ID: 1011517355

View in Genome Browser
Species Human (GRCh38)
Location 6:88167344-88167366
Sequence CCGTGCACACAGGAGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011517355_1011517359 -7 Left 1011517355 6:88167344-88167366 CCGTCTGCCTCCTGTGTGCACGG No data
Right 1011517359 6:88167360-88167382 TGCACGGATCAAACCTTAATTGG No data
1011517355_1011517361 11 Left 1011517355 6:88167344-88167366 CCGTCTGCCTCCTGTGTGCACGG No data
Right 1011517361 6:88167378-88167400 ATTGGTCTTTACATTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011517355 Original CRISPR CCGTGCACACAGGAGGCAGA CGG (reversed) Intergenic