ID: 1011501904

View in Genome Browser
Species Human (GRCh38)
Location 6:87999858-87999880
Sequence ATGAAAAAGCAGCAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011501900_1011501904 8 Left 1011501900 6:87999827-87999849 CCAGGGACACAAGTATACAAGGG No data
Right 1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011501904 Original CRISPR ATGAAAAAGCAGCAAGAGGA TGG Intergenic
No off target data available for this crispr