ID: 1011531163

View in Genome Browser
Species Human (GRCh38)
Location 6:88322562-88322584
Sequence GCTTTGCTGAGCCTCTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011531163_1011531172 30 Left 1011531163 6:88322562-88322584 CCTACACAGAGGCTCAGCAAAGC No data
Right 1011531172 6:88322615-88322637 CAAGGGCCAGAGCTCAAGCTGGG No data
1011531163_1011531169 12 Left 1011531163 6:88322562-88322584 CCTACACAGAGGCTCAGCAAAGC No data
Right 1011531169 6:88322597-88322619 CCAAGCTTGAGGTGCTAGCAAGG No data
1011531163_1011531170 13 Left 1011531163 6:88322562-88322584 CCTACACAGAGGCTCAGCAAAGC No data
Right 1011531170 6:88322598-88322620 CAAGCTTGAGGTGCTAGCAAGGG No data
1011531163_1011531166 1 Left 1011531163 6:88322562-88322584 CCTACACAGAGGCTCAGCAAAGC No data
Right 1011531166 6:88322586-88322608 CAGGGACTAGCCCAAGCTTGAGG No data
1011531163_1011531171 29 Left 1011531163 6:88322562-88322584 CCTACACAGAGGCTCAGCAAAGC No data
Right 1011531171 6:88322614-88322636 GCAAGGGCCAGAGCTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011531163 Original CRISPR GCTTTGCTGAGCCTCTGTGT AGG (reversed) Intergenic
No off target data available for this crispr