ID: 1011553373

View in Genome Browser
Species Human (GRCh38)
Location 6:88549742-88549764
Sequence TCCACATAACTGCTGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011553373_1011553375 -1 Left 1011553373 6:88549742-88549764 CCATTCTTCAGCAGTTATGTGGA No data
Right 1011553375 6:88549764-88549786 ATTTTTTGCCTGGAGTCTTGAGG No data
1011553373_1011553376 4 Left 1011553373 6:88549742-88549764 CCATTCTTCAGCAGTTATGTGGA No data
Right 1011553376 6:88549769-88549791 TTGCCTGGAGTCTTGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011553373 Original CRISPR TCCACATAACTGCTGAAGAA TGG (reversed) Intergenic
No off target data available for this crispr