ID: 1011518604

View in Genome Browser
Species Human (GRCh38)
Location 6:88179909-88179931
Sequence GCAGGTGATCAGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011518604_1011518618 25 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518604_1011518613 18 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518613 6:88179950-88179972 GAACCCAGCCCGGAGCCAGCAGG No data
1011518604_1011518610 8 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518604_1011518616 23 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518616 6:88179955-88179977 CAGCCCGGAGCCAGCAGGCAAGG No data
1011518604_1011518620 26 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518620 6:88179958-88179980 CCCGGAGCCAGCAGGCAAGGGGG No data
1011518604_1011518617 24 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518617 6:88179956-88179978 AGCCCGGAGCCAGCAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011518604 Original CRISPR GCAGGTGATCAGAGGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr