ID: 1011521281

View in Genome Browser
Species Human (GRCh38)
Location 6:88209441-88209463
Sequence CTCCGGAAGAGGAAAGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011521276_1011521281 20 Left 1011521276 6:88209398-88209420 CCAGGGGAGCAGACCAAGAATTA No data
Right 1011521281 6:88209441-88209463 CTCCGGAAGAGGAAAGTGAGTGG No data
1011521277_1011521281 7 Left 1011521277 6:88209411-88209433 CCAAGAATTAGTTCAGCATAAGT No data
Right 1011521281 6:88209441-88209463 CTCCGGAAGAGGAAAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011521281 Original CRISPR CTCCGGAAGAGGAAAGTGAG TGG Intergenic
No off target data available for this crispr