ID: 1011545400

View in Genome Browser
Species Human (GRCh38)
Location 6:88477412-88477434
Sequence AATTTACATATAATTGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011545400_1011545407 9 Left 1011545400 6:88477412-88477434 CCACTTTCAATTATATGTAAATT No data
Right 1011545407 6:88477444-88477466 GTTAATGCAAATCAAGGAGTTGG No data
1011545400_1011545406 3 Left 1011545400 6:88477412-88477434 CCACTTTCAATTATATGTAAATT No data
Right 1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011545400 Original CRISPR AATTTACATATAATTGAAAG TGG (reversed) Intergenic
No off target data available for this crispr