ID: 1011541202

View in Genome Browser
Species Human (GRCh38)
Location 6:88432125-88432147
Sequence CAGTAGGAGCAGAGGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011541202_1011541211 24 Left 1011541202 6:88432125-88432147 CCTCTCTGCCTCTGCTCCTACTG No data
Right 1011541211 6:88432172-88432194 CAACACTCTCACAAGAGATTGGG No data
1011541202_1011541210 23 Left 1011541202 6:88432125-88432147 CCTCTCTGCCTCTGCTCCTACTG No data
Right 1011541210 6:88432171-88432193 CCAACACTCTCACAAGAGATTGG No data
1011541202_1011541205 0 Left 1011541202 6:88432125-88432147 CCTCTCTGCCTCTGCTCCTACTG No data
Right 1011541205 6:88432148-88432170 ATACACCCCACAGCTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011541202 Original CRISPR CAGTAGGAGCAGAGGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr