ID: 1011561522

View in Genome Browser
Species Human (GRCh38)
Location 6:88622235-88622257
Sequence CAAGTATTAAACACCTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011561521_1011561522 -3 Left 1011561521 6:88622215-88622237 CCAAGTTTATAAAATATACTCAA 0: 1
1: 0
2: 8
3: 64
4: 647
Right 1011561522 6:88622235-88622257 CAAGTATTAAACACCTATATAGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011561522 Original CRISPR CAAGTATTAAACACCTATAT AGG Intronic
903208460 1:21800729-21800751 CAAGTATTACCCACCTAGAATGG - Intergenic
910494327 1:87809690-87809712 AAAGTATTAAATACCTTTAAAGG - Intergenic
910856758 1:91703482-91703504 TAAGAATTAAACACATCTATAGG + Intronic
911768506 1:101708995-101709017 AAACTTTTATACACCTATATGGG - Intergenic
913712444 1:121499195-121499217 AAAGTACTAAACAGCTATCTGGG - Intergenic
917302980 1:173597814-173597836 GAATTATTAATCATCTATATAGG + Intronic
917785388 1:178450645-178450667 CAAGTAATAAACACATATTTAGG + Intronic
917935646 1:179864137-179864159 CTATTAGGAAACACCTATATAGG - Intronic
918666593 1:187158595-187158617 TAAGCATTAAACATCTATAGTGG + Intergenic
918942306 1:191016418-191016440 AAAATATTAGACACCTAAATGGG - Intergenic
920022114 1:202964221-202964243 CAAAAATTAGACACATATATAGG - Intronic
921104867 1:211966541-211966563 CAAGTAATAGAAACCTATAGCGG - Intronic
1065272371 10:24048204-24048226 CATGTATTACATATCTATATGGG + Intronic
1065735195 10:28745176-28745198 CAAGTATGAAAGCCCTAAATTGG + Intergenic
1070895585 10:79981449-79981471 CAAGTGTAAGAAACCTATATAGG + Intronic
1071246576 10:83771736-83771758 CAATTATTAAACAAATGTATAGG + Intergenic
1071593027 10:86894339-86894361 CAAGTATGTAACAACTGTATAGG - Intronic
1073582671 10:104682270-104682292 CAACTATTAGACACCTACTTTGG - Intronic
1085021052 11:73208351-73208373 CAAGTATTAAAAGAATATATGGG + Intergenic
1086513222 11:87583291-87583313 CAATTATTAAACATATTTATAGG - Intergenic
1089844961 11:121451543-121451565 CAATTATTACACAGCTATACAGG - Intergenic
1098746184 12:74240045-74240067 CACATATTAAGCACATATATTGG + Intergenic
1098922014 12:76311426-76311448 CAAGGACAAAACACATATATAGG - Intergenic
1099727246 12:86447805-86447827 CAAGTACAAAACACCTAAGTAGG - Intronic
1102078784 12:110081079-110081101 CAAGTATTAAACACGAAGATAGG + Intergenic
1103464047 12:121127924-121127946 CACGTATTAAACACAAAGATAGG - Intergenic
1106635401 13:31523881-31523903 CAAGAATTCAACACCTGTCTGGG - Intergenic
1108880307 13:55105467-55105489 CTAGAATTAAAAACCTAAATAGG + Intergenic
1110128649 13:71979246-71979268 CAAGTATATACCACCTGTATTGG + Intergenic
1110707782 13:78614402-78614424 CCATTTTTAAAGACCTATATAGG + Exonic
1110856774 13:80305106-80305128 CAAGATTTAAACAGATATATAGG - Intergenic
1111024727 13:82504968-82504990 GAAATATTAAAGACTTATATTGG + Intergenic
1114853325 14:26407000-26407022 CAAGATTTAAAGACCTAGATAGG + Intergenic
1114997234 14:28370174-28370196 CAAGAATGCAACACTTATATGGG - Intergenic
1116943264 14:50811598-50811620 CAGGTATTAAACAATTTTATGGG + Intronic
1118866445 14:69707965-69707987 CTGGTATAAAACTCCTATATAGG - Intronic
1120369746 14:83617820-83617842 CAAGTTGTAATCACCAATATTGG - Intergenic
1124444105 15:29713771-29713793 TAACCATTAAATACCTATATGGG + Intronic
1127276904 15:57454173-57454195 CAAACATCAAACACCTAAATGGG - Intronic
1129064771 15:72892627-72892649 CAAATAGTAAACACATAAATGGG - Intergenic
1134798166 16:17060493-17060515 GAAGTATTAAATACCTTAATAGG - Intergenic
1138081619 16:54095993-54096015 CAGGTAATAAACACATGTATCGG - Intronic
1138126323 16:54441738-54441760 CAAGTGTTGCTCACCTATATAGG - Intergenic
1140911177 16:79454417-79454439 CAAGTAATCAAGACCAATATTGG - Intergenic
1157351579 18:46892220-46892242 CAAGTATTTAAAAACCATATAGG - Intronic
1159115376 18:64107379-64107401 CCAGTATTTATCACCTTTATGGG - Intergenic
1159458722 18:68694834-68694856 GAAGCATTAAACACCTACTTCGG + Intronic
1164005508 19:21144941-21144963 CATGTAGTAAACAGTTATATGGG - Intronic
1164252586 19:23494432-23494454 CAAGTTTTAAAAAAGTATATTGG + Intergenic
1164962739 19:32449266-32449288 AAAGTTTTAAACGCCTAGATTGG + Intronic
927743849 2:25597649-25597671 AAAGTATTAAATACCCATATGGG + Intronic
929087170 2:38179996-38180018 CAAAAATAAAACATCTATATAGG - Intergenic
930929530 2:56863474-56863496 GATTTATTAAAGACCTATATTGG + Intergenic
936552200 2:113455058-113455080 CAAGGATTCAACCCCAATATTGG + Intronic
936555364 2:113492661-113492683 AAAGTATTAAAGACCAATTTAGG - Intronic
936744934 2:115563788-115563810 AAAATATCAAACACTTATATAGG + Intronic
937753360 2:125505102-125505124 CAAATATTAATCACAGATATTGG + Intergenic
938035355 2:128030240-128030262 AATGTATTGAACACCTTTATTGG + Intergenic
938663882 2:133513940-133513962 CAAGTGTCAAACAGCTACATGGG + Intronic
939600279 2:144180478-144180500 TAAGTATAATACACATATATTGG - Intronic
939922236 2:148130502-148130524 CAAGTATGAAACATTTGTATTGG + Intronic
944132151 2:196358270-196358292 CGAGTTTTAAAAACCTATTTCGG + Intronic
945809956 2:214536865-214536887 CAAGTATTAAACATTTATTTAGG - Intronic
1177662817 21:24109153-24109175 AATATATTAAACAGCTATATGGG - Intergenic
1180763971 22:18232412-18232434 CAGAAATTAAACACATATATGGG + Intergenic
1180771673 22:18392130-18392152 CAGAAATTAAACACATATATGGG - Intergenic
1180803052 22:18641744-18641766 CAGAAATTAAACACATATATGGG - Intergenic
1181218665 22:21353516-21353538 CAGAAATTAAACACATATATGGG + Intergenic
1183854733 22:40623733-40623755 CATGTATTAAATACCTATTTTGG + Intronic
1203233511 22_KI270731v1_random:133121-133143 CAGAAATTAAACACATATATGGG - Intergenic
951674632 3:25223481-25223503 AAAGTATTAAAAAAATATATTGG - Intronic
953471462 3:43170192-43170214 CATTTATCAAACACCTTTATAGG + Intergenic
953593392 3:44282914-44282936 GAAGTAATAGATACCTATATGGG + Intronic
957495801 3:80990190-80990212 CAAGTATTAAATACTTAAACAGG - Intergenic
957991502 3:87633146-87633168 TAATTATTTAACACCTATCTTGG + Intergenic
960112653 3:113860318-113860340 CAAGTATTACATACCCATTTTGG - Intronic
966806156 3:183809232-183809254 TAAGTATAAAACACCTTCATGGG - Intronic
971765398 4:30824435-30824457 CAAGTATTAAACATCCTTTTTGG + Intronic
972815325 4:42638725-42638747 CAATTTTTAAACATCTATGTTGG - Intronic
974169493 4:58247450-58247472 CAAGCATTAAAAACTTATTTTGG + Intergenic
975874723 4:78822900-78822922 CAAGTATTACACCCCTCTCTTGG + Intronic
976204109 4:82608403-82608425 CAAGTTTTAAACATCAACATGGG - Intergenic
979763205 4:124432824-124432846 CAAGTATTAAATTCCATTATAGG + Intergenic
979942843 4:126784163-126784185 TAAGTCTTAAACATTTATATGGG - Intergenic
982896169 4:160929935-160929957 AAAGTATTAAACAACTCAATAGG - Intergenic
988826601 5:34942213-34942235 CAAGTTTAAAGCCCCTATATTGG - Intronic
993160404 5:84283213-84283235 CATCTATTAAATACCAATATGGG - Intronic
993725333 5:91360504-91360526 CAAGTTTTAAACTGCAATATTGG + Intergenic
993738183 5:91502793-91502815 CCAGTCTTTAACACCTATATTGG - Intergenic
996069095 5:119113997-119114019 CAAGTATCTAACAAGTATATAGG + Intronic
1000729928 5:164821617-164821639 CATGTATGTAAAACCTATATAGG - Intergenic
1004992884 6:21158835-21158857 GAAGTTTTAAACACTTAAATGGG - Intronic
1007508012 6:42351928-42351950 CCAGTCTGAAACACCTATGTTGG + Intronic
1010079893 6:71848518-71848540 CATTTATTAAACACCTAATTTGG - Intergenic
1010759380 6:79705152-79705174 CAAGTGCTCAACAGCTATATAGG - Intergenic
1011438176 6:87360731-87360753 CAAGTTTAAAGCAGCTATATTGG - Intronic
1011561522 6:88622235-88622257 CAAGTATTAAACACCTATATAGG + Intronic
1013101688 6:106992485-106992507 CAAGTATTAATTACATATACAGG + Intergenic
1013369912 6:109459683-109459705 CAAAGATTAAACACATAAATAGG + Intergenic
1014130008 6:117820004-117820026 CAGGTATTAAACACCAACACTGG - Intergenic
1014192560 6:118514555-118514577 CAAGTTTAAATCTCCTATATTGG - Intronic
1014206233 6:118658408-118658430 CCAGTATAAAATAGCTATATGGG + Intronic
1016650945 6:146459577-146459599 ATAGTAATAAACACCTACATTGG - Intergenic
1019855369 7:3600846-3600868 CAATTTTTAAAAACCTACATTGG - Intronic
1021395442 7:20142266-20142288 AAAGAATTAAAGACCTAAATAGG + Intronic
1023736349 7:43239367-43239389 CAGGAATTAACCACATATATGGG + Intronic
1027331940 7:77106355-77106377 CATGTATTGAATACCTAAATTGG - Intergenic
1028326293 7:89529940-89529962 TAACTATTAAAAAACTATATAGG - Intergenic
1028619719 7:92811850-92811872 CAAGTATCAAACACTTAAAAGGG + Intronic
1036415373 8:8542161-8542183 TAAGTATTAAATGCCTATAGTGG - Intergenic
1037125296 8:15340976-15340998 TAAGAATTAAGCACCTACATCGG - Intergenic
1037125401 8:15341928-15341950 TAAGAATTAAGCACCTACATTGG + Intergenic
1037452599 8:19031564-19031586 AAAGTATCAAACACATATGTAGG + Intronic
1039155158 8:34546910-34546932 AAAGTATTAAACAGTTTTATTGG - Intergenic
1044681535 8:94783406-94783428 TAAGAAGTAAACACATATATTGG - Intronic
1048182903 8:132212814-132212836 CAAGTAATTAATACCTATATGGG - Intronic
1049897630 9:124527-124549 AAAGTATTAAAGACCAATTTAGG + Intronic
1049900808 9:162130-162152 CAAGGATTCAACCCCAATATTGG - Intronic
1050775358 9:9252751-9252773 CAAGTTTTAAACACCTCTTCTGG + Intronic
1051049849 9:12918785-12918807 CAAGTATTAATCAACAATATAGG - Intergenic
1051050136 9:12922983-12923005 CAAATATTAATCAACAATATAGG + Intergenic
1053740721 9:41134815-41134837 AAAGTATTAAAGACCAATTTAGG + Intronic
1053743839 9:41172410-41172432 CAAGGATTCAACCCCAATATTGG - Intronic
1054349117 9:64002225-64002247 CAAGGATTCAACCCCAATATTGG - Intergenic
1054443710 9:65290970-65290992 AAAGTATTAAAGACCAATTTAGG + Intergenic
1054483433 9:65692888-65692910 CAAGGATTCAACCCCAATATTGG + Intronic
1054486564 9:65730533-65730555 AAAGTATTAAAGACCAATTTAGG - Intronic
1054687629 9:68296484-68296506 AAAGTATTAAAGACCAATTTAGG - Intronic
1054795105 9:69294117-69294139 TAATTATTAAACACCAATATGGG - Intergenic
1057854203 9:98590083-98590105 GATGTATTAAACACCTGTTTGGG - Intronic
1185634905 X:1544561-1544583 CAAGTATTACACACATACACTGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190869408 X:54412710-54412732 CAAGTATAAAAACCCTAGATGGG + Intergenic
1197965780 X:132060205-132060227 CAAGTTATAAACACATATCTGGG - Intergenic
1199427345 X:147718200-147718222 CATTTATTGAACACCTATAATGG - Intergenic
1202590131 Y:26473882-26473904 AAAGTATTAAAAACCTAGCTGGG + Intergenic