ID: 1011518610

View in Genome Browser
Species Human (GRCh38)
Location 6:88179940-88179962
Sequence TCCATTGCCTGAACCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011518608_1011518610 0 Left 1011518608 6:88179917-88179939 CCTCTGATCACCTGCTGGTACTT No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518607_1011518610 1 Left 1011518607 6:88179916-88179938 CCCTCTGATCACCTGCTGGTACT No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518601_1011518610 19 Left 1011518601 6:88179898-88179920 CCTCTCTCTCCCCTCCTGCCCTC No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518602_1011518610 10 Left 1011518602 6:88179907-88179929 CCCCTCCTGCCCTCTGATCACCT No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518603_1011518610 9 Left 1011518603 6:88179908-88179930 CCCTCCTGCCCTCTGATCACCTG No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518609_1011518610 -10 Left 1011518609 6:88179927-88179949 CCTGCTGGTACTTTCCATTGCCT No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518605_1011518610 5 Left 1011518605 6:88179912-88179934 CCTGCCCTCTGATCACCTGCTGG No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data
1011518604_1011518610 8 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518610 6:88179940-88179962 TCCATTGCCTGAACCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011518610 Original CRISPR TCCATTGCCTGAACCCAGCC CGG Intergenic
No off target data available for this crispr