ID: 1011550501

View in Genome Browser
Species Human (GRCh38)
Location 6:88527474-88527496
Sequence TCCCAATGCTGAGGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011550494_1011550501 17 Left 1011550494 6:88527434-88527456 CCTTAGGAGACTATCACATAATC No data
Right 1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG No data
1011550492_1011550501 19 Left 1011550492 6:88527432-88527454 CCCCTTAGGAGACTATCACATAA No data
Right 1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG No data
1011550496_1011550501 -5 Left 1011550496 6:88527456-88527478 CCAAGATGTTGAGGTCTTTCCCA No data
Right 1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG No data
1011550493_1011550501 18 Left 1011550493 6:88527433-88527455 CCCTTAGGAGACTATCACATAAT No data
Right 1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011550501 Original CRISPR TCCCAATGCTGAGGGAGGGA AGG Intergenic
No off target data available for this crispr