ID: 1011518618

View in Genome Browser
Species Human (GRCh38)
Location 6:88179957-88179979
Sequence GCCCGGAGCCAGCAGGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011518611_1011518618 -7 Left 1011518611 6:88179941-88179963 CCATTGCCTGAACCCAGCCCGGA No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518605_1011518618 22 Left 1011518605 6:88179912-88179934 CCTGCCCTCTGATCACCTGCTGG No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518602_1011518618 27 Left 1011518602 6:88179907-88179929 CCCCTCCTGCCCTCTGATCACCT No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518604_1011518618 25 Left 1011518604 6:88179909-88179931 CCTCCTGCCCTCTGATCACCTGC No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518608_1011518618 17 Left 1011518608 6:88179917-88179939 CCTCTGATCACCTGCTGGTACTT No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518607_1011518618 18 Left 1011518607 6:88179916-88179938 CCCTCTGATCACCTGCTGGTACT No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518609_1011518618 7 Left 1011518609 6:88179927-88179949 CCTGCTGGTACTTTCCATTGCCT No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data
1011518603_1011518618 26 Left 1011518603 6:88179908-88179930 CCCTCCTGCCCTCTGATCACCTG No data
Right 1011518618 6:88179957-88179979 GCCCGGAGCCAGCAGGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011518618 Original CRISPR GCCCGGAGCCAGCAGGCAAG GGG Intergenic
No off target data available for this crispr