ID: 1011534655

View in Genome Browser
Species Human (GRCh38)
Location 6:88363180-88363202
Sequence AAGCATATCAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011534655_1011534659 6 Left 1011534655 6:88363180-88363202 CCTTCCTCTTTCTTGATATGCTT No data
Right 1011534659 6:88363209-88363231 TTTGGTTTGGTACGCCCTCCAGG No data
1011534655_1011534658 -7 Left 1011534655 6:88363180-88363202 CCTTCCTCTTTCTTGATATGCTT No data
Right 1011534658 6:88363196-88363218 TATGCTTTCTGCTTTTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011534655 Original CRISPR AAGCATATCAAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr