ID: 1011515646

View in Genome Browser
Species Human (GRCh38)
Location 6:88149656-88149678
Sequence AGGGACAAGGTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1681
Summary {0: 1, 1: 1, 2: 12, 3: 139, 4: 1528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011515646_1011515654 26 Left 1011515646 6:88149656-88149678 CCTTCCTCCTTCACCTTGTCCCT 0: 1
1: 1
2: 12
3: 139
4: 1528
Right 1011515654 6:88149705-88149727 CCTACTAAACTTATCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011515646 Original CRISPR AGGGACAAGGTGAAGGAGGA AGG (reversed) Intronic
900204456 1:1426143-1426165 AGGGAGACGGAGGAGGAGGAGGG + Exonic
900682468 1:3924524-3924546 AGGGACCCTGGGAAGGAGGAAGG - Intergenic
900701937 1:4053872-4053894 GGGGACAAGGTGCAGAGGGAAGG + Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901058850 1:6462362-6462384 GGGGACAAGAGGAAGGAGGCGGG - Intronic
901137425 1:7007097-7007119 AGGGCCAAGGGGATGGATGATGG + Intronic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901309750 1:8260055-8260077 AGGGAAGAAGGGAAGGAGGAAGG - Intergenic
901519061 1:9768910-9768932 AGGGAGAAAGTAAAGGAGAAAGG + Intronic
901952189 1:12758098-12758120 AGGAACAAGGTGGAGGGGCAGGG - Intronic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902499624 1:16901119-16901141 AGGGATAAGGTGTAGGGGCAGGG - Intronic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903070797 1:20726182-20726204 AGGGCCCATGTGAAGGATGAGGG - Intronic
903283611 1:22263906-22263928 AAGGACTCGGTGGAGGAGGATGG - Intergenic
903377414 1:22875619-22875641 AGGGAGAAAGTGAGGAAGGAAGG - Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903555380 1:24189033-24189055 AGGCGCAGGGTGGAGGAGGATGG + Intergenic
903632852 1:24789977-24789999 AGGGAAAAGGAGAAGGGAGATGG + Intronic
903714698 1:25356264-25356286 AGGGACAGGGTAAAGAAAGAGGG - Intronic
903737117 1:25537138-25537160 AGGGACAAAGTGAAGGGGCCAGG - Intergenic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904172780 1:28603172-28603194 AGGGAAAAGGGGAAGGGAGAAGG + Exonic
904183180 1:28681430-28681452 AGGGAGAAGATGAGGGAGAAAGG + Intronic
904295747 1:29518784-29518806 GGAGAAAAGGAGAAGGAGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904482034 1:30800156-30800178 AGGGAAAGAGGGAAGGAGGAAGG + Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905799942 1:40837041-40837063 GGGGAAAAGGGGAAAGAGGATGG - Intronic
905828459 1:41045413-41045435 AGGGAAAGGGGGAAGGAGAATGG + Intronic
905898305 1:41563427-41563449 AGGGAGGAGGGGAAGAAGGAGGG - Intronic
905934145 1:41810476-41810498 AGGGACTAGGAGATGGTGGATGG - Intronic
906006076 1:42471665-42471687 GGGGACCAGGTGAAGGAGGTCGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906381180 1:45332982-45333004 AGAGACAAGGTCAAGGGTGAAGG + Intronic
906538488 1:46565907-46565929 AGAGAAAAGGGGAGGGAGGAAGG - Intronic
906653186 1:47527991-47528013 AGAAACAAGGGGAAGGAGGGAGG + Intergenic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907239386 1:53072648-53072670 AGGGAAAATGTCAAGGAGGCAGG - Intronic
907302408 1:53496553-53496575 AGGGTCAAGGTGGAGGAAGCAGG + Intergenic
907303532 1:53502196-53502218 AGGGACAAGGAGGCGGGGGAGGG + Intergenic
907621285 1:55983443-55983465 AAGGACAAGGCGAAGGGGAAGGG + Intergenic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907912793 1:58841495-58841517 AGGGACAAGTGGAAGGAAGGTGG + Intergenic
907915128 1:58861327-58861349 AGGGAAGAAGTGAGGGAGGAAGG + Intergenic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908702613 1:66919035-66919057 AGGGACAACTTGAAGCAGGGAGG - Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909687843 1:78371165-78371187 AGGTAAATGTTGAAGGAGGAAGG - Intronic
909772185 1:79437704-79437726 AGAGAGAGAGTGAAGGAGGAAGG - Intergenic
909897740 1:81094085-81094107 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
909969619 1:81966028-81966050 AGGGAAAAGATAAAGGAGGTGGG - Intronic
910135677 1:83966346-83966368 AGAGACAGAGGGAAGGAGGAGGG - Intronic
910297481 1:85664609-85664631 AGGAACTAGGTGAAGGTGGAGGG + Intronic
910445478 1:87295407-87295429 AGGGAAAAGGGTCAGGAGGAAGG - Intergenic
910548007 1:88440887-88440909 AGAGAAAAAGGGAAGGAGGAGGG + Intergenic
910646110 1:89517186-89517208 AGGGACAAGGCCAATGAGGCTGG + Intergenic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
910773661 1:90853504-90853526 AGGCACAAGGTGAAGGTGCTGGG - Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911453259 1:98092969-98092991 AGGGACAGTGAGAAGGAGCATGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912070430 1:105802216-105802238 AGGGACCTGGTGGAGGATGATGG - Intergenic
912548713 1:110470146-110470168 AGGGAATAGGGGAAGAAGGAAGG - Intergenic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
912711453 1:111952828-111952850 AGAGACAAGGGGATGGAGGAGGG + Intronic
913008873 1:114662983-114663005 AGGGAAAAGGAAAGGGAGGAAGG + Intronic
913153135 1:116065641-116065663 AGGGAGAAGGGGGAGGAGAAGGG - Intronic
913428869 1:118766774-118766796 AAGGAAAAGGTGGAGGAGCAGGG - Intergenic
914004913 1:143724028-143724050 AGGGACAAGGTGTAGGGGCAGGG + Intergenic
914513416 1:148353854-148353876 AGGGACACGGGAGAGGAGGAGGG - Intergenic
914799648 1:150951184-150951206 AGGGAGGAGGTAAAGGAAGATGG - Intronic
914825201 1:151134455-151134477 AGGGACAGGGTGAAGATGGGGGG + Intronic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915164344 1:153940320-153940342 AGGCACAAAGTGAGGGAGGCTGG - Intronic
915311703 1:155008553-155008575 TGGGACCAGGAGAAGGAAGAAGG - Intronic
915643231 1:157246128-157246150 AGTCACAAGGTGAAGGCAGAAGG - Intergenic
915650124 1:157303567-157303589 AGGGAGAAGGTGCATGAAGATGG + Intergenic
915994858 1:160552016-160552038 AGGGTCAAGGTGAAAAAAGAAGG + Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916578737 1:166089410-166089432 AGCGACAAGGGGCAAGAGGATGG + Intronic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916754663 1:167757546-167757568 TGGGACAGGGTGGAGGAGGCAGG - Intronic
916772345 1:167923532-167923554 AGGGACTGGGAGAAGGAGAATGG + Intronic
916809244 1:168291219-168291241 AGGGACAAAGTCCAGCAGGAGGG - Exonic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917514893 1:175699054-175699076 AGGCACAAGGTGATGGAGACAGG + Intronic
917922798 1:179765096-179765118 AGGGAAGAGGTGGACGAGGAAGG - Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919188014 1:194179928-194179950 AGGGACATGGTGAAGTCAGAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919835872 1:201572936-201572958 AGGGGCAAGATGGAGTAGGAAGG - Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920112858 1:203599308-203599330 AGGGTCTAGGGGAAGGAGAAAGG - Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920220155 1:204391276-204391298 AGGGACACGAGGCAGGAGGACGG + Intergenic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920679327 1:208060515-208060537 AGGGTGGAGGTGAGGGAGGAGGG + Intronic
920823367 1:209401952-209401974 AGGGACAGGGTGAAGGGACAGGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921396851 1:214677788-214677810 AGGGAGAAGGGGGAGGAGAAGGG - Intergenic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
921906506 1:220501090-220501112 AGGGGCAAGGTGAAGTACAAAGG - Intergenic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922430673 1:225549359-225549381 AGAGACAGAGTGAAAGAGGATGG - Intronic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922535821 1:226379921-226379943 AAGGGCCAGGTCAAGGAGGAAGG - Exonic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922720270 1:227896707-227896729 AGGGACAGGGTGAGGGCAGATGG + Intergenic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923109470 1:230879627-230879649 AGGGGCAGGGTGACTGAGGAGGG - Intergenic
923109483 1:230879665-230879687 AGGGGCAGGGTGATTGAGGAGGG - Intergenic
923235773 1:232031416-232031438 AGAGACAAGGGAAAGGAGAAGGG + Intronic
923235778 1:232031435-232031457 AGGGAAAAGGGAAAGGAGAAGGG + Intronic
923333495 1:232947125-232947147 AGGGACAAGGGGAAGTGAGAGGG - Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924206171 1:241713354-241713376 AGGGACAGAGGGAGGGAGGAAGG + Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
924529467 1:244881143-244881165 ATTGACAAGTTGAGGGAGGAAGG + Intergenic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062763404 10:44667-44689 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1062970504 10:1644458-1644480 AGGGAGAAGGAGAAGGACAAAGG + Intronic
1063057047 10:2517036-2517058 AGGGACAATGGAAAGAAGGAGGG - Intergenic
1063216284 10:3928970-3928992 TGGGACCAGGAGAAGGAGAAAGG + Intergenic
1063564200 10:7158077-7158099 AGGGACAGGGTTAAGGGAGAAGG - Intergenic
1063604092 10:7507909-7507931 AGGCAGAAGGTGCAGGTGGACGG + Intergenic
1063665195 10:8056443-8056465 TGGGAAAAGGTCAAGGAGAAGGG - Intronic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064214483 10:13388092-13388114 AGGGAGATGGTGGAAGAGGAGGG + Intergenic
1064509715 10:16076760-16076782 AGAGACAAGGTGAAGGACTAAGG + Intergenic
1064586275 10:16842592-16842614 TGGGAACAGGTGAAGGACGATGG - Intronic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065190583 10:23204408-23204430 AGAGAGACGGTGAAGGAGGTAGG + Intronic
1065259284 10:23908106-23908128 AGAGGCAAGGTGAAGGCAGATGG + Intronic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065641521 10:27787338-27787360 AGGCAGAAGGTGGAGGAGGGAGG - Intergenic
1065746134 10:28844274-28844296 AGGGGCAAGGTATAGGAGCAGGG + Intergenic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1066321549 10:34308147-34308169 AGGGACAAGGTCAAAGAGGCTGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066596194 10:37052579-37052601 AGGGAGAAAGGGAGGGAGGAGGG + Intergenic
1066598498 10:37078147-37078169 AGGGGCAGGGAGAGGGAGGAAGG - Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067291310 10:44945284-44945306 AGAGACCAGGTGAAAAAGGAGGG - Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067856875 10:49801974-49801996 AGGGACCAGGTGAAGAGTGAGGG - Intergenic
1067949174 10:50712689-50712711 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069706081 10:70459737-70459759 AGACACAAGGTGAAAGTGGAAGG + Intergenic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070495835 10:77021459-77021481 AGGGACAAAGTGGAGGGTGATGG - Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1070884489 10:79877701-79877723 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1070888592 10:79925750-79925772 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071516343 10:86300457-86300479 AGGGAACAGGGGAGGGAGGAAGG + Intronic
1071720937 10:88145594-88145616 AGGGAAAAAGGGAAGGAGGAAGG - Intergenic
1071869003 10:89771166-89771188 AGTGACAGGGTGATGAAGGAAGG - Intronic
1072405321 10:95146987-95147009 AGGGACAAAGGGAAAGAGGGTGG - Intergenic
1073045906 10:100638032-100638054 GGGGACAATGTGAGGCAGGAGGG + Intergenic
1073101266 10:101007933-101007955 GGAGAAAAGGTGATGGAGGAAGG + Intronic
1073327203 10:102649899-102649921 AGGGACCAGGGGGAGGAGTAGGG + Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074085846 10:110208631-110208653 AGGAAAAAGGCGAAGTAGGAGGG - Intronic
1074290954 10:112137691-112137713 AGGGACAAGGGGAGGGATGCTGG - Intergenic
1074419928 10:113299745-113299767 AGGAGGAAGGTGAGGGAGGAAGG + Intergenic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1074706272 10:116134985-116135007 AAGGAAAAGGTGGAGGAGGTTGG - Intronic
1074756712 10:116629158-116629180 AGGCACTGGGTGAAGGATGAGGG + Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075111927 10:119595231-119595253 AGGGAATAGATGAAGGTGGAGGG - Intronic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075455686 10:122583383-122583405 GGTCACAAGGTGAGGGAGGAAGG + Intronic
1075457809 10:122596086-122596108 GGTCACAAGGTGAGGGAGGAAGG + Intronic
1076109410 10:127849448-127849470 ACGGACAAGGGGCATGAGGAGGG + Intergenic
1076196648 10:128523276-128523298 AGGGACAAGCTTGAGGAGGAAGG - Intergenic
1076218043 10:128711449-128711471 AGGGACAAAGTGGAGGAGCAGGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077280415 11:1742409-1742431 AGAGACAAGGTGGATGAGGAAGG + Intronic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1077426419 11:2480913-2480935 AGGGACAGGATGGAGCAGGACGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077632092 11:3817639-3817661 AGGGACAAGGGGATGGGGGAAGG + Intronic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077644559 11:3912098-3912120 AGGGAGAAGGGAAAGGAGAAGGG - Intronic
1077693432 11:4370466-4370488 AGAGAAAAGGAGCAGGAGGAAGG - Intergenic
1077959526 11:7059864-7059886 AAGGACAATGTGAAGAAAGATGG - Intronic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078484021 11:11705385-11705407 AGGGAGAAAGGGAAGGAGGGAGG + Intergenic
1078488563 11:11747690-11747712 AGGGACAGAGGGAAGGAGGGAGG + Intergenic
1078605750 11:12774066-12774088 AGTGACAGGGTGAAGCTGGAGGG + Intronic
1078617251 11:12877741-12877763 GGAGAAAAGGGGAAGGAGGAAGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079408327 11:20163917-20163939 ACGGGCGAGGCGAAGGAGGAGGG + Intergenic
1079511631 11:21217119-21217141 AAGTACAGGGTGAAGGAGGGGGG - Intronic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1079675004 11:23215981-23216003 AGGGACAAGATAAAGGAGAAAGG + Intergenic
1079761591 11:24336001-24336023 AGGGAGGGGGTGAGGGAGGAAGG - Intergenic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080960805 11:37157640-37157662 AAGGACAAGATGAGGGAAGAAGG - Intergenic
1081570519 11:44287733-44287755 GGAGACAGGGTCAAGGAGGAAGG + Intronic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082735887 11:56855063-56855085 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083187123 11:61024236-61024258 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1083419606 11:62545718-62545740 AGGGGCAAAGGGGAGGAGGAAGG - Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083541357 11:63513743-63513765 AGGGATGAGGTGAAGAAGGAGGG - Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1083989873 11:66240414-66240436 AGGGAAGAGGCGAAGGCGGAAGG - Intronic
1084093090 11:66892125-66892147 AATGACAAGTTGAAGAAGGAAGG + Intronic
1084163792 11:67365644-67365666 AGGGTGATGGGGAAGGAGGAGGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084666769 11:70580588-70580610 GGGCTCAAGATGAAGGAGGAGGG + Intronic
1084679989 11:70661394-70661416 AGGCACAATGTGAAGGAACATGG + Intronic
1084725674 11:70940202-70940224 AGGGAGGAAGGGAAGGAGGAAGG - Intronic
1084726414 11:70945338-70945360 AGGGAGGAGGTGAAGGCAGAAGG + Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085159998 11:74331826-74331848 AGGGGCATGATGAAGGGGGAAGG - Exonic
1085502722 11:77038125-77038147 AGGGAGGAGGGGGAGGAGGAGGG + Intronic
1085891399 11:80584393-80584415 AGAGGCGAGGGGAAGGAGGAAGG + Intergenic
1086046093 11:82533782-82533804 AGGGATTAGGTGGGGGAGGAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1087912254 11:103767742-103767764 AGGGTGAAGGTGAAGGAGTGTGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1089295192 11:117463157-117463179 AGGCACAAGGTGAAGCAGGAAGG + Intronic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089455063 11:118621311-118621333 AGGGACAAAGGAGAGGAGGAGGG - Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089625644 11:119749132-119749154 ATGGAAGAGGTGAAGGAGAAGGG - Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090393188 11:126402763-126402785 GGGGACAAGGTGAAGAAATAAGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1091038115 11:132252093-132252115 AGGGAAAAGGAGAGGTAGGAGGG - Intronic
1091143642 11:133258403-133258425 AGGGCATAGGTGAAGGAAGAAGG + Intronic
1091306231 11:134538004-134538026 AGTGACAAGGTGCAGGTGGAGGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091493568 12:952958-952980 AGGGAAAAGGGGAAGGGGAAGGG + Intronic
1091616877 12:2056145-2056167 ACGGAAAAGGTGAGGGAGCAAGG - Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092127724 12:6086617-6086639 AGAGGCAAGGAGAAGAAGGAGGG + Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1092205704 12:6613294-6613316 AGGGAGAAGGGGAAGGACGGTGG + Intergenic
1092217563 12:6693908-6693930 AGGGAAGAAGGGAAGGAGGAAGG + Exonic
1092778613 12:11965178-11965200 AGGGAGAAAGTGAGGAAGGAAGG - Intergenic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093564239 12:20582998-20583020 AGGGAAAAAGTGAAGGATAAGGG - Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094684112 12:32694016-32694038 AGGGACAGAGTGAAGAAGAATGG - Intronic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1094848486 12:34371931-34371953 GGGGACAAGCTGAAGGTGGCAGG - Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096193471 12:49634447-49634469 AGGGACAAGGTGCTGGAGTGGGG + Exonic
1096197377 12:49657331-49657353 AGGGACAGGGTGCAGGAGGCAGG + Intronic
1096214680 12:49792595-49792617 AGGAACAAAGGGAAGGTGGATGG + Intronic
1096229888 12:49890899-49890921 AGGCACCAGGTAAAGGAGGGAGG + Intronic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096595017 12:52689490-52689512 AGGGAGTAGGGGGAGGAGGAGGG + Intergenic
1096619021 12:52850886-52850908 TGGGGCCAGGGGAAGGAGGAAGG - Intergenic
1096725829 12:53561589-53561611 AGGGAAAGGGAGAAGAAGGAAGG + Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1096803994 12:54129222-54129244 AGGGACAAGGGAAAGAAGCAAGG + Intergenic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1097235477 12:57536437-57536459 AGGGACAGGGAGAAGGGGCAAGG + Intronic
1097724041 12:63053908-63053930 AGGGAAAGGGGGAAGAAGGAAGG - Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099868068 12:88309507-88309529 AGGGAGAAAGTAAGGGAGGAAGG - Intergenic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100982210 12:100170724-100170746 AGTGCCAAGTTGAAGGATGATGG + Intergenic
1101735339 12:107458972-107458994 GGGGAGTAGGTGAAGGAGGCAGG - Intronic
1102027885 12:109723764-109723786 CGGGACAAGATTCAGGAGGAGGG - Intronic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102397054 12:112595501-112595523 AGGCAAAAGGGGAAGGAGGAGGG - Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102549787 12:113683574-113683596 AGGGACCAGGGGGTGGAGGAAGG - Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102902329 12:116648011-116648033 AGGCAGAGGATGAAGGAGGAAGG - Intergenic
1103030215 12:117606655-117606677 AGGGAGGAAGGGAAGGAGGAGGG - Intronic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103222482 12:119257381-119257403 AGGGAGAAGGGGAGGGAAGAAGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103451319 12:121031397-121031419 AGGGGCAAGGAGAGGGAAGAGGG - Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104066804 12:125313486-125313508 AGAGAGAAAGGGAAGGAGGAAGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104553137 12:129775738-129775760 GGGGACAGAGTGTAGGAGGAGGG - Intronic
1104565926 12:129883044-129883066 AGGGAAAAGGGAAAGAAGGAGGG + Intronic
1104671165 12:130681484-130681506 AGGGAATAGGGGAGGGAGGAAGG - Intronic
1104781279 12:131422101-131422123 AGGGGACAGGTGGAGGAGGAGGG - Intergenic
1104992161 12:132631841-132631863 TGGGACCAGGTGCAGGAGGAGGG - Intronic
1105750296 13:23416910-23416932 AGGGAGGAGGGGAAGGAAGAGGG + Intronic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106048664 13:26169312-26169334 AGGGAGAAGGGCAAGGAGTAGGG + Intronic
1106135034 13:26967551-26967573 TGGGATAGGGGGAAGGAGGAGGG + Intergenic
1106193580 13:27474979-27475001 AGGGACACAGAGAAGGAAGAGGG + Intergenic
1106232966 13:27836123-27836145 AGGGACAAGATGCGGGAGAAAGG - Intergenic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106681446 13:32012537-32012559 AGGAATAAAGTGAAGGATGAGGG - Intergenic
1106793188 13:33177721-33177743 AGGGAGAAAGGGAGGGAGGAAGG + Intronic
1106840859 13:33683665-33683687 GGGGAGAAGGTGAGGGAGGTGGG + Intergenic
1106927277 13:34626192-34626214 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1107017951 13:35723038-35723060 AGGCACGAAGTGAAGGAGGATGG + Intergenic
1107021220 13:35753966-35753988 AGGGAGAGAGGGAAGGAGGAAGG - Intergenic
1107088642 13:36452102-36452124 AGGGACAGAGGGAGGGAGGAAGG - Intergenic
1107739180 13:43431373-43431395 AGGGCCCAGGTGAGGGAGCAGGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108804031 13:54132210-54132232 AGGGACACGGAGAAGGGGGGTGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109245034 13:59943913-59943935 AGGGAAAAGATGATGGAGGCTGG + Intronic
1109473624 13:62846908-62846930 AGAGGCAGGGAGAAGGAGGATGG - Intergenic
1109512314 13:63394331-63394353 AGGAAGAAGGGGATGGAGGAAGG + Intergenic
1109589577 13:64460450-64460472 AGGTACATGATGAAGGAGGCTGG + Intergenic
1109777005 13:67054033-67054055 AGGGATGTGGTGAGGGAGGAGGG - Intronic
1110034778 13:70669347-70669369 TGAGACAAGGGGAAGGAGGAAGG - Intergenic
1110493969 13:76143528-76143550 AGGGATAGGGTGAGAGAGGATGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112015175 13:95325571-95325593 AGGGAAAGGGGGAAGGGGGAAGG + Intergenic
1112111910 13:96310632-96310654 AGGGACATAGAGAAGGAGGGAGG - Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113454722 13:110440115-110440137 AGTGACAAGGACATGGAGGAGGG - Intronic
1113520675 13:110938273-110938295 AAGGGCCAGGTCAAGGAGGAAGG + Intergenic
1113608557 13:111627362-111627384 AGGCAGATGGTGAAGGATGAAGG - Intronic
1113680143 13:112238230-112238252 TGGCAGAAGGTGAAGCAGGAGGG + Intergenic
1113931979 13:113973529-113973551 AGGGACAGCCTGAAGCAGGAGGG - Intergenic
1114288402 14:21267580-21267602 GGGGAAAAGTTGAAGAAGGATGG - Intronic
1114539544 14:23444531-23444553 AGGGAGAGGGTGGAGGAGGGTGG + Intergenic
1114956899 14:27832828-27832850 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115939231 14:38589976-38589998 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939238 14:38590001-38590023 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939245 14:38590026-38590048 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939252 14:38590051-38590073 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939259 14:38590076-38590098 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939266 14:38590101-38590123 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1116131206 14:40856909-40856931 AGGGATCAAGGGAAGGAGGATGG + Intergenic
1116253432 14:42517483-42517505 AGGCAGAAGGTGCAAGAGGAAGG + Intergenic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1116625449 14:47256978-47257000 GGGGACAAGATGAAAAAGGAAGG + Intronic
1116882100 14:50181013-50181035 AGGGAAAGGGTGAAGAAAGAAGG + Intronic
1117032943 14:51693851-51693873 AGGGACTAGGTTACGTAGGATGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117564130 14:56976518-56976540 AGGGACGGAGGGAAGGAGGAAGG - Intergenic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118998783 14:70862089-70862111 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1119031991 14:71200013-71200035 AGGGAGACAGTGCAGGAGGAAGG + Intergenic
1119070698 14:71580432-71580454 GGGGACAAGGTGAAGGCTGCTGG + Intronic
1119110668 14:71970950-71970972 AGAGAGAAGGTGTAGGAGGCAGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119386127 14:74258999-74259021 TGGGACAGGGTGGAGGAGGCAGG + Intronic
1119730571 14:76948486-76948508 AAGGAAAAGGTGGAGGAGGGTGG - Intergenic
1120168041 14:81220954-81220976 AGAGACAGGGTGAAGGGGGAGGG + Intronic
1120699794 14:87686476-87686498 AGGGAGGAGGTGTAAGAGGAGGG - Intergenic
1120841461 14:89089094-89089116 AAGGTCAAGGTCAAGAAGGAAGG + Intergenic
1120892354 14:89502298-89502320 AGAGACAAGGTGCAGGATTAGGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121279190 14:92687392-92687414 GGGGACCGGGTGAAGGAGGCTGG - Intronic
1121410580 14:93745991-93746013 AGGGAGAAGGGGAAGGATGGGGG - Intronic
1121544140 14:94751212-94751234 AGGGCAAAGGTGTTGGAGGAGGG + Intergenic
1121652076 14:95566117-95566139 AGAGGAAAGGGGAAGGAGGAAGG + Intergenic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121777090 14:96598181-96598203 AGGGACAATGGGGAAGAGGAGGG - Intergenic
1121845427 14:97168371-97168393 TGGGACATGGTGAAGGACAAGGG - Intergenic
1122002068 14:98666966-98666988 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1122222778 14:100251738-100251760 AGGGACAAAGGGAGGGAGGGAGG - Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1122384195 14:101332896-101332918 GGGGACAAGGGGAAGAGGGAGGG + Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122631571 14:103109692-103109714 AGGGACAGGGTGGAGAGGGAGGG - Intronic
1122912857 14:104841920-104841942 AGGGAGGAAGGGAAGGAGGAAGG - Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123917712 15:25049035-25049057 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1124153115 15:27200016-27200038 AGGGAGAAAGTAAGGGAGGAAGG - Intronic
1124967530 15:34447479-34447501 AGGGAAGAGATGAGGGAGGAGGG - Intergenic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125220577 15:37328443-37328465 AGGGGCTTGGGGAAGGAGGAGGG + Intergenic
1126286343 15:47016660-47016682 AGAGACAAAGGGAAGGAAGAGGG - Intergenic
1126349041 15:47725544-47725566 AGGGGGAAGGTGAGGGAGGTGGG - Intronic
1126370205 15:47938005-47938027 AGGGAAGAAGTGAAGGAGGGAGG + Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127553726 15:60066635-60066657 AGGCACAATGTGATGGAAGAAGG + Intergenic
1127785106 15:62348922-62348944 AGGGATGTGGTGAGGGAGGAAGG - Intergenic
1127883224 15:63176253-63176275 GGGGAGAAGGTGAAGGGGGTAGG - Intergenic
1128113054 15:65088504-65088526 AGTGACACAGTGAAGGCGGAGGG - Intergenic
1128154750 15:65385370-65385392 GGGGAGAGGGTGAGGGAGGACGG + Intronic
1128311144 15:66632341-66632363 AGGGACAGAGTGAAGGCAGAGGG + Intronic
1128388751 15:67168652-67168674 AGGCACAAGGAGGAAGAGGAGGG - Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128646451 15:69382102-69382124 AGGAACAGTGTGGAGGAGGAGGG + Intronic
1128904042 15:71451733-71451755 AGGGACCTGGAGAAGGAGGGAGG - Intronic
1128995393 15:72290981-72291003 AGGGACAGGGTGGTGGAGGTGGG - Intronic
1129020503 15:72513704-72513726 AGGGACAGGGGGAGGGAGGGAGG - Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129475292 15:75780886-75780908 AGTGACAGGTTGAAGGATGATGG - Intergenic
1129720140 15:77873422-77873444 AGGGAAGGGGAGAAGGAGGATGG - Intergenic
1129771559 15:78206364-78206386 AGGGACAGGCTGAGGAAGGAGGG - Intronic
1129785984 15:78310409-78310431 AGAGACAGGGTGATGGGGGAAGG + Intergenic
1129949044 15:79570091-79570113 AGGGAGATGGTGTAGGAGAAAGG + Intergenic
1130090528 15:80817086-80817108 AAAGCCATGGTGAAGGAGGAAGG + Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130301766 15:82685044-82685066 AGGCCCAAGGTGAAGGAGATGGG + Intronic
1130689031 15:86064332-86064354 AGGGACACGGGGAAGGGGCAGGG + Intergenic
1130821775 15:87503381-87503403 AGGAACAAGGTGGATGTGGAGGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131329418 15:91482910-91482932 AGGGACTATGTGGTGGAGGAGGG + Intergenic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131692138 15:94838685-94838707 AGGGACAATGTGAAAGGGAAAGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131743159 15:95416390-95416412 AGGGACAAGGTGAATGGGCCAGG + Intergenic
1132100197 15:99017557-99017579 AAGGCCAAGGTAAAGGATGAGGG - Intergenic
1132191180 15:99862439-99862461 AGGGAAGAGATGAGGGAGGAGGG + Intergenic
1132291364 15:100705989-100706011 GGCGACAGGGTGAATGAGGAAGG + Intergenic
1132589484 16:720518-720540 AGGGAGAAGGGCATGGAGGAGGG - Intronic
1132989936 16:2787274-2787296 AGGGAGGGGGTGAAGGATGAGGG - Intronic
1133415854 16:5606460-5606482 AGAGAGAAGGTGAGGAAGGAAGG - Intergenic
1133417290 16:5616550-5616572 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133417302 16:5616588-5616610 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133749499 16:8713563-8713585 GGAGGGAAGGTGAAGGAGGAGGG - Exonic
1133839415 16:9394476-9394498 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1134059482 16:11190558-11190580 AGGGACAAGTGGAGGGAGGGGGG - Intergenic
1134066595 16:11232462-11232484 AGGGGCAGGGGGGAGGAGGAGGG + Intergenic
1134792167 16:16998857-16998879 ATGGACTGGGTGAAGAAGGAAGG + Intergenic
1134955762 16:18381501-18381523 AGGGGCTAGGTGAGGGGGGAGGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135645343 16:24156801-24156823 AGGGAGAAGGTAAGGGAGTAGGG - Intronic
1135660433 16:24291924-24291946 AAGGAAAGGGTTAAGGAGGATGG + Intronic
1136054498 16:27678412-27678434 AGGGAAAAGGAGAGGGAAGAGGG - Intronic
1136075543 16:27814711-27814733 AGGGAGAGAGGGAAGGAGGAAGG + Intronic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136239620 16:28936232-28936254 AGGCATAAAGTGAAGGTGGAGGG - Intronic
1136343175 16:29658351-29658373 AGAGACAAAGAGAAGGAGGGAGG - Intergenic
1136994624 16:35181358-35181380 AGGCACCAGGTGAATGAGGATGG + Intergenic
1137218675 16:46426530-46426552 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1137534465 16:49307702-49307724 CGGGACATGGTGGAGGAAGAAGG - Intergenic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137562173 16:49509980-49510002 AGAGGCAAGGTGAAGGACGATGG - Intronic
1137833204 16:51564082-51564104 AGGGACAACATACAGGAGGAAGG + Intergenic
1137955427 16:52824530-52824552 AGGGGGAAGGTGAGGGAGGGAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138078182 16:54063280-54063302 AGGGACAAGCGGAAGCAGGGGGG + Intronic
1138360257 16:56422429-56422451 GGGGAGGAGGTGAAGGAGGTGGG - Intronic
1138434393 16:56989182-56989204 GGGGATACGGTGCAGGAGGAGGG - Intergenic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138457608 16:57130456-57130478 AGGGAGGAAGTGAAGGAGGGAGG + Intronic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139447914 16:67009555-67009577 AGGCACAAGGTTGAGCAGGATGG - Exonic
1139640874 16:68290608-68290630 AGGGAGGAGGAGAAGGATGAGGG - Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139834118 16:69824524-69824546 AGGAACAAAGGGAAGGGGGAGGG - Intronic
1140045691 16:71439180-71439202 AGTGACATGGTGGAGGAGGAGGG + Intergenic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141173201 16:81704119-81704141 AGTGCAGAGGTGAAGGAGGAGGG - Intronic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141255249 16:82396233-82396255 GAGGACGAGGTGGAGGAGGAGGG - Intergenic
1141533920 16:84665886-84665908 AGGACCAGGGTGAAGGATGAAGG - Intronic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143273189 17:5690605-5690627 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143473516 17:7190657-7190679 AGGGCCCAGGTGATGGAGGCAGG + Exonic
1143478469 17:7216099-7216121 GGTGAAAAGGTGTAGGAGGAGGG - Intronic
1143504560 17:7356533-7356555 AGGGACAGAGGGAGGGAGGATGG - Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144245925 17:13364530-13364552 AGAGACATGGTCAGGGAGGAGGG + Intergenic
1144273535 17:13643179-13643201 GGGGTTAAGGTGAAGGGGGAGGG - Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144438102 17:15259243-15259265 AAGGAAAAGGGGAAGGAGAAAGG + Intronic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144552561 17:16254102-16254124 AGGGACAAGATGAAGGGCGTTGG - Intronic
1144768972 17:17748646-17748668 ATAGAAAAGGTGTAGGAGGATGG + Intronic
1145903697 17:28505155-28505177 AGGGTCAGGGAGATGGAGGAGGG + Intronic
1146529100 17:33592690-33592712 CGGACCAAAGTGAAGGAGGAGGG + Intronic
1146570835 17:33951231-33951253 AGGGCCACTGTGAAGGTGGAAGG - Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146918964 17:36697127-36697149 AGAGAAAAGGGGAAGGAGGGAGG + Intergenic
1146923290 17:36727873-36727895 GGGGACATGGTGTAGGATGAGGG - Intergenic
1146944546 17:36864754-36864776 AGGGAGGAGGGGAGGGAGGAAGG - Intergenic
1147141534 17:38463272-38463294 AGGAACAGGGTCCAGGAGGAAGG - Intronic
1147191334 17:38739770-38739792 AGGGACAGGGTGGAGGAGGAGGG - Intronic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147331082 17:39699999-39700021 AAGGAGGAGGTGGAGGAGGAGGG + Intronic
1147363592 17:39946154-39946176 AGGGGCAAGGGGAAGGTGGGTGG + Intergenic
1147574902 17:41593431-41593453 ATGGGCAAGGTGAAGGGGGTGGG - Intergenic
1147584503 17:41646167-41646189 AGGGACAGAGAGAAGGAGGCAGG - Intergenic
1147647574 17:42043059-42043081 AGGGCCAGGCTGAAGGTGGAGGG - Intronic
1147674397 17:42194537-42194559 AGGGAGGAGCTGAAGGAGGGGGG + Intergenic
1147891462 17:43720531-43720553 AGGGACACGGAGATCGAGGAGGG + Intergenic
1148389213 17:47258208-47258230 AGGGCCAAGGTTCAGGAAGAGGG - Intronic
1148465176 17:47860821-47860843 AGTGTCAGGGTGAAAGAGGAAGG - Intergenic
1148526163 17:48338044-48338066 AGGAACTAAGTGAAGAAGGAAGG - Intronic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148701464 17:49589478-49589500 AGGGACAGGGAGAAAGAGAAGGG + Intergenic
1148738769 17:49880372-49880394 AGGGAGAAGGTTAAGGGGCAAGG - Intergenic
1148864060 17:50619464-50619486 AGAGGGAAGGCGAAGGAGGAAGG - Intronic
1148988937 17:51648597-51648619 AGTGCAAAGTTGAAGGAGGAAGG - Intronic
1149522037 17:57324720-57324742 TGGAAGAAAGTGAAGGAGGAGGG - Intronic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149684518 17:58527711-58527733 AGAGACCAGGTGAGGGAGGATGG + Intronic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1149946331 17:60931672-60931694 GGTGACAAGGTGAAGGAGGAAGG - Intronic
1150464380 17:65379611-65379633 AGGGACAAAGAAATGGAGGAAGG + Intergenic
1150569004 17:66369384-66369406 AGGGACCTGGGGGAGGAGGAGGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150953674 17:69831123-69831145 AGGGAAAAGGAGAGGGAGGGAGG - Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151316074 17:73323488-73323510 AGGAACAAGGGGAAGGAGCGTGG + Intergenic
1151516409 17:74599014-74599036 AGGGAGCAGGTGACAGAGGAGGG + Intergenic
1151648906 17:75453476-75453498 AGGTTTAGGGTGAAGGAGGAAGG - Intronic
1151745625 17:76010257-76010279 AAGGCCCAGGTGGAGGAGGAGGG - Exonic
1151825991 17:76524661-76524683 AGGTACGAGGAGGAGGAGGATGG - Intergenic
1151895322 17:76976574-76976596 AGGGACAAGAAGAAGCAAGATGG + Intergenic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152184763 17:78848394-78848416 AGGGGCTAGGAGGAGGAGGACGG + Intergenic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152470699 17:80488992-80489014 AGGGACACGGTGGAGAGGGATGG + Intergenic
1152470782 17:80489281-80489303 AGGGACACGGTGGAGAGGGATGG + Intergenic
1152470859 17:80489530-80489552 AGGGACACGGTGGAGAGGGATGG + Intergenic
1152470936 17:80489779-80489801 AGGGACACGGTGGAGAGGGATGG + Intergenic
1152956313 18:44998-45020 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153283753 18:3438366-3438388 AGAGAGAAGGTGAGGGAGGGAGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153835115 18:8956786-8956808 AGGCAGTAGGTGAAAGAGGAAGG - Intergenic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1155063034 18:22245552-22245574 ATAAACAAGGTGATGGAGGAAGG - Intergenic
1155191984 18:23438304-23438326 AGAGGGAAGGTGAAGGAAGAAGG + Intergenic
1155515308 18:26618551-26618573 AGGATAAAGGTGAACGAGGAAGG + Intronic
1155527139 18:26728801-26728823 AAGGACAAGTTGAAGCAGCATGG + Intergenic
1155543846 18:26893956-26893978 ATGGACAGGGTTAAGGAGAAGGG + Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1156060906 18:33075009-33075031 TGTGAGAAGGTGAAAGAGGATGG + Intronic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156486784 18:37471490-37471512 AGGGGCAAAGGCAAGGAGGAGGG - Intronic
1156491404 18:37498512-37498534 AGGGAGAAGGTAAGGGAAGAGGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156987508 18:43365870-43365892 AGGGAGAGAGTGAGGGAGGAGGG + Intergenic
1157103757 18:44753844-44753866 AGAGACAAGGTGAAGAAGGATGG + Intronic
1157357741 18:46951060-46951082 AGGGACAGGGAGAAGTAGAAGGG - Intronic
1157369913 18:47101430-47101452 AGTCCCAGGGTGAAGGAGGACGG + Exonic
1157403602 18:47405770-47405792 AGGGAGAAGGTGAGGCAGGGAGG + Intergenic
1157614371 18:48978027-48978049 AGGGACAGGGTTAGGGAGGCTGG - Intergenic
1158195721 18:54883053-54883075 AGACACCAGGTGAAGGAGGAAGG + Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1159673370 18:71251002-71251024 GGGGAGAAGGTGGGGGAGGAAGG + Intergenic
1159889113 18:73938094-73938116 AGGGAACAGGAGAAGGATGAAGG + Intergenic
1160135269 18:76266234-76266256 AGGGACAGAGAAAAGGAGGAAGG + Intergenic
1160537103 18:79600574-79600596 AGGGATAAGATGATGGCGGAGGG - Intergenic
1160612194 18:80097169-80097191 AAGGACGAGGGGGAGGAGGAGGG - Intergenic
1160676919 19:395899-395921 AAGGACAATGGGAAGGATGATGG + Intergenic
1161415799 19:4145666-4145688 AGGGAAAAGGCCAAGGAGGAGGG + Intergenic
1161638076 19:5401823-5401845 AGGGACGAAGGGAAGGAGGGAGG + Intergenic
1161851795 19:6740981-6741003 TGGGACATGGTGGGGGAGGAGGG - Intronic
1161918737 19:7250346-7250368 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162303379 19:9856923-9856945 AGGAACAGGGGGAATGAGGATGG + Intronic
1162337635 19:10071431-10071453 AGGGACAAGGAGGGGCAGGAGGG + Intergenic
1162680127 19:12334141-12334163 AGAGGCAAGGTGAGAGAGGAAGG - Intergenic
1162838733 19:13340124-13340146 AGGGACAGGGTGGAGGATGGGGG + Intronic
1162865332 19:13541670-13541692 AGAGAGAAAGGGAAGGAGGAAGG + Intronic
1162869693 19:13576138-13576160 TGGGACAAGGTGAGTGAGGTGGG - Intronic
1162969167 19:14169807-14169829 AGGGATAATGGGAAGGAGGGAGG + Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163478942 19:17543179-17543201 TGGGACAAGGAGGAGGAGGTTGG + Intronic
1163549368 19:17957104-17957126 AGGGACAGAGGGAGGGAGGAAGG + Intronic
1163577462 19:18118992-18119014 AGGGATGAGGTGCAGGAGGCTGG + Intronic
1163685777 19:18710963-18710985 TGGGACAGGGTGAAGAAAGAGGG - Intronic
1163703184 19:18797101-18797123 AGGGAGAGGGGGAGGGAGGAAGG - Intergenic
1163721793 19:18901356-18901378 AGGGGCAGGGTGGTGGAGGAGGG + Intronic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1163779607 19:19239564-19239586 AGGGAGGAGGGGAGGGAGGATGG - Intronic
1163822732 19:19505504-19505526 AGGGGCCAGGTGGGGGAGGAGGG - Exonic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164639382 19:29812702-29812724 CGGGACACCATGAAGGAGGACGG + Exonic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164979967 19:32606496-32606518 AGGGACCAGGTGAAGAGGGGAGG + Intronic
1165028212 19:32977499-32977521 AGGAACAAAGGAAAGGAGGAAGG - Exonic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166062429 19:40334987-40335009 AGGGAGAAAGGGAAGGAGGGAGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166252961 19:41584253-41584275 AGGGGCATGGTCAGGGAGGAAGG - Intronic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166297672 19:41896940-41896962 AGGGGGAAGGTGAGAGAGGAGGG - Intronic
1166348046 19:42179114-42179136 AGAGCCCAGGTAAAGGAGGAAGG + Intronic
1166369175 19:42291915-42291937 GGGGACACAGAGAAGGAGGAGGG - Intronic
1166880926 19:45929488-45929510 AGGGACAGAGGGAGGGAGGATGG + Intergenic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167221728 19:48203819-48203841 AGGAACAAGGTTAAGGAAGCTGG - Intronic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167327738 19:48835770-48835792 AGGGCCAAGGTGAGGGCTGAGGG + Intronic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1167579084 19:50331530-50331552 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579096 19:50331570-50331592 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579108 19:50331610-50331632 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167843665 19:52142083-52142105 AGGCACAAGGTGAGAGATGATGG + Intergenic
1168116423 19:54223373-54223395 ATGGACGAGCTGAAGGAGGGAGG - Intronic
1168348501 19:55662374-55662396 AGGGATGAGGGGAGGGAGGAGGG - Intronic
1168357933 19:55713782-55713804 AGGGACGAGGGGAAGGGGGGAGG - Intronic
1168471142 19:56642043-56642065 AGAGACAAGGAGGGGGAGGAGGG + Intergenic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925034257 2:673775-673797 AGGAAGGAGGGGAAGGAGGAGGG + Intronic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925189917 2:1874601-1874623 GGGGAGCAGGTGATGGAGGAAGG - Intronic
925577011 2:5370531-5370553 TGGGTCAAGGAGAAGGAGAAAGG - Intergenic
925750694 2:7088785-7088807 AGGGGCAGTGTGATGGAGGAAGG + Intergenic
925903869 2:8527592-8527614 CGAGAGGAGGTGAAGGAGGAAGG - Intergenic
925988446 2:9234666-9234688 AGAGCCAAGGTGAAGGAAGATGG + Intronic
926197983 2:10775152-10775174 GGGGACAATGAGAGGGAGGAGGG - Intronic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926334486 2:11853040-11853062 AGGGGGAAGGGGAAGAAGGAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926842738 2:17100701-17100723 AGGGAAGAGGTGAAGCCGGAGGG + Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927645948 2:24877104-24877126 GGGGACATGGGGGAGGAGGAGGG - Intronic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
927840630 2:26440705-26440727 AGGAACAAGATGAATGGGGACGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
928972786 2:37049309-37049331 AGGGACAAGGAAAGGGAGGGAGG + Intronic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929484114 2:42339572-42339594 AGGGATAAAGGGAGGGAGGAAGG - Intronic
929794171 2:45046330-45046352 AGGGAGAAGTTTCAGGAGGAGGG + Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930352660 2:50277432-50277454 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
930400465 2:50878425-50878447 AGGGTGTAGGTGGAGGAGGAGGG - Intronic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
930640522 2:53850069-53850091 AGGGAAAAAGGGAAGGAGGGAGG + Intergenic
930752192 2:54945028-54945050 AGGGAAGGAGTGAAGGAGGAGGG - Intronic
931133390 2:59366219-59366241 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
931899211 2:66769378-66769400 AGGGAGGAGGTGAACAAGGAAGG - Intergenic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933257970 2:80102302-80102324 TGGGACAAGGCCAAGGTGGAAGG - Intronic
933873098 2:86589372-86589394 AGGGACCAATTGAAGGTGGAGGG - Intronic
934026152 2:88003169-88003191 AGGGAACAGGGGCAGGAGGAAGG - Intergenic
934480386 2:94635167-94635189 AGGGCCAAGGGGAAGAAAGATGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935638429 2:105268613-105268635 AGGGATATGCTGAAGGAGGTGGG + Intronic
935924104 2:108048475-108048497 AGGGAAAGAGTGAAGGTGGAGGG - Intergenic
936034253 2:109098027-109098049 AGGAACAGGGTGAGGGAGCAGGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936650461 2:114420809-114420831 AGGGACAGGGAGAAGCAGAAAGG - Intergenic
936679850 2:114757346-114757368 AGGGAGAGGGGGAGGGAGGAGGG + Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937419258 2:121740847-121740869 AGGAAGAAAGGGAAGGAGGAAGG - Intronic
937656430 2:124381915-124381937 AGAGAGACAGTGAAGGAGGAAGG + Intronic
937818172 2:126276301-126276323 AGGGACAGAGGGAAGGAGGGAGG + Intergenic
937818183 2:126276333-126276355 AGGGACAGAGGGAAGGAGGGAGG + Intergenic
937818194 2:126276365-126276387 AGGGACAGAGGGAAGGAGGGAGG + Intergenic
937818205 2:126276397-126276419 AGGGACAGAGGGAAGGAGGGAGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938188872 2:129256387-129256409 TGTGAGAAGGTGAAGGAGTAAGG - Intergenic
938380189 2:130832135-130832157 AGGGAGGAGGTGGGGGAGGAGGG - Intergenic
938973752 2:136456305-136456327 AAGGGGAAGGTGAAGGAGAAGGG - Intergenic
939430591 2:142100919-142100941 AGGGAGAGAGGGAAGGAGGAAGG + Intronic
939629085 2:144513387-144513409 GGGGACAGTGTGAAGGAGAAGGG - Intronic
939994257 2:148905703-148905725 AGGGTCAAGGAGTGGGAGGATGG + Intronic
939996860 2:148927889-148927911 AGGGACAGGGAGAGAGAGGAGGG - Intronic
940004442 2:148998300-148998322 AGGGACACAGGGAAGGAGGTAGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941474881 2:165938737-165938759 AGGGAAGAGGGGAAGGAGAAAGG + Intronic
941756319 2:169190435-169190457 AAGGAGGAGGTGAAGGAGCAGGG - Intronic
941810368 2:169749190-169749212 AAGGACAAGCTGAAGGATAATGG + Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
941904819 2:170710632-170710654 AGGAAGAAGGTGAAGGGGAAAGG - Intergenic
942325418 2:174772323-174772345 AGGGAGATTGTGAAGCAGGACGG - Intergenic
942803201 2:179899534-179899556 AGGGACCTTGTGAAGCAGGAGGG + Intergenic
943418795 2:187639908-187639930 AGAGACAAAGAGAAGGTGGAAGG + Intergenic
943532662 2:189103864-189103886 AGGAAGAAAGTGAGGGAGGAAGG - Intronic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
943786454 2:191883032-191883054 TGGGCAAAGGTGAAGGAGGCAGG - Intergenic
943824647 2:192373450-192373472 GGCGACAAGGCGAAGAAGGAGGG + Intergenic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
944687180 2:202127960-202127982 AGGGGCTAGGGGAGGGAGGAGGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945648487 2:212531461-212531483 AGGGCCATGATGAAAGAGGATGG + Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946034180 2:216728641-216728663 ACCTACAAGGTAAAGGAGGAGGG + Intergenic
946045297 2:216816036-216816058 AGGGAAGAAGAGAAGGAGGATGG - Intergenic
946292289 2:218754477-218754499 AGGGACAGGGTGAAAGGGGTAGG - Exonic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946693976 2:222333633-222333655 AGGCACTAGGGGAAGGGGGATGG - Intergenic
946887417 2:224236406-224236428 AGAAACAAGGTTAAGGATGATGG - Intergenic
947077746 2:226363986-226364008 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077751 2:226363998-226364020 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077793 2:226364105-226364127 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077799 2:226364117-226364139 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077804 2:226364129-226364151 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077824 2:226364177-226364199 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077841 2:226364213-226364235 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077847 2:226364225-226364247 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077853 2:226364237-226364259 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077859 2:226364249-226364271 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077865 2:226364261-226364283 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077870 2:226364273-226364295 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077884 2:226364309-226364331 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947119267 2:226799263-226799285 TGGGAGGAGGCGAAGGAGGAGGG - Exonic
947171556 2:227317853-227317875 AGGGACAATCTAAAGGATGAAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947343044 2:229159996-229160018 AGGAACAGGATGAAGGAAGAGGG + Intronic
947394327 2:229672388-229672410 AGAGAGGAGGTGAAGGAGGGAGG + Intronic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
948057911 2:235022932-235022954 AGGGACAAGGTCAAGGAGTGGGG - Intronic
948091890 2:235302069-235302091 AGGGAAAAGGAGGAGGAGGGAGG - Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948221238 2:236271396-236271418 AGGGACAACTTGAAGCAGGGAGG - Intergenic
948236119 2:236391962-236391984 AAGGACAAGGTGAGTGGGGAAGG - Exonic
948283250 2:236764854-236764876 AGGGAAAAGGTGCAGGAGTAAGG - Intergenic
948294089 2:236847998-236848020 AGAGAAGAGGTGTAGGAGGAGGG + Intergenic
948294109 2:236848058-236848080 AGGGGAGAGGTGTAGGAGGAGGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558571 2:238835275-238835297 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948771771 2:240254951-240254973 AAGGACTAGGGGAAGAAGGATGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949049961 2:241892367-241892389 AGGGGCAAGGGGAAGAGGGATGG - Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169125933 20:3126616-3126638 AGGGAGGGAGTGAAGGAGGAAGG + Intronic
1169163482 20:3403152-3403174 AGGGAATAGCTGAAGTAGGATGG - Intronic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169342147 20:4804808-4804830 AGGCACATGGTGCAGGAGGAGGG + Intronic
1169719374 20:8657059-8657081 AGGGAGAAGGTGAGGGAAGGGGG + Intronic
1169920622 20:10730965-10730987 AGGGAAAAGGAAAGGGAGGAAGG - Intergenic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1170000934 20:11612613-11612635 AGGGAGAGAGGGAAGGAGGAAGG - Intergenic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170607287 20:17883654-17883676 AGGGGCAAGGGGAGGGAGAAGGG + Intergenic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1170782422 20:19437808-19437830 GGGAACAGGGTGGAGGAGGATGG - Intronic
1171209150 20:23303613-23303635 AAGGAGAGGGTGAAGGATGAGGG - Intergenic
1171725926 20:28620817-28620839 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1171752204 20:29062563-29062585 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
1171770704 20:29320254-29320276 AGGGAAAAAGGGAAGGAGGGAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172014314 20:31863869-31863891 GGGGATAAGGTGGGGGAGGAAGG - Intronic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172766325 20:37352967-37352989 AGGGACAAGGTGAAGTTCAATGG - Intronic
1172834665 20:37865291-37865313 AGGTACAAGGGGAATGAAGACGG + Intronic
1173418045 20:42876049-42876071 AGGGAGAGAGTGAAGGAGGATGG - Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173738400 20:45378069-45378091 AAGGAAAAGGTGAAGGGTGAAGG - Intronic
1173928204 20:46796741-46796763 AGGGAAAGGGAGAAGGAGAAGGG - Intergenic
1174671948 20:52316637-52316659 AGGGAAAAGGTGGAGGGAGAAGG + Intergenic
1174718171 20:52782901-52782923 TGGGACAAGATGAAGAAGGATGG - Intergenic
1174832704 20:53827739-53827761 AGGGACAGAGGGAAGGAGGGAGG - Intergenic
1175329236 20:58151227-58151249 AGGGAGAAGGAGACGGAGAAAGG - Intronic
1175619431 20:60430988-60431010 AAGGACATGGTGAAGGTCGACGG - Intergenic
1175674563 20:60935622-60935644 AGGGAAGGGGAGAAGGAGGAAGG - Intergenic
1175793393 20:61756569-61756591 AGGGACCAGGGGATGGGGGAGGG - Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175918811 20:62440369-62440391 AGGAGAAAGGTGAGGGAGGAAGG - Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176411866 21:6453550-6453572 AGGGGCACGGGGTAGGAGGAAGG + Intergenic
1177118874 21:17118050-17118072 AGGGAGAAGATGATGCAGGAAGG - Intergenic
1177301892 21:19257383-19257405 AGGGACAGGAGGCAGGAGGAGGG + Intergenic
1178038747 21:28615316-28615338 GGGGAAAAGGGGAAGGAGGGAGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178205450 21:30459078-30459100 GGGGAAAAGGTGCAGCAGGAAGG - Intergenic
1178666213 21:34549231-34549253 AGGCACCAGGTGAAAGAAGAGGG + Intronic
1178939174 21:36890575-36890597 AGACACAAGGTGAAGGCGGTGGG + Intronic
1178940009 21:36897734-36897756 AGGTACAAGGAGGAGAAGGAAGG + Intronic
1179046636 21:37850562-37850584 ACGGACCAGGGGCAGGAGGAGGG - Intronic
1179089625 21:38252681-38252703 ACTGACAAAGTGGAGGAGGATGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179215916 21:39366937-39366959 GGGGAAAGGGGGAAGGAGGAGGG - Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179444045 21:41419242-41419264 AGGGAAGAGGTGAAGAAGGGAGG + Intergenic
1179549740 21:42136365-42136387 AGAGACAGGGGGAAGGTGGATGG - Intronic
1179569748 21:42271437-42271459 AGGGACAGGAGGAAGTAGGAAGG + Intronic
1179687360 21:43061872-43061894 AGGGGCACGGGGTAGGAGGAAGG + Intronic
1179958225 21:44752688-44752710 AGGGACAAAGGGAAAGAGGGGGG + Intergenic
1179965105 21:44799456-44799478 AAGCACAAGGTGAAGCAGCAAGG - Intronic
1180093492 21:45543872-45543894 AGGGGCAACGCGGAGGAGGAGGG + Intronic
1180626206 22:17195096-17195118 AGTGACAAGATGAAGGAAAAGGG - Intronic
1181118270 22:20647845-20647867 GGGGAGAGGGTGAAGGAAGAAGG - Intergenic
1181127510 22:20710663-20710685 AGGGCCAGGGTGGAGGCGGAGGG - Intronic
1181240842 22:21475966-21475988 AGGGCCAGGGTGGAGGCGGAGGG - Intergenic
1181484388 22:23221382-23221404 GGGAACAGGGTGAAGGAGGGAGG - Intronic
1181666133 22:24398849-24398871 AGGGACTGGGTGAGGGAGGAAGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181917374 22:26292067-26292089 AGGAAGAAAATGAAGGAGGAAGG + Intronic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182615480 22:31586169-31586191 AGGTACAAAGAGAAGCAGGAGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182973035 22:34595356-34595378 AGGGACAAAGGGAGGGAGGGAGG + Intergenic
1183017502 22:35001307-35001329 AGGAAGAATGTGAAGGAGGGAGG + Intergenic
1183153157 22:36053736-36053758 AGGGAGAAGGGAAAGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183499311 22:38168940-38168962 ATGGACAAAGGGAAGAAGGAAGG - Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1183855428 22:40629988-40630010 AGGGACAAGGTTAATCTGGAGGG + Intronic
1183855517 22:40630883-40630905 AGGGACAAGGTTAACCTGGAGGG - Intronic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184345410 22:43909909-43909931 AGGGACAGAGGGAAGGAAGAAGG + Intergenic
1184401287 22:44276133-44276155 AGGGACAAAGTGACGGGGGGAGG + Intronic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184449799 22:44576096-44576118 AGGGAGGAGGTAGAGGAGGAGGG + Intergenic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1184729811 22:46366048-46366070 AGGGGAAAGGTGGAGGGGGAAGG + Intronic
1184864865 22:47196432-47196454 AGGGACCTTGTGAAGAAGGAAGG + Intergenic
1185089346 22:48757134-48757156 AGAGGCAAGGAGGAGGAGGAGGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
949219833 3:1618527-1618549 AGGAACATAGGGAAGGAGGAAGG + Intergenic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949520487 3:4848616-4848638 AGGCACAATGTGAAGGAAGCAGG - Intronic
949677014 3:6467180-6467202 AGGGAAAAAGTGAAGGAGGTAGG + Intergenic
949762891 3:7491571-7491593 ATTGACAAGGTGAGGGAGGTGGG + Intronic
949839777 3:8307139-8307161 AGGGAAAGTGTGAAGAAGGACGG - Intergenic
949855615 3:8458365-8458387 AGGCACAGGGTGAGGGAGGGAGG + Intergenic
949898705 3:8792289-8792311 AGGTGGAAGGTGAAGAAGGAGGG - Intronic
949918577 3:8984176-8984198 AGGGAGTGGGTGAAGGGGGAGGG + Exonic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950333651 3:12176954-12176976 AGGCACATGGTGAAAGGGGAGGG + Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950505716 3:13393239-13393261 ATGGACAAGGGGATGGAGGTGGG + Intronic
950905055 3:16530519-16530541 AGGGAAGAAGAGAAGGAGGAGGG - Intergenic
951804291 3:26627520-26627542 AGGGATGAGGTGGAGGAAGATGG + Intronic
951977896 3:28534109-28534131 AGGGACAAGGTGAAGTCTAATGG + Intronic
952202137 3:31141545-31141567 AGGGACAACTTGAAGGAGGGAGG - Intergenic
952218603 3:31302129-31302151 AGGGAGAAGGTGAAGGAGAGAGG - Intergenic
952240826 3:31530268-31530290 ACGGACGAGGAGAAGGAGAATGG - Intergenic
952259288 3:31724144-31724166 AGAGAAAAGGGGAAGGAGGAGGG + Intronic
953465459 3:43115572-43115594 AGGTATATGGTGAAGGAGAAGGG + Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954105331 3:48406747-48406769 AGGGGCAGTGTGAAGGGGGAAGG + Intronic
954189247 3:48944789-48944811 AGGGACAAGAGGAAGAAAGAAGG - Intronic
954403864 3:50334250-50334272 AGGAAAAAGGTAAAGGGGGAGGG + Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955315294 3:57933529-57933551 AGGGACCAGGGGAGGGAGAAAGG + Intergenic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955479868 3:59378632-59378654 AGGGACGAAGGGAGGGAGGAAGG - Intergenic
956055182 3:65291082-65291104 AAGGCCATGGTGAAGGAGGGGGG - Intergenic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956554331 3:70501280-70501302 AGGGAGAAGGTGAAAGAACAAGG + Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
956771822 3:72533133-72533155 TGGGACAAGGTGATGGAGAGGGG - Intergenic
956870461 3:73412172-73412194 AGCCACAAATTGAAGGAGGAAGG + Intronic
957025186 3:75173632-75173654 GGAGGCAAGCTGAAGGAGGAAGG + Intergenic
957181054 3:76877898-76877920 AAGGGCAAGGTGGAGGAGAAGGG + Intronic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
957822853 3:85400769-85400791 AGGGACAAGACGCAGGCGGAGGG + Intronic
957867980 3:86049696-86049718 AGGCAAAGGGGGAAGGAGGAAGG + Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958506999 3:94992646-94992668 AGGGACAATGTGAAGAATGATGG + Intergenic
958706407 3:97662146-97662168 AGAGAAAAGGTGGAAGAGGAAGG + Intronic
959033641 3:101333906-101333928 AGGGACAAGGTTAGGGGGGATGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960422368 3:117462874-117462896 AGGGACTGATTGAAGGAGGAGGG + Intergenic
960696957 3:120405800-120405822 AGGCACTAGCTGCAGGAGGAGGG + Intronic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
961003394 3:123388980-123389002 AGGGACCTGGGGAAGGAGGCGGG + Intronic
961340128 3:126212297-126212319 AGGGAGGAAGGGAAGGAGGAAGG + Intergenic
961460232 3:127045468-127045490 AGGGAGAAAGGGAAGGAGAAAGG + Intergenic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961780765 3:129318953-129318975 AGGGACAGGGTCACGGAGGAAGG + Intergenic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
961962859 3:130869836-130869858 AAGTACAAGGTGAAGCAGCAAGG + Intronic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962381527 3:134901979-134902001 AGTGACAATGTGGAGGAGGAGGG + Intronic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965679181 3:171232862-171232884 AGGGAGGAGTTGAAGGAGTAGGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966077428 3:175954728-175954750 AGGTGCAAGGAGAAGGAGAAAGG + Intergenic
966188611 3:177250253-177250275 AGAGAAAGGGTGGAGGAGGAAGG + Intergenic
966461403 3:180180625-180180647 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966656201 3:182361243-182361265 AGTGAAAAGATGAAGGAAGAGGG - Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966739342 3:183217711-183217733 AGGGACAAGTGGAGGAAGGAAGG - Intronic
966766105 3:183464029-183464051 AGGGGAAATGTGGAGGAGGAAGG - Intergenic
966799324 3:183748221-183748243 GGGGACAAGGGGAAGGGGAAAGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967258602 3:187619405-187619427 AGAGACAAGGCTGAGGAGGAGGG - Intergenic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967443785 3:189540728-189540750 AGGAGCAAGGTGAGGGGGGAAGG - Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967581878 3:191167985-191168007 AGCTGCAAGGTGATGGAGGAAGG - Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
968131579 3:196195638-196195660 AGGGACAGGGTGGCAGAGGAAGG + Intergenic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
968695029 4:2020208-2020230 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
969073928 4:4562012-4562034 AGGGACAAGGTGGAAAAGCAGGG - Intergenic
969089832 4:4685422-4685444 AGGGAGAGGGCAAAGGAGGATGG + Intergenic
969098215 4:4750299-4750321 CGGGACAAGGTGGGGGAGCACGG - Intergenic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969270290 4:6095028-6095050 AGGGACAGAGGGAGGGAGGAAGG + Intronic
969278323 4:6152047-6152069 AGGAAGCAGGCGAAGGAGGAAGG + Intronic
969315206 4:6377724-6377746 GGGGCCCAGGTGAAGGAGGATGG + Intronic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
969495286 4:7522943-7522965 AGGGAGAAGGGGAAGGATGGGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969626610 4:8308935-8308957 AGGGGCAGGGAGAAGGAGGGTGG - Intergenic
969633856 4:8353826-8353848 ATGAACAAAGTCAAGGAGGAAGG + Intergenic
969686823 4:8680198-8680220 AGAGACAAAGAGAAAGAGGAAGG + Intergenic
970023641 4:11596891-11596913 AGGAATGAGGTCAAGGAGGAGGG - Intergenic
970092090 4:12421249-12421271 AGGGACAAGTTGAAGCAGGGAGG - Intergenic
970153446 4:13116465-13116487 AGAGAGAAAGTAAAGGAGGAAGG + Intergenic
970163790 4:13215146-13215168 AGGAACAGAGTGAAGGAGCAGGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970867772 4:20778989-20779011 AGAGACAGGGAGGAGGAGGAAGG + Intronic
971026485 4:22593819-22593841 ACGGACAGGGTTAAGGAGAAGGG + Intergenic
971136982 4:23879625-23879647 AGGGACAAGGTGATAGCAGAGGG - Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971158613 4:24109776-24109798 AGGAACAAGTTCAAGGATGAGGG + Intergenic
971393674 4:26209542-26209564 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393682 4:26209566-26209588 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393690 4:26209590-26209612 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393698 4:26209614-26209636 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393706 4:26209638-26209660 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393723 4:26209686-26209708 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393731 4:26209710-26209732 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393739 4:26209734-26209756 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393757 4:26209783-26209805 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393775 4:26209832-26209854 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971393783 4:26209856-26209878 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
971479047 4:27098317-27098339 AGAGAAAAGGGGAAGGAGGCAGG + Intergenic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
971605929 4:28657291-28657313 AGGGACAATCTGAAAGAGTAAGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972125437 4:35759190-35759212 AGGGAGGAGGTGAAGCAAGATGG - Intergenic
972322914 4:37989359-37989381 TGGGACAACTTGAAGGTGGAGGG - Intronic
972329165 4:38047756-38047778 AGGGAAAAGGTGAGGGGTGAGGG + Intronic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972712264 4:41609147-41609169 AGGGAAAAGGGGAGGGAGCATGG + Intronic
972741061 4:41886539-41886561 GGGGACAAGGTGCCTGAGGAGGG - Intergenic
972840058 4:42920201-42920223 ATTGGCAAGGTGAAGGATGAAGG + Intronic
972924240 4:43983906-43983928 AGGGAGAAAGTGAAGGAAGGAGG + Intergenic
973560678 4:52131957-52131979 AGGAACAAGATGAAGGAGATGGG + Intergenic
973631454 4:52824562-52824584 AGGGCCAGGGGGAAGGAGCATGG - Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974811376 4:66950455-66950477 AGCACCAAGGTGAATGAGGAAGG + Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975633808 4:76425954-76425976 AGAGACAAGGAGGTGGAGGAAGG + Intergenic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
976056831 4:81078982-81079004 AGGGAAAAGGTGAGGGAACAAGG + Intergenic
976126569 4:81839416-81839438 AAGGACAAGGTCAAAGAAGAAGG + Intronic
976842870 4:89452174-89452196 AGAGACTAGGTGAAGAAGAATGG + Intergenic
976893042 4:90074091-90074113 AGGTACAAGGTGAAGCACAAGGG - Intergenic
976987278 4:91317440-91317462 TGGGGCAAGGTGAAAGAGAATGG - Intronic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977582833 4:98744230-98744252 ATGGACGAGGTGGAGGAGAAAGG - Intergenic
977597014 4:98894474-98894496 AAGTACAAGGTGAAGCAGCAAGG - Intronic
977745291 4:100539830-100539852 AGGGACAAGGTACAGAAGGGAGG + Intronic
978194461 4:105954633-105954655 AGCAAGAAGGTGCAGGAGGAAGG - Intronic
978268570 4:106859061-106859083 AGGGTGAAGGGGGAGGAGGAGGG + Intergenic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
980200178 4:129646719-129646741 AAGGACAAGGTGAAATAGTATGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981182632 4:141763811-141763833 TGGGGCCAGGTGATGGAGGATGG + Intergenic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
981955685 4:150470297-150470319 AGAGGCAAGGTGAAAGAGGGAGG - Intronic
982261487 4:153498126-153498148 TGGGAGAAGATGTAGGAGGATGG + Intronic
982360955 4:154518491-154518513 AGGGACAAAGGGAAAGAGTAAGG - Intergenic
982374387 4:154673594-154673616 GGGGACAAGAGGAAGGAAGAAGG + Intronic
982524105 4:156456069-156456091 AGGGAGAAAGTCAAGGATGACGG + Intergenic
982739026 4:159038749-159038771 AGGGACAAGGAGCTGGAGGTTGG + Intronic
983032400 4:162819085-162819107 AGGGGCAAGGTGAAGAAGAAAGG + Intergenic
983500933 4:168499222-168499244 AGGGAGACGGGGAAGAAGGAAGG + Intronic
983575430 4:169256292-169256314 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
984201385 4:176724913-176724935 AGGGGCAAGGGTAGGGAGGATGG + Intronic
984318284 4:178157458-178157480 AGGAACAAGGTGAAAGATGAGGG + Intergenic
984443026 4:179797322-179797344 AGGGAGAAAGTGAGGGAGGGAGG + Intergenic
984687365 4:182685217-182685239 AGGGAAGAAGAGAAGGAGGAAGG - Intronic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703553 4:182833357-182833379 AGGGGAGAGGGGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985009860 4:185570957-185570979 AGGGGATGGGTGAAGGAGGAGGG + Intergenic
985057556 4:186048727-186048749 AGAGACACGGAGAAGGAGGTGGG + Intergenic
985117364 4:186605302-186605324 AGTGAGAAGGGGGAGGAGGAGGG + Intronic
985434625 4:189916978-189917000 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
985440433 4:189979843-189979865 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
985957449 5:3276108-3276130 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957464 5:3276156-3276178 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957482 5:3276203-3276225 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957493 5:3276235-3276257 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957504 5:3276267-3276289 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957515 5:3276299-3276321 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957546 5:3276379-3276401 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957557 5:3276411-3276433 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
985993816 5:3585083-3585105 AGGGACAAGAGGAAGGAAGGAGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986551525 5:8961359-8961381 AACCAAAAGGTGAAGGAGGAGGG - Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
986733869 5:10653980-10654002 AGAGACAAGGTGACGGGGGCAGG - Intergenic
987175971 5:15309893-15309915 AGGGACAGGATGAAAGAGGGCGG + Intergenic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988801198 5:34698154-34698176 AGGGAGGAGGGGAGGGAGGAAGG - Intronic
989056342 5:37369470-37369492 AGAGACTGGGTGAAAGAGGAAGG + Intronic
989127863 5:38074449-38074471 GGGGACATGATGGAGGAGGATGG - Intergenic
989437466 5:41431882-41431904 ATGGACAAGTTGCAGGAGAATGG - Intronic
989761208 5:45018892-45018914 AGGGATTAAGTGAAGCAGGAAGG - Intergenic
989795935 5:45472513-45472535 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
990690248 5:58355747-58355769 AGGGTGAGGGGGAAGGAGGAAGG - Intergenic
990762308 5:59143145-59143167 AGGGAGGAAGGGAAGGAGGAAGG - Intronic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991217607 5:64173615-64173637 AGGGGAAAGGGAAAGGAGGAGGG - Intronic
991638685 5:68732363-68732385 AGGGACAAAGGAAAGGAAGAAGG - Intergenic
991927435 5:71719194-71719216 AGGGAGGAGGCGAAGAAGGAAGG - Exonic
991997710 5:72404458-72404480 AGGCACCATGAGAAGGAGGAAGG + Intergenic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994619930 5:102150920-102150942 AGGGACAACTTGAAGTAGGGAGG - Intergenic
994810273 5:104508590-104508612 AGGGACAAAGAGAAGGAGGGAGG + Intergenic
994945058 5:106377164-106377186 AGTGAGAAAGGGAAGGAGGAAGG - Intergenic
994957194 5:106546975-106546997 AGGGAAAAAGGGAAGGAGGGAGG + Intergenic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
995307316 5:110668474-110668496 AGGGGCAAAGTGAAGAAGAATGG + Intronic
996034585 5:118744002-118744024 AGGGAAGAAGAGAAGGAGGAAGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996873256 5:128215429-128215451 AGGGCCAAGGGGTAGGAGGCAGG - Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997799251 5:136843389-136843411 AGGGACGGGGAGAAGGAGAAGGG - Intergenic
998267147 5:140674665-140674687 AGGGAAGAGGTGAGGGAGGTGGG - Exonic
998288869 5:140892897-140892919 AGGGTGAAGGAAAAGGAGGATGG - Intronic
998431408 5:142073472-142073494 AGTGACAAGATGAAGGAAAAGGG - Intergenic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999047500 5:148485004-148485026 AGGAAGAAAGGGAAGGAGGAAGG + Intronic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999279598 5:150356608-150356630 AGGGAAAAGGTGAGGTAGGCTGG - Intergenic
999671564 5:153963224-153963246 TGTGACAAGGTGGTGGAGGAGGG + Intergenic
999747127 5:154600889-154600911 AGGGAGAAGGGGCAGGAGCAGGG - Intergenic
999751713 5:154632358-154632380 AGGGAGAAGGGAAAGAAGGAAGG - Intergenic
1000725997 5:164771626-164771648 AGGGAAAGGGTGAAGATGGAGGG - Intergenic
1000936996 5:167313935-167313957 AGGGAATAGGTGGAGGAGAAAGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001003814 5:168031810-168031832 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001132958 5:169079713-169079735 AGGGAAGAGGAGGAGGAGGAGGG + Intronic
1001172208 5:169430345-169430367 AGAGACACGCTGAAAGAGGAAGG + Intergenic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001408736 5:171495379-171495401 AGGGAGAGCGGGAAGGAGGAAGG + Intergenic
1001634314 5:173198824-173198846 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1001647020 5:173289728-173289750 AGGGAGAGAGGGAAGGAGGAAGG - Intergenic
1002422219 5:179154615-179154637 AGGAACCAATTGAAGGAGGAAGG - Intronic
1002611123 5:180419238-180419260 AGAGACACGGAGAAGGAGGGGGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003022458 6:2522777-2522799 GGGGACGTGGTGAAGAAGGAAGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003169502 6:3709946-3709968 AGGAAGACCGTGAAGGAGGATGG + Intergenic
1003235787 6:4294446-4294468 GGGGGCAAGGTGAGGGAGGGAGG - Intergenic
1003354358 6:5352736-5352758 AGGGAGGAAGGGAAGGAGGAAGG - Intronic
1003439811 6:6129692-6129714 AGGGAGAAGGGGCAGGAGAAAGG - Intergenic
1003487847 6:6595217-6595239 GGGGAAAAGGAGTAGGAGGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003823651 6:9928090-9928112 AGTTCCAAGGTGAAGGTGGAAGG - Intronic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004288024 6:14340736-14340758 AGTGACTAGGTGAAGGATGTTGG - Intergenic
1004468373 6:15906584-15906606 AGTGAGAAGGTGGGGGAGGAAGG - Intergenic
1004551986 6:16656675-16656697 ATGGGCAAGGTGAAAGATGATGG - Intronic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1004758435 6:18639122-18639144 AAGGACAAGGTGAAACAGGGTGG + Intergenic
1004892680 6:20116497-20116519 AGGGACAGAAGGAAGGAGGAAGG + Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1005689357 6:28287288-28287310 TGTGACAAGGTGAAGGCAGAGGG - Intronic
1006147588 6:31968649-31968671 AGGGGCAAGGAGAAGGCTGACGG + Intronic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006520857 6:34570345-34570367 AGCGAGGGGGTGAAGGAGGAGGG - Intergenic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006620699 6:35361838-35361860 GGGCACGAGGTGATGGAGGAAGG + Intronic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1006724543 6:36188248-36188270 AGAGAGAAAGGGAAGGAGGAAGG - Intergenic
1006743333 6:36324439-36324461 AGGGAGAAGGTGCAGGATGAGGG - Intronic
1007170395 6:39858815-39858837 GGGGAACAGGTGAGGGAGGATGG + Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007440821 6:41858405-41858427 TGGGAAGTGGTGAAGGAGGAAGG - Intronic
1007660465 6:43482230-43482252 AGTTGCAAGGTGAAGGATGATGG + Intronic
1007698185 6:43747138-43747160 GGGGACATGGAAAAGGAGGAAGG - Intergenic
1007705098 6:43785679-43785701 AAGGACCAGGGGATGGAGGAAGG - Exonic
1007741045 6:44009636-44009658 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1007767763 6:44171052-44171074 AGGGACAATGGGCTGGAGGAGGG + Intronic
1007925473 6:45646472-45646494 AGAGCCCAGGTGCAGGAGGAAGG + Intronic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008221808 6:48863405-48863427 GGGGAAATGGTGAAGGAGGTTGG - Intergenic
1008461898 6:51785155-51785177 TGGGAGGAGGTAAAGGAGGAAGG + Intronic
1008828319 6:55726785-55726807 TGGCAGAAGGTGAAAGAGGAAGG + Intergenic
1008928382 6:56911188-56911210 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1009562929 6:65272335-65272357 AGGGACAAGGTCAAGGTCAAGGG - Intronic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011746938 6:90415251-90415273 ACGGCCAGGGTGGAGGAGGAAGG - Intergenic
1011798462 6:90983043-90983065 AGGGACGAGGGGAGGGAGGGAGG - Intergenic
1012422279 6:99078467-99078489 AGGGAGGAAGGGAAGGAGGAAGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012728293 6:102845002-102845024 AGTGACAAGGTAAAGGTGGAAGG + Intergenic
1012744425 6:103066514-103066536 AGATACAATGTGAAGGTGGATGG - Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1014205684 6:118652279-118652301 AGGAAGAACGTGAAGGAGTAGGG - Intronic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1014436295 6:121424507-121424529 GGGGACAGGGTGAGGCAGGAGGG + Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015921002 6:138266362-138266384 AGGGAAAAGGGAAAGGAGAAGGG + Intronic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016724638 6:147348360-147348382 GGGGACAGGGAGTAGGAGGAAGG - Intronic
1016828819 6:148413456-148413478 AGGGAGAAAGGGGAGGAGGAAGG + Intronic
1016998633 6:149979236-149979258 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1016999757 6:149988574-149988596 AGGGAGAAGGGAGAGGAGGATGG + Intergenic
1017006859 6:150033700-150033722 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1017286373 6:152681039-152681061 AGGGACAGAGGGAGGGAGGAAGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017741797 6:157413067-157413089 AGGGAGACGGTGAATGAGGGAGG + Intronic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018221213 6:161581592-161581614 ATGGACAAGGTGAAGGGCGTTGG + Intronic
1018322905 6:162632486-162632508 GGGGACTATGAGAAGGAGGAGGG + Intronic
1018577680 6:165276643-165276665 AGGGACAAGGACAATGAAGAGGG - Intergenic
1018779161 6:167046377-167046399 AGGGAAAAATGGAAGGAGGAAGG + Exonic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019170927 6:170132773-170132795 AGGCACGAGGTGAAGAAAGACGG + Intergenic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019502892 7:1374012-1374034 AGGAAGAGGGTGAAGGGGGAGGG + Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1021450614 7:20780353-20780375 AGAGAGAAGGTGAGGAAGGAAGG + Intergenic
1021783276 7:24127690-24127712 TGTGAGAAGGTGAAGGAGGGAGG - Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023052522 7:36265604-36265626 AGGGACGAGGAAAAGGAAGATGG - Intronic
1023073966 7:36464982-36465004 AGAGACAAGGAGTTGGAGGAAGG + Intergenic
1023397379 7:39763791-39763813 AGGGAAAGAGGGAAGGAGGAAGG - Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1024051181 7:45624342-45624364 AGGGGCAGGGGGAAGGAGGGTGG + Intronic
1024070979 7:45785075-45785097 AGGGAAAGAGGGAAGGAGGAAGG - Intergenic
1024099193 7:46011676-46011698 GGTGATAAGGTGTAGGAGGAGGG - Intergenic
1024171334 7:46791058-46791080 AGGGAAGAGGTGAAGGATAAGGG + Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024380953 7:48695317-48695339 AGGGAAGAGGGGAGGGAGGAAGG + Intergenic
1024422286 7:49182681-49182703 AGCCATCAGGTGAAGGAGGATGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024681717 7:51696875-51696897 AGGGTAAAGGTGAAGGAAGAGGG + Intergenic
1024965326 7:55018951-55018973 AGGGACCAGGCGGCGGAGGAGGG - Intergenic
1025135292 7:56406677-56406699 AGGGAAAGAGGGAAGGAGGAAGG + Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025769926 7:64495079-64495101 AGAGTCCAGGGGAAGGAGGAGGG - Intergenic
1025777355 7:64570509-64570531 AGGGGCAAGGGGGAGGGGGAAGG + Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026015389 7:66667459-66667481 AGGGACCAGGTGAGGGAGGAGGG - Intronic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026305287 7:69134966-69134988 AGGTAGAGAGTGAAGGAGGAAGG - Intergenic
1026405047 7:70056389-70056411 AGGGTGAAGGTGATGAAGGAGGG - Intronic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026571911 7:71538789-71538811 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1026769622 7:73187156-73187178 AGGAGCAAGGTGGGGGAGGAGGG + Intergenic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026891801 7:73986611-73986633 AGGGACCAGGTGAGGGAGGAGGG - Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027010491 7:74740542-74740564 AGGAGCAAGGTGGGGGAGGAGGG + Intronic
1027044112 7:74980320-74980342 AGGGATAAGGTGAAGCATGGTGG + Intronic
1027077551 7:75205502-75205524 AGGAGCAAGGTGGGGGAGGAGGG - Intergenic
1027079533 7:75222038-75222060 AGGGATAAGGTGAAGCATGGTGG - Intergenic
1027131122 7:75592158-75592180 AAAGACAAAGGGAAGGAGGATGG + Intronic
1027254217 7:76420169-76420191 AAGGAGGAGGTGGAGGAGGAGGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027712523 7:81623512-81623534 AGGAAGAAGGTGAAGGAGAAGGG + Intergenic
1028097646 7:86782173-86782195 AGGGTGAAAGGGAAGGAGGAAGG - Intronic
1028679879 7:93514112-93514134 AAGGACAAGGTGAACTAAGATGG + Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029244775 7:99191127-99191149 AGGGAGATGGTGAAGCAGGTGGG - Intronic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1029628873 7:101737821-101737843 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1029977510 7:104848642-104848664 AGGGAAAAGGAGAAGGGGAAAGG + Intronic
1030224396 7:107132699-107132721 TGGGAAAACTTGAAGGAGGAAGG + Intronic
1030285273 7:107820084-107820106 AGAGACACTGTGGAGGAGGAAGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031078672 7:117238153-117238175 AGAGACAAGCTGGAGAAGGAGGG - Intergenic
1031141667 7:117949536-117949558 ATGGACAATGTGAAGGGAGATGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031866090 7:127039904-127039926 AGGGGGAAGGTGAAGGGGAAGGG + Intronic
1032123822 7:129176167-129176189 AGGGAAAAGGGAAAGAAGGAAGG + Intergenic
1032243589 7:130187510-130187532 AGGGACTAGGGGTAGGAGAAAGG - Intronic
1032246504 7:130218067-130218089 AAGGACAAGATGAAGCAGCAGGG + Intergenic
1032345308 7:131110720-131110742 AGGAACTTGGGGAAGGAGGATGG - Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032580140 7:133096526-133096548 AGGGAAGATGTGATGGAGGAAGG + Intergenic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1032746312 7:134790130-134790152 AGGGAAAAGGGGGAAGAGGAGGG + Intronic
1032751158 7:134843096-134843118 AGGCCCAAGATGAAGGAAGACGG - Intronic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1032996129 7:137448592-137448614 AGGGAGGAAGGGAAGGAGGAGGG + Intronic
1032996143 7:137448628-137448650 AGGGAGGAAGGGAAGGAGGAGGG + Intronic
1032996157 7:137448664-137448686 AGGGAGGAAGGGAAGGAGGAGGG + Intronic
1032996170 7:137448700-137448722 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033283393 7:140021622-140021644 AGGGGCCAGGTGATGGAGAAGGG - Intergenic
1033361862 7:140643612-140643634 GGCCACAAGGTGAAGGAGGGAGG - Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033656978 7:143381288-143381310 AGGGACACACGGAAGGAGGAGGG - Exonic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033930870 7:146519335-146519357 AGGGAACAGATGAGGGAGGAAGG + Intronic
1034043626 7:147905333-147905355 TGGGACAAGGTGATGGTGGCAGG - Intronic
1034064590 7:148124103-148124125 AGGGACTGGCTGAAGGAGCAAGG + Intronic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034422289 7:150996196-150996218 TGGGACGGGGAGAAGGAGGAAGG - Intronic
1034438404 7:151074625-151074647 AGGGTTAAGGTGAATGTGGAGGG - Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1034998781 7:155594993-155595015 AGGCAGGAGGGGAAGGAGGAAGG + Intergenic
1035037331 7:155903802-155903824 AGTGACATAGTGAAGGCGGAGGG - Intergenic
1035408645 7:158619095-158619117 AGGGGCTAGGGGACGGAGGATGG + Intergenic
1035426899 7:158784051-158784073 AGGCACAGGGAGGAGGAGGAGGG + Intronic
1035595313 8:853236-853258 AGGGAGAAGGTGGAGGAGGGAGG + Intergenic
1035618252 8:1018201-1018223 AGGGACAAGCTGAGGACGGAGGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1035865977 8:3082386-3082408 GGGGACATGGTGGAGGACGATGG - Intronic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036296827 8:7544061-7544083 TGGGACAACTTGAAGGAGGGGGG + Intergenic
1036325740 8:7776958-7776980 TGGGACAACTTGAAGGAGGGGGG - Intergenic
1036668110 8:10761244-10761266 AGTGAACAGGTGGAGGAGGAGGG + Intronic
1037540430 8:19865450-19865472 AGGGAGAGAGGGAAGGAGGAAGG + Intergenic
1037676977 8:21059417-21059439 AGTGGCAAGGAGAAGGAGAAGGG - Intergenic
1037710389 8:21350900-21350922 AGGCACAGTGGGAAGGAGGAGGG + Intergenic
1037886652 8:22599391-22599413 AGGGGCGAGGGGAAGGGGGAGGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038691248 8:29765429-29765451 AGGGAACAGGTGCAGGGGGAGGG - Intergenic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039087999 8:33799044-33799066 AAGGAGAAGGTCATGGAGGAGGG + Intergenic
1039428577 8:37506780-37506802 AGGGAGAGAGGGAAGGAGGAAGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041125658 8:54635955-54635977 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041789628 8:61678749-61678771 AGATCCAAGGGGAAGGAGGAGGG - Intronic
1042120202 8:65479093-65479115 ATTGACAAGGTGAAGGCAGAGGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042397825 8:68311905-68311927 AGGGAAAAAGAGAAGGAAGAAGG - Intronic
1042397832 8:68311941-68311963 AGGGAGACAGGGAAGGAGGAAGG - Intronic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043112453 8:76203365-76203387 AAGGACTCAGTGAAGGAGGAAGG - Intergenic
1043439176 8:80261554-80261576 TGTGACCATGTGAAGGAGGAGGG + Intergenic
1043467668 8:80528487-80528509 AGGGACAAGGTGCGGGGGAAGGG - Intergenic
1044096893 8:88078047-88078069 AGGGAGAGAGGGAAGGAGGAAGG - Intronic
1044358051 8:91248351-91248373 AGGGAAAAAGTGCAGCAGGAGGG + Intronic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1044714270 8:95086561-95086583 AGAGACAAGAGGAAGGAGGGAGG - Intronic
1045155288 8:99462149-99462171 AGGGAGAAAGGGAGGGAGGAAGG - Intronic
1046011825 8:108557753-108557775 AGGGAGTAAGGGAAGGAGGAAGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046485920 8:114888393-114888415 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1046632531 8:116635587-116635609 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1046695357 8:117333588-117333610 AGGGACTTGGTGGGGGAGGACGG - Intergenic
1046890412 8:119416080-119416102 ACGGTCAGGGTGGAGGAGGATGG + Intergenic
1047468608 8:125144669-125144691 AGGGGCAAAATGAAGGAGAAAGG - Intronic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048165928 8:132061386-132061408 AGGGACAGAGAGAAGGAGGAAGG - Intronic
1048268221 8:133005942-133005964 AGGGAGAAGATGGAGTAGGAGGG - Intronic
1048325575 8:133436568-133436590 AGTGGCAAAGTGAAGGATGAGGG - Intergenic
1048416473 8:134232697-134232719 AGAGAGAAGGTGAGGGAGAATGG - Intergenic
1048460042 8:134614054-134614076 AGGGTCTAGGTGGAGGAGGATGG - Intronic
1048672468 8:136738493-136738515 AGGGAAACAGTGCAGGAGGAAGG + Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1048767493 8:137860822-137860844 GGAGACAAGGTGCTGGAGGAAGG + Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049004593 8:139846744-139846766 AGGGACTGGATGAGGGAGGATGG - Intronic
1049083181 8:140458077-140458099 AGGGAGAGGGTGGAGGAGGGAGG + Intronic
1049208945 8:141376499-141376521 AGGGAAGAGGTGAGGGAGGCTGG + Intergenic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049383817 8:142330985-142331007 AGGGACAGGGTGAGGGCAGAAGG + Intronic
1049632364 8:143665597-143665619 AGGGACAGGGATAAGGGGGATGG + Intergenic
1049825789 8:144666932-144666954 AGGGACAGGACCAAGGAGGAGGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050290169 9:4145749-4145771 AGGGAGAAAGTGAGGGAGGGAGG - Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051493150 9:17689597-17689619 AGGGACAGTGCTAAGGAGGAGGG - Intronic
1051518728 9:17960205-17960227 AGGGACAAAGTGATAAAGGAGGG + Intergenic
1052283800 9:26761959-26761981 AGGGAGCAGGGGATGGAGGAGGG + Intergenic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1052785058 9:32820652-32820674 TGGGAAGAAGTGAAGGAGGAGGG - Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053060129 9:35024160-35024182 AGAGACACGGAGAAGGAGGGTGG + Intergenic
1053073173 9:35112883-35112905 AGGGACTAGGGGGAAGAGGAAGG - Intronic
1053174086 9:35909893-35909915 AGGGACATGAGGAGGGAGGAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053306530 9:36988016-36988038 AGCGAGAAGATGAAGAAGGAGGG + Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053677460 9:40448767-40448789 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1053723685 9:40975051-40975073 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
1053927210 9:43074921-43074943 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1054286261 9:63176145-63176167 AGGGCCAAGGGGAAGAAAGATGG + Intergenic
1054290532 9:63284294-63284316 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1054342275 9:63876948-63876970 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1054388554 9:64588835-64588857 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1054507162 9:65927528-65927550 AGGGCCAAGGGGAAGAAAGATGG + Intergenic
1054734927 9:68741507-68741529 GGGGTCAAGGTGGAGGATGAGGG + Intronic
1054792043 9:69265536-69265558 AGGGAAAAGGACAAGCAGGAGGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1054981257 9:71209385-71209407 AGGGAGAGGGGGAAGGAGGGAGG + Intronic
1055271295 9:74562584-74562606 TGGGTCATGGTGAAGGAGTAGGG - Intronic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055502433 9:76915026-76915048 GGTGACAGGGTGAAGGAGGTGGG - Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056004419 9:82252724-82252746 AGGTTCAGAGTGAAGGAGGAGGG - Intergenic
1056320730 9:85432449-85432471 AGGGACAAAGGCAAGGAGGTGGG + Intergenic
1056662340 9:88553464-88553486 AGAGACAAGGAGAAGGAGGGTGG - Intronic
1056897562 9:90565255-90565277 AGGGAAGGGGAGAAGGAGGAGGG - Intergenic
1057818995 9:98316938-98316960 AGGCTCATGGTGAAGGAGGAGGG - Intronic
1057861282 9:98642913-98642935 AGGGAGACAGTGCAGGAGGAGGG - Intronic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1060190326 9:121588542-121588564 AGGGGAAGGGTGAAGGGGGAAGG + Intronic
1060430561 9:123547859-123547881 GGTGACAAAGTAAAGGAGGAAGG - Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1060830241 9:126709201-126709223 TGGCAGAAGGTGAAGGAGCAAGG - Intergenic
1061205762 9:129162363-129162385 AGGGACCAGGAGAAGGTGGCAGG + Intergenic
1061445464 9:130634867-130634889 AGGTACAGGGTGGAGGACGAAGG - Intronic
1061679916 9:132237910-132237932 AGGGACAAAGTGAAGGGGGCAGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061869911 9:133515119-133515141 AGGGAGAAAGTGGAGGAGGGAGG - Intronic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1061994622 9:134177271-134177293 AGAGACACGGGGGAGGAGGAGGG - Intergenic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062088225 9:134659650-134659672 AGGGCCATGGTGATGCAGGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062588733 9:137263503-137263525 AGGGCCAGGGGGAAGGAGGGAGG - Intronic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1203451474 Un_GL000219v1:120947-120969 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1203363548 Un_KI270442v1:238053-238075 AGGGACAAGGGGAAGAGGGAAGG + Intergenic
1203654033 Un_KI270752v1:6531-6553 AGGGAGAAAGTGAATAAGGATGG - Intergenic
1185584182 X:1232968-1232990 AGGGGCATGGTGAATGAGAAGGG + Intergenic
1185698427 X:2213301-2213323 AGGGAGGAAGGGAAGGAGGAAGG + Intergenic
1186007780 X:5093410-5093432 AGGGTGGAGGTGCAGGAGGAAGG + Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186111178 X:6257383-6257405 AGGCACATATTGAAGGAGGAAGG - Intergenic
1186140487 X:6567056-6567078 GGGCACCAGGTGGAGGAGGAGGG - Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1186451439 X:9677142-9677164 TGGGACAAGGTGGTGGAGGTGGG - Intronic
1186471161 X:9823081-9823103 AGGGAGAAGGAGGAGGAGAAGGG - Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186639197 X:11437090-11437112 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187205582 X:17177998-17178020 AGGGCACAGGTGTAGGAGGATGG + Intergenic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187444225 X:19346210-19346232 AGGGAGAAGGGGAGGGAGAAGGG + Intronic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1188388731 X:29593198-29593220 TGGGATAAAGTGGAGGAGGAGGG - Intronic
1188740209 X:33769136-33769158 AGGGAAAAGGGAAGGGAGGAGGG + Intergenic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189142348 X:38620036-38620058 AGGGACATGGCGAGGGTGGATGG + Intronic
1189726187 X:43969904-43969926 CGGGAGGAGGTGGAGGAGGAAGG + Intronic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG + Intergenic
1190100761 X:47521242-47521264 AGGGACAAGATGAAAGAGAAAGG - Intergenic
1190110928 X:47588437-47588459 AGGGGGAAGGTGAAGTAGCAGGG + Intronic
1190341962 X:49303987-49304009 AGGGGCCAGGACAAGGAGGAAGG + Intronic
1190407608 X:50103212-50103234 GAGGACAAGGTGAGGGCGGATGG - Intergenic
1190619322 X:52269586-52269608 AGGGGCAGGGTGGAGTAGGATGG + Intergenic
1191777097 X:64826511-64826533 AGGGACTGGGGGAAAGAGGAAGG + Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192369089 X:70498655-70498677 AGGGACCTGGAGGAGGAGGAAGG + Intronic
1193217452 X:78880876-78880898 AGGATCAAGGTGCAGGGGGAGGG + Intergenic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195682216 X:107555898-107555920 AGGGCCATGATGAAGGAGGTGGG + Intronic
1195965367 X:110425327-110425349 AGTGGGAAGGTGAAGGAAGAAGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196001615 X:110793414-110793436 AGGGAGGAGGTAAAGAAGGAAGG - Intronic
1196707120 X:118726557-118726579 AGGGAAAAGGGGAAGTAAGAGGG + Intergenic
1196898418 X:120360268-120360290 AGGGACAAGGGGAGGGAGAAAGG - Intergenic
1197112678 X:122795292-122795314 AGGGTCAGGGAGAGGGAGGAGGG + Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197508206 X:127335332-127335354 AGTGACAAGGTAAACCAGGAAGG + Intergenic
1197516726 X:127441262-127441284 AGGAACAAGGTGTTGGAGCAAGG - Intergenic
1198960287 X:142175420-142175442 TGGGAAAAGGGGCAGGAGGAGGG - Intergenic
1198971348 X:142284009-142284031 AGGGACAGATTGAAGGAGAAAGG - Intergenic
1199061518 X:143361204-143361226 AGGGAAGAGTTGTAGGAGGATGG - Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199714472 X:150496657-150496679 AGGGACGGGGTAAAAGAGGAAGG - Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199895635 X:152125081-152125103 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1199895642 X:152125101-152125123 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1200098318 X:153674404-153674426 GGGGAAGAGGTGGAGGAGGAGGG - Intronic
1200395047 X:155980724-155980746 AGGGACAACTTGAAGCAGGGAGG - Intergenic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1200770852 Y:7124047-7124069 AGGGAGAATGGGAAGGAGAATGG + Intergenic
1201058061 Y:10015525-10015547 AGGGACAGAGGGAAGGAAGAAGG + Intergenic
1201146430 Y:11067535-11067557 AGGGAGAGGGTGAGGAAGGAAGG + Intergenic
1201785004 Y:17766307-17766329 AGGGAAAAGGGAAAGGAGAAAGG + Intergenic
1201816548 Y:18139680-18139702 AGGGAAAAGGGAAAGGAGAAAGG - Intergenic
1201856297 Y:18548075-18548097 AGGTTGAAGGTGAAGGAGGAGGG - Exonic
1201877024 Y:18772309-18772331 AGGTTGAAGGTGAAGGAGGAGGG + Exonic
1201887705 Y:18903963-18903985 AGGTAAAAGGGGATGGAGGAAGG + Intergenic
1202111705 Y:21427737-21427759 AGGGGCTGGGTGAATGAGGATGG - Intergenic
1202327954 Y:23712282-23712304 AGGGAAAAGGGAAAGGAGAAAGG + Intergenic
1202542816 Y:25957770-25957792 AGGGAAAAGGGAAAGGAGAAAGG - Intergenic