ID: 1011538447

View in Genome Browser
Species Human (GRCh38)
Location 6:88403818-88403840
Sequence GAAATTAAACAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011538447_1011538450 -7 Left 1011538447 6:88403818-88403840 CCCTTCTCCATCTGTTTAATTTC No data
Right 1011538450 6:88403834-88403856 TAATTTCTGCCTATTCTTAAAGG No data
1011538447_1011538452 5 Left 1011538447 6:88403818-88403840 CCCTTCTCCATCTGTTTAATTTC No data
Right 1011538452 6:88403846-88403868 ATTCTTAAAGGTATACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011538447 Original CRISPR GAAATTAAACAGATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr