ID: 1011517359

View in Genome Browser
Species Human (GRCh38)
Location 6:88167360-88167382
Sequence TGCACGGATCAAACCTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011517354_1011517359 -4 Left 1011517354 6:88167341-88167363 CCGCCGTCTGCCTCCTGTGTGCA No data
Right 1011517359 6:88167360-88167382 TGCACGGATCAAACCTTAATTGG No data
1011517353_1011517359 6 Left 1011517353 6:88167331-88167353 CCACTATCAGCCGCCGTCTGCCT No data
Right 1011517359 6:88167360-88167382 TGCACGGATCAAACCTTAATTGG No data
1011517355_1011517359 -7 Left 1011517355 6:88167344-88167366 CCGTCTGCCTCCTGTGTGCACGG No data
Right 1011517359 6:88167360-88167382 TGCACGGATCAAACCTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011517359 Original CRISPR TGCACGGATCAAACCTTAAT TGG Intergenic