ID: 1011517361

View in Genome Browser
Species Human (GRCh38)
Location 6:88167378-88167400
Sequence ATTGGTCTTTACATTTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011517358_1011517361 1 Left 1011517358 6:88167354-88167376 CCTGTGTGCACGGATCAAACCTT No data
Right 1011517361 6:88167378-88167400 ATTGGTCTTTACATTTATCATGG No data
1011517357_1011517361 4 Left 1011517357 6:88167351-88167373 CCTCCTGTGTGCACGGATCAAAC No data
Right 1011517361 6:88167378-88167400 ATTGGTCTTTACATTTATCATGG No data
1011517354_1011517361 14 Left 1011517354 6:88167341-88167363 CCGCCGTCTGCCTCCTGTGTGCA No data
Right 1011517361 6:88167378-88167400 ATTGGTCTTTACATTTATCATGG No data
1011517355_1011517361 11 Left 1011517355 6:88167344-88167366 CCGTCTGCCTCCTGTGTGCACGG No data
Right 1011517361 6:88167378-88167400 ATTGGTCTTTACATTTATCATGG No data
1011517353_1011517361 24 Left 1011517353 6:88167331-88167353 CCACTATCAGCCGCCGTCTGCCT No data
Right 1011517361 6:88167378-88167400 ATTGGTCTTTACATTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011517361 Original CRISPR ATTGGTCTTTACATTTATCA TGG Intergenic