ID: 1011498418

View in Genome Browser
Species Human (GRCh38)
Location 6:87961664-87961686
Sequence CATCATAGGGAGACTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011498418_1011498424 15 Left 1011498418 6:87961664-87961686 CCAGGCACAGTCTCCCTATGATG No data
Right 1011498424 6:87961702-87961724 GGACCTCTGGTCTTGTCTGCTGG No data
1011498418_1011498422 -6 Left 1011498418 6:87961664-87961686 CCAGGCACAGTCTCCCTATGATG No data
Right 1011498422 6:87961681-87961703 ATGATGTAATGGTCACTGCATGG No data
1011498418_1011498425 16 Left 1011498418 6:87961664-87961686 CCAGGCACAGTCTCCCTATGATG No data
Right 1011498425 6:87961703-87961725 GACCTCTGGTCTTGTCTGCTGGG No data
1011498418_1011498423 2 Left 1011498418 6:87961664-87961686 CCAGGCACAGTCTCCCTATGATG No data
Right 1011498423 6:87961689-87961711 ATGGTCACTGCATGGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011498418 Original CRISPR CATCATAGGGAGACTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr