ID: 1011509577

View in Genome Browser
Species Human (GRCh38)
Location 6:88085867-88085889
Sequence TGTCCATTGCTAATCGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011509577_1011509580 -4 Left 1011509577 6:88085867-88085889 CCTCCCACGATTAGCAATGGACA No data
Right 1011509580 6:88085886-88085908 GACATAAAGCAATAGTGTTCTGG No data
1011509577_1011509582 19 Left 1011509577 6:88085867-88085889 CCTCCCACGATTAGCAATGGACA No data
Right 1011509582 6:88085909-88085931 AGAGGAATTAGCATATCTCTTGG No data
1011509577_1011509581 1 Left 1011509577 6:88085867-88085889 CCTCCCACGATTAGCAATGGACA No data
Right 1011509581 6:88085891-88085913 AAAGCAATAGTGTTCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011509577 Original CRISPR TGTCCATTGCTAATCGTGGG AGG (reversed) Intergenic
No off target data available for this crispr