ID: 1011517067

View in Genome Browser
Species Human (GRCh38)
Location 6:88166327-88166349
Sequence CCCTCCGCTCGCGCTGTCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011517055_1011517067 26 Left 1011517055 6:88166278-88166300 CCAGCCCGGGCGCCCGTCGCCTC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517059_1011517067 13 Left 1011517059 6:88166291-88166313 CCGTCGCCTCGTCCCGCTCGCGC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517060_1011517067 7 Left 1011517060 6:88166297-88166319 CCTCGTCCCGCTCGCGCAGTCCC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517056_1011517067 22 Left 1011517056 6:88166282-88166304 CCCGGGCGCCCGTCGCCTCGTCC 0: 1
1: 0
2: 3
3: 7
4: 126
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517057_1011517067 21 Left 1011517057 6:88166283-88166305 CCGGGCGCCCGTCGCCTCGTCCC 0: 1
1: 0
2: 2
3: 9
4: 206
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517054_1011517067 29 Left 1011517054 6:88166275-88166297 CCGCCAGCCCGGGCGCCCGTCGC 0: 1
1: 0
2: 3
3: 27
4: 252
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517061_1011517067 1 Left 1011517061 6:88166303-88166325 CCCGCTCGCGCAGTCCCTGCCGC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517058_1011517067 14 Left 1011517058 6:88166290-88166312 CCCGTCGCCTCGTCCCGCTCGCG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1011517062_1011517067 0 Left 1011517062 6:88166304-88166326 CCGCTCGCGCAGTCCCTGCCGCT 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011517067 Original CRISPR CCCTCCGCTCGCGCTGTCTC TGG Exonic
901674122 1:10872967-10872989 CCCTCCCCTCAGGCTGCCTCGGG + Intergenic
901676435 1:10888655-10888677 CCCTCCGCCCCTTCTGTCTCGGG - Intergenic
904268353 1:29331159-29331181 TCCTGCGCTCCCGCTGACTCAGG - Intergenic
904566173 1:31429583-31429605 CCCTCCCCTCACTCTGGCTCAGG - Intronic
905278495 1:36834274-36834296 CCCCCAGCAAGCGCTGTCTCAGG + Intronic
906650288 1:47508178-47508200 CCACCCGCCCGCCCTGTCTCCGG - Intergenic
910786985 1:91010023-91010045 CCCTCCAATCACGCTGTATCTGG + Intronic
921029818 1:211327117-211327139 CGCACCGCTCCCGCTGTCCCCGG - Intronic
922705605 1:227788603-227788625 CCCTCCACTCGCGCCCTCGCGGG - Intergenic
923539213 1:234876151-234876173 TCCTCCCCTGGCACTGTCTCTGG + Intergenic
1062843351 10:687963-687985 CCCTCCGTGTTCGCTGTCTCAGG - Intronic
1075810682 10:125222587-125222609 CCCTCAGCTCTGGCTGTCTAAGG + Intergenic
1078496090 11:11818661-11818683 CCCTCCCCTTGCTCTATCTCTGG + Intergenic
1083614002 11:64017672-64017694 CCCTCCTCCCTCGCTGGCTCTGG - Intronic
1084793366 11:71489050-71489072 CCCTCCCCTCCTGCTCTCTCTGG - Intronic
1087505901 11:99020829-99020851 CCGGCCGCCCGCGCTGTCACCGG - Intergenic
1091348048 11:134868500-134868522 CCCTCCCCTCTCAGTGTCTCGGG - Intergenic
1093972962 12:25391567-25391589 CCCTCCGCAGCCGCTGGCTCGGG - Intergenic
1096127700 12:49131549-49131571 CCCTCCCCTCGCGCGGCCGCGGG + Intergenic
1099184558 12:79503518-79503540 CCCACCCCTCCCTCTGTCTCAGG - Intergenic
1100985823 12:100200783-100200805 CCCTCTGCTCGAGCTTTTTCCGG - Exonic
1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG + Intronic
1103555100 12:121761527-121761549 CCCACAGCACGCGCTGCCTCTGG - Intronic
1104755300 12:131265410-131265432 CCCACCGCCCCCGCTGGCTCCGG - Intergenic
1104837222 12:131799484-131799506 GCCTCCGCTGGCCCCGTCTCAGG - Exonic
1105512225 13:21060914-21060936 GCCTCTGCTTCCGCTGTCTCCGG - Intronic
1114069876 14:19098089-19098111 GCCTCGCCGCGCGCTGTCTCAGG - Intergenic
1114092386 14:19301913-19301935 GCCTCGCCGCGCGCTGTCTCAGG + Intergenic
1122666713 14:103334797-103334819 CCCGCCGCTCGGGCTGACTCAGG + Intronic
1122793530 14:104194465-104194487 CTCTCAGCTCGTGCTGTGTCAGG + Intergenic
1123106704 14:105845172-105845194 CCCTCCGCTCCCTCTCTCTGAGG - Intergenic
1123843264 15:24270166-24270188 CCCTCCGCTCCCTCTGTGTGGGG + Intergenic
1124789995 15:32718254-32718276 CCCTCCGTGCGCGCAGGCTCGGG + Intronic
1125092754 15:35813402-35813424 CCCTCCTCTCTAGCTCTCTCTGG + Intergenic
1128582662 15:68820097-68820119 CCCTCCCCACGCGCTCTCCCCGG + Intronic
1132662526 16:1068028-1068050 CCCCCAGCTCCCTCTGTCTCTGG + Intergenic
1132903356 16:2270086-2270108 CCCTCCCCTAGCGCCGACTCTGG - Intergenic
1133838708 16:9389084-9389106 CCCTCACCTGGTGCTGTCTCCGG - Intergenic
1142398707 16:89848025-89848047 GCCTCAGCTCGTGCTGTCCCTGG - Intronic
1147502785 17:40981773-40981795 CCTTCCTCTGGCGCTGTCTAGGG + Intronic
1148183198 17:45620964-45620986 CTCTCCGCTCCCTCTGGCTCTGG + Intergenic
1148265652 17:46224727-46224749 CTCTCCGCTCCCTCTGGCTCTGG - Intronic
1148337536 17:46851644-46851666 CCCCCCGCCCGCGCTGGCCCTGG + Exonic
1148490982 17:48023938-48023960 CCCTCCGCGCCCGCCGGCTCCGG + Intergenic
1148945894 17:51261049-51261071 CCCTCCGCGCCCGCGTTCTCGGG - Intronic
1152847966 17:82614132-82614154 CCCTCCTCTCTCCCTGTGTCGGG - Intronic
1152847978 17:82614169-82614191 CCCTCCTCTCTCCCTGTGTCGGG - Intronic
1157386114 18:47261067-47261089 CGCGCCGCCCGCGCGGTCTCCGG + Intergenic
1160884846 19:1341079-1341101 CCCTCCGCACCCTGTGTCTCTGG - Intergenic
1162486141 19:10961434-10961456 CTCTCCGCGCGCGCTCTCGCCGG + Intronic
1162954565 19:14090937-14090959 CCCTGCGCTCTCGCTCACTCCGG + Intronic
1163517387 19:17773436-17773458 CCCTCCTGTCGCTCTGGCTCAGG + Intronic
1166785298 19:45363714-45363736 CCCACCCCGCGCGCTGTCTGGGG + Intronic
1166852704 19:45768070-45768092 CGGTCCGGTCGCGCTGTCGCCGG + Exonic
1167120832 19:47515365-47515387 CCCTCGGCTCGCGCTGGGGCGGG + Intergenic
925162374 2:1694905-1694927 CCCTCAGCTTGCTGTGTCTCAGG - Intronic
925610387 2:5696816-5696838 CCCTCCCCGCGCGCCGGCTCAGG + Exonic
936795348 2:116196543-116196565 CCCTCCCATTCCGCTGTCTCTGG + Intergenic
938042979 2:128091306-128091328 CCCTGCCCTGGCGTTGTCTCTGG + Exonic
942456304 2:176140691-176140713 CCCTCCGCTCCCGCCCTCCCCGG - Intergenic
946280903 2:218664792-218664814 CCCCCCGCTCCTGCTGCCTCTGG + Exonic
1175902984 20:62367276-62367298 CCCGCCGCGCGCGCTGTCCCTGG - Exonic
1179882815 21:44300488-44300510 CCCTCCGCTCGCGTGGCCTCGGG - Intronic
1180488342 22:15820653-15820675 GCCTCGCCGCGCGCTGTCTCAGG - Intergenic
1180782320 22:18528256-18528278 ACCTCCGCTCCCGCTCGCTCAGG - Exonic
1181125871 22:20702286-20702308 ACCTCCGCTCCCGCTCGCTCAGG - Intergenic
1181239208 22:21467594-21467616 ACCTCCGCTCCCGCTCGCTCAGG - Intergenic
1182903534 22:33918918-33918940 CCCTCCTCTCTCTCTCTCTCTGG + Intronic
1183666610 22:39249851-39249873 CCCTCTCCTAGCGCTGGCTCTGG - Intergenic
1184376806 22:44118788-44118810 CCCTCCGCTTGCTCTGGTTCTGG + Intronic
949397910 3:3634756-3634778 CCTTCCGCTGCCACTGTCTCAGG + Intergenic
950458109 3:13104643-13104665 CCCTCCGGTGGCCCTGGCTCCGG + Intergenic
952326224 3:32322848-32322870 CCCTCTGCTTTCTCTGTCTCTGG - Intronic
960999696 3:123365878-123365900 CCCTCCCCTCCCTCTGCCTCTGG - Intronic
961216189 3:125162461-125162483 CCCTCCGTTGGCTTTGTCTCTGG - Intronic
966947380 3:184786512-184786534 CCCTCCTCTCTCTCTCTCTCTGG - Intergenic
967694329 3:192514497-192514519 CCCTCCGCTGGTTCTGTCTGTGG - Intronic
967979230 3:195055541-195055563 CCCACCGCTCGCTCTCTCTGTGG + Intergenic
973961314 4:56112591-56112613 CCCTCGGCTCCCCCTGTCTGAGG + Intergenic
973982223 4:56316126-56316148 CCCTGCATCCGCGCTGTCTCCGG - Exonic
977906482 4:102483266-102483288 CCCTCCGCAGGCGCTGGCCCGGG - Intergenic
985948368 5:3203952-3203974 CCCTCCGCACGCTCAGTCTTGGG + Intergenic
986284302 5:6348426-6348448 CCCTCCGCCTGTGCTGTCTCTGG + Intergenic
992431633 5:76716133-76716155 CCCTCGGCGAGCGCTGTGTCTGG - Exonic
1002067506 5:176659461-176659483 CCCTCCGCTCGCCTTCTCCCAGG - Intergenic
1005997576 6:30940731-30940753 CCCTCCACTGGGGCTGGCTCAGG + Intergenic
1010617388 6:78029943-78029965 CCCTCCGCTGCCGCTGGCCCGGG - Intergenic
1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG + Exonic
1012391625 6:98747477-98747499 CCCTCCACTCTCTCTGTCTAAGG - Intergenic
1012551062 6:100465077-100465099 CCCTCCGCGCGCCCAGGCTCCGG + Intergenic
1019150186 6:170000491-170000513 CCCTCTGCTTGCGCTGTTGCGGG + Intergenic
1019737177 7:2656347-2656369 CCCTCCACCCTCCCTGTCTCTGG + Intronic
1025196951 7:56941047-56941069 CCCTGAGCACCCGCTGTCTCTGG - Intergenic
1025674996 7:63635890-63635912 CCCTGAGCACCCGCTGTCTCTGG + Intergenic
1034985449 7:155510279-155510301 CCCTCCGCCCGCGCTTTCAAGGG - Intronic
1035476133 7:159145133-159145155 CCCGCCGCGCGCGCTCCCTCTGG + Intergenic
1035831772 8:2702627-2702649 CACTCCGCTGGCTCTGTCTCAGG - Intergenic
1037801424 8:22037862-22037884 CCCTCTGCTACCTCTGTCTCTGG - Intergenic
1039446702 8:37638856-37638878 CCCTCCACTCCCTCTTTCTCTGG - Intergenic
1044638406 8:94352561-94352583 CCCTAGGCTGGGGCTGTCTCAGG + Intergenic
1045327367 8:101126949-101126971 TCCTGCGCTGGCTCTGTCTCGGG + Intergenic
1047750547 8:127877139-127877161 CTCTGAGCTCCCGCTGTCTCAGG - Intergenic
1053434726 9:38067538-38067560 CCCTCCGCTCACGCTGTAGGTGG - Intronic
1053812038 9:41862619-41862641 CCCTCCGCAGCCGCTGGCTCAGG + Intergenic
1054618557 9:67324820-67324842 CCCTCCGCAGCCGCTGGCTCAGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1061396394 9:130346145-130346167 ACCTCCGCCAGCGCTGACTCAGG - Intronic
1061540646 9:131276608-131276630 CCTTCCGCACGCGCTCCCTCCGG + Intergenic
1200249730 X:154546607-154546629 CCCTTCGCTCTCGGGGTCTCAGG + Intronic
1202137100 Y:21676885-21676907 CCCTCCGCAGCCGCTGGCTCGGG + Intergenic