ID: 1011507710

View in Genome Browser
Species Human (GRCh38)
Location 6:88066556-88066578
Sequence GCTTGGGGATATTTATCTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011507710 Original CRISPR GCTTGGGGATATTTATCTAA AGG Exonic
901587764 1:10312479-10312501 GTCTGGGGATATTATTCTAATGG - Intronic
911338602 1:96610262-96610284 GCATTGGGAGATATATCTAATGG + Intergenic
918489822 1:185069494-185069516 ATTTGAGGCTATTTATCTAAGGG + Intronic
918869915 1:189957270-189957292 GCTTTGGGATATTTTCCTAGTGG + Intergenic
918917031 1:190655530-190655552 GGTAGTGGATATTTAACTAATGG - Intergenic
921021731 1:211242079-211242101 GCCTGGGCATATTTTTCTCATGG - Intergenic
1063982486 10:11465797-11465819 GATTGGGGATATAGAGCTAAGGG - Intronic
1064407393 10:15076197-15076219 TTTGGGGGATATTTATCTTAAGG + Intergenic
1065214066 10:23433018-23433040 CCTTTGGGCTATTTATCAAAAGG + Intergenic
1066192932 10:33072329-33072351 TCTGGGAGATATTTAACTAAGGG + Intergenic
1067161660 10:43830469-43830491 GCTTGTGGATATATAGCCAAAGG + Intergenic
1070641382 10:78172901-78172923 ACCTGTGGATATTTGTCTAAGGG + Intergenic
1071669049 10:87590010-87590032 GCTGGAGGATATTTATCTAGTGG - Intergenic
1072319273 10:94233023-94233045 GCTTGGGAATATTTCTCTGGGGG - Intronic
1077450612 11:2641167-2641189 ACTACTGGATATTTATCTAAAGG - Intronic
1079437954 11:20476968-20476990 GCTAGGAGATATTCTTCTAAGGG - Intronic
1080851037 11:36070454-36070476 CCTTGTGGATATTTATCTCATGG + Intronic
1081440179 11:43072247-43072269 CCTTGGGGTTCTTTATCTGAGGG - Intergenic
1082721051 11:56677089-56677111 ACTTCTGGATATATATCTAAAGG - Intergenic
1084986810 11:72881529-72881551 TCTTTTGGATATTTATCCAAAGG + Intronic
1085992110 11:81861533-81861555 ACTTCTGGGTATTTATCTAAAGG + Intergenic
1088336300 11:108707989-108708011 CCTTGGTAATATTTATCCAAAGG - Intronic
1088785638 11:113179146-113179168 GCTGGTGAATATTTATCAAAAGG - Intronic
1089906721 11:122047715-122047737 GCTTTTGGATATATATCCAAAGG - Intergenic
1091815108 12:3431869-3431891 GCTTGAGCATATTTACCTACTGG + Intronic
1092761577 12:11815752-11815774 GCTTGGGGATATTTGTGAACAGG + Intronic
1093129141 12:15368672-15368694 GTTTGGAGAAATTTATCTAGAGG - Intronic
1095549118 12:43412316-43412338 GCTTGAGCATTTTTATTTAAAGG + Intronic
1095604247 12:44047712-44047734 AATTGGGGATTTTTCTCTAAGGG - Intronic
1097781541 12:63712036-63712058 ATTTGTGGATATTTATCTCATGG + Intergenic
1098429516 12:70404163-70404185 GCTTGGGGTTAGATTTCTAATGG + Intronic
1098499610 12:71176033-71176055 GTTTGGGGCTTTTTGTCTAATGG - Intronic
1098605019 12:72379969-72379991 GCTTAGGGGTTTTTATGTAAGGG - Intronic
1106723624 13:32462083-32462105 ACCTTGGGATATTTATCCAAAGG + Intronic
1107896827 13:44973474-44973496 GCTTGAAGATATTTTTCTTATGG - Intronic
1108150675 13:47530764-47530786 GCTTGGGGGTATATACCCAAAGG + Intergenic
1108440366 13:50447119-50447141 ACTTCTGGATATTTATCCAAAGG - Intronic
1108539340 13:51423426-51423448 GCTTAGGAATTTTTATCCAAAGG - Intronic
1109053266 13:57511951-57511973 GTTTGGGCAAATTTTTCTAATGG + Intergenic
1109439825 13:62354964-62354986 ACTTCTGGATATATATCTAAAGG + Intergenic
1110944209 13:81392341-81392363 ACTACCGGATATTTATCTAAAGG - Intergenic
1112382775 13:98908533-98908555 GCTTGCTGATATGTATGTAAGGG + Intronic
1112457886 13:99578205-99578227 GCTTGGGTATTTTTATCTGTAGG + Intergenic
1115057489 14:29147877-29147899 TATTGGAGATATTTACCTAAAGG + Intergenic
1115714850 14:36092155-36092177 TCTTGGTTAAATTTATCTAAAGG + Intergenic
1116300622 14:43177139-43177161 TCCTGCAGATATTTATCTAAAGG - Intergenic
1116582079 14:46654464-46654486 GCTTTGAGATATATAGCTAAGGG + Intergenic
1116722303 14:48514137-48514159 GCTTCTGGATATATATCCAAAGG - Intergenic
1117016063 14:51518347-51518369 GCAAGGGGATTTTTCTCTAAGGG + Intronic
1126307251 15:47274008-47274030 GCTTGGGGGTATGGACCTAAAGG + Intronic
1130820011 15:87485302-87485324 GCTTTGGGACATATACCTAATGG - Intergenic
1140884957 16:79234941-79234963 CCTTGGGGATGTTTCTCTCATGG - Intergenic
1144266190 17:13572193-13572215 GTTTAGGGATATTTCTCTAAAGG + Intronic
1147805778 17:43130007-43130029 ACTGGGGGATAATTATCTTAGGG + Intergenic
1148709219 17:49664936-49664958 GCCAGGGGAGATTTATCTAAAGG - Intronic
1151023195 17:70643541-70643563 ACTTGGGAATATCTATCTAAAGG + Intergenic
1155860047 18:30886587-30886609 GTTTGGGGATCTCTGTCTAAGGG - Intergenic
1156389205 18:36634953-36634975 ACTTGGGAAGATTTATCTGATGG + Intronic
1156588850 18:38463043-38463065 GCTGAGAGTTATTTATCTAAAGG + Intergenic
1156924771 18:42562840-42562862 ACTTCTGGATATATATCTAAAGG - Intergenic
1157186127 18:45541329-45541351 GGTTTGGGAGATTTGTCTAAAGG - Intronic
1162695864 19:12474525-12474547 GCTTCTCCATATTTATCTAAAGG - Intronic
925805208 2:7641532-7641554 GCCTGGAGATATTTACCTCATGG + Intergenic
926359681 2:12074508-12074530 GCTTAGGAATACTTATCTCATGG - Intergenic
933027884 2:77285050-77285072 GGTTCAGGATATTTAACTAAAGG + Intronic
933656614 2:84893949-84893971 GCTGGGTGATATTTATATATGGG - Intronic
934581944 2:95449707-95449729 GCTTGGGGATATTTGATGAAAGG - Intergenic
934597506 2:95627007-95627029 GCTTGGGGATATTTGATGAAAGG + Intergenic
940568695 2:155403204-155403226 GCTGGGGGATATGTATGTAAGGG + Intergenic
941251746 2:163173548-163173570 AGTTGTGGATATTTCTCTAAGGG - Intergenic
942466383 2:176211742-176211764 GCTTGGGGGTATTTCTGGAATGG + Intergenic
943782859 2:191844497-191844519 CCTTGGGGATTGTTTTCTAAAGG + Intronic
943879426 2:193121067-193121089 GTTTGGGAACATTTATCTTAGGG - Intergenic
947449041 2:230188675-230188697 TGTTGAGGATCTTTATCTAAAGG + Intronic
1170861509 20:20108445-20108467 GCTTCTGCATATCTATCTAAGGG - Intronic
1172793239 20:37520485-37520507 GCTTGGGGATAGTTTTCTGCTGG - Intronic
1173002389 20:39113857-39113879 CCTTGGAGATAAATATCTAAGGG - Intergenic
1173722863 20:45274798-45274820 GATTGTGGATATTCATATAATGG - Intergenic
1176358964 21:5976839-5976861 ACTTCTGGATATTTATCCAAAGG - Intergenic
1179764554 21:43561711-43561733 ACTTCTGGATATTTATCCAAAGG + Intronic
1182956080 22:34427802-34427824 GCTTGGGGATAATTTTCTAGTGG + Intergenic
1183798956 22:40145489-40145511 GGTTGGAGATATTTATAAAATGG + Intronic
949274784 3:2266540-2266562 GCTGGGGGATTTTTAAGTAAGGG + Intronic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
953970137 3:47340889-47340911 GCTTGGAAATACTTATTTAATGG + Intronic
954446563 3:50550058-50550080 GCTCAGGGCTATTTATCAAATGG - Intergenic
955178370 3:56640610-56640632 GTTTTGGGATATTTATTTCAAGG - Intronic
956820682 3:72951072-72951094 GATGTGGGATATTTATCGAAAGG - Intronic
957426181 3:80043014-80043036 ATTTGGGAATATATATCTAATGG - Intergenic
958200325 3:90307190-90307212 GCTTTGGGAGATATACCTAATGG - Intergenic
958960955 3:100509425-100509447 GCTACTGGATATTTATCCAAAGG + Intronic
960500970 3:118437744-118437766 GCCTTTGGATATCTATCTAAAGG + Intergenic
961096151 3:124158553-124158575 GTTTGGGGATTTTTATGCAAAGG + Intronic
962654147 3:137525537-137525559 GGTGGGGGTTATCTATCTAAAGG - Intergenic
968396032 4:239365-239387 GCTTGCCGATATTTATTTAATGG - Intergenic
968415016 4:424225-424247 GCTTGCCAATATTTATTTAATGG - Intergenic
970703094 4:18766313-18766335 CCTTTGGGATATATATCCAAAGG - Intergenic
971623066 4:28882201-28882223 CCTTGGGGATATTTTTGTACAGG + Intergenic
974222128 4:58988684-58988706 TCTTGGGGATGTTTTTCTCATGG - Intergenic
975758189 4:77592077-77592099 ACTTCTGGATATTTATCCAAAGG + Intronic
981012145 4:139936387-139936409 GCTTCCGGATATGTATCTAAAGG - Intronic
981272859 4:142865059-142865081 GATGGTGGATATTTATCTAATGG - Intergenic
983164361 4:164457626-164457648 ACTTCTGGATATTTATCCAAAGG + Intergenic
984443918 4:179809221-179809243 GCTATGGGATATATATCCAAAGG + Intergenic
986232814 5:5882591-5882613 GCTTGAGGATAGTAAGCTAAAGG - Intergenic
987188228 5:15446427-15446449 CCTTTGTGATATTTACCTAAGGG - Intergenic
987477807 5:18413432-18413454 GCATGGGCCTATTTATCTGAAGG + Intergenic
989432455 5:41371703-41371725 GCCTGGGGATCTTTGGCTAAAGG + Intronic
989489881 5:42037859-42037881 CCTTGGGGAGATTTATTTGATGG + Intergenic
989531491 5:42512972-42512994 TCTGGGGGATATTTTTTTAAAGG + Intronic
989759005 5:44989664-44989686 TATTGGGCATATTTATCCAATGG + Intergenic
993930208 5:93929096-93929118 GATTCTGGATATGTATCTAATGG - Intronic
995932431 5:117463898-117463920 GCTTAGGGATATTTATCCAGTGG + Intergenic
999894861 5:156021048-156021070 GCTTGAGGACATTTATCTTCTGG + Intronic
1002958907 6:1896096-1896118 GCTTGAGGATGATTATGTAAGGG + Intronic
1004778546 6:18877569-18877591 CCTTGGGTATTTTTATTTAAAGG + Intergenic
1010016154 6:71106755-71106777 TCTGGGGGATATTTCCCTAAAGG - Intergenic
1010716820 6:79239609-79239631 GCTTGTGGCTTTTTACCTAAGGG - Intergenic
1011507710 6:88066556-88066578 GCTTGGGGATATTTATCTAAAGG + Exonic
1013380264 6:109561819-109561841 GCTTGAGCATATTTATTTATTGG + Intronic
1014343865 6:120242866-120242888 ATTTGGGGATATTTATGTTATGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020901299 7:14006915-14006937 GGTTTGGGATATTTGACTAAAGG + Intergenic
1022940138 7:35228129-35228151 ATTTGTGGATATTTATCTTATGG + Intronic
1023007034 7:35882106-35882128 ACTTGGGAATTTATATCTAAAGG + Intronic
1023013830 7:35945918-35945940 ACTTGGAGATTTATATCTAAAGG + Intergenic
1024067160 7:45749065-45749087 ACTTGGAGATTTATATCTAAAGG - Intergenic
1024833944 7:53494657-53494679 ACTTTGGGGTATATATCTAAAGG - Intergenic
1028737158 7:94228861-94228883 ACCTAGGGATATTTTTCTAATGG - Intergenic
1029336600 7:99905490-99905512 GCTTTGGTATATTAATATAATGG + Intronic
1030436589 7:109529704-109529726 GCCTGGGGGTAATTATTTAAAGG - Intergenic
1031230384 7:119098149-119098171 ATTTGGGGATATATATCCAAAGG - Intergenic
1031329015 7:120439997-120440019 GCTCCTGGATATTTATCCAAAGG - Intronic
1031660294 7:124415990-124416012 GCTTGGGGATCTGCAACTAAAGG + Intergenic
1032271868 7:130416190-130416212 GCTAGGGGATATTTAGTTAATGG - Intronic
1032517861 7:132520297-132520319 GCTTGGTCCTTTTTATCTAAGGG - Intronic
1039032930 8:33329273-33329295 GATTGGGCATACTTATCTATGGG + Intergenic
1043850225 8:85207890-85207912 ACTTGGGGATAGATATCTTAGGG - Intronic
1046457095 8:114480697-114480719 CCTTGGGGATGTTTACTTAAAGG - Intergenic
1050941436 9:11464178-11464200 GCTTCTGGATATATATTTAAAGG - Intergenic
1051524139 9:18023601-18023623 GCTTTGGGATTTTTATCTGTTGG + Intergenic
1052971124 9:34377665-34377687 GCTTGGGCATTTCTAACTAAAGG - Intergenic
1053172147 9:35895610-35895632 GCTTCTGAATATTTTTCTAAAGG + Intergenic
1053439676 9:38105940-38105962 GATAGGGGATATTGAGCTAAAGG - Intergenic
1058212504 9:102187402-102187424 TCTTGGGTATATTTTTCAAAAGG + Intergenic
1058631874 9:106997316-106997338 ACTTCTGGATATTTAACTAAAGG + Intronic
1058652258 9:107187584-107187606 ACTGTTGGATATTTATCTAAAGG + Intergenic
1060692002 9:125670711-125670733 GCTGGGTGGTATTTCTCTAAAGG - Intronic
1061566761 9:131445935-131445957 GCTGGGGGATCTTTATTAAAAGG + Intronic
1187817983 X:23254113-23254135 GCTTCTGGATATATATCCAAAGG + Intergenic
1188637893 X:32458493-32458515 GCTTCTGGATATATATCCAAAGG - Intronic
1188748960 X:33882101-33882123 GCTATGGGTTATTTATCTACAGG + Intergenic
1192792603 X:74398013-74398035 GCTTGGGGATATTTCTCTAAAGG + Intergenic
1195680694 X:107543861-107543883 ACTTGTGGATATATATCCAAGGG + Intronic
1198941295 X:141959183-141959205 GCTTTGGTAGATTTTTCTAATGG + Intergenic
1199120236 X:144043938-144043960 ATGTGGTGATATTTATCTAATGG - Intergenic