ID: 1011540395

View in Genome Browser
Species Human (GRCh38)
Location 6:88421360-88421382
Sequence CGGCAAACAACAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011540387_1011540395 19 Left 1011540387 6:88421318-88421340 CCGGATTCAGAGGGATGGGTGTC No data
Right 1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG No data
1011540385_1011540395 23 Left 1011540385 6:88421314-88421336 CCTGCCGGATTCAGAGGGATGGG No data
Right 1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG No data
1011540383_1011540395 24 Left 1011540383 6:88421313-88421335 CCCTGCCGGATTCAGAGGGATGG No data
Right 1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011540395 Original CRISPR CGGCAAACAACAGTGGTGGA CGG Intergenic
No off target data available for this crispr