ID: 1011561569

View in Genome Browser
Species Human (GRCh38)
Location 6:88622806-88622828
Sequence ATACTGATCAACCATGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011561563_1011561569 14 Left 1011561563 6:88622769-88622791 CCTGAGCTCTAGAACCATCATTC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1011561562_1011561569 22 Left 1011561562 6:88622761-88622783 CCACAGTTCCTGAGCTCTAGAAC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1011561565_1011561569 -8 Left 1011561565 6:88622791-88622813 CCTCCCACCTGACAAATACTGAT 0: 1
1: 0
2: 4
3: 17
4: 181
Right 1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1011561564_1011561569 0 Left 1011561564 6:88622783-88622805 CCATCATTCCTCCCACCTGACAA 0: 1
1: 0
2: 3
3: 20
4: 390
Right 1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011561569 Original CRISPR ATACTGATCAACCATGTGCC CGG Intronic
906302394 1:44692536-44692558 CTACTCAGCAAACATGTGCCAGG - Intronic
907353508 1:53853129-53853151 ATATTGAGGACCCATGTGCCAGG + Intronic
907525303 1:55050435-55050457 ATAGGCATCTACCATGTGCCCGG - Intronic
922665139 1:227462276-227462298 TTACTGAACAACTATATGCCAGG - Intergenic
1063276659 10:4576122-4576144 ATATTGAACAACCCTGTCCCTGG - Intergenic
1066630685 10:37456613-37456635 AGACTGAGCACCCATGTGCTTGG + Intergenic
1067327597 10:45284571-45284593 ATGGTGACCAACCATGGGCCTGG + Intergenic
1068243395 10:54335246-54335268 ATACTGTTAAAACATGTCCCTGG + Intronic
1071826100 10:89327696-89327718 ATACTCACCAACCATGTGACTGG - Intronic
1072258073 10:93639933-93639955 TCACTGAACCACCATGTGCCAGG - Intronic
1074428185 10:113370530-113370552 AAACTGATCACCCTTCTGCCTGG - Intergenic
1079193386 11:18301694-18301716 CTCCTGCTCAACGATGTGCCAGG + Intronic
1079582796 11:22087348-22087370 ATACTCATCTACCATAGGCCAGG + Intergenic
1080760156 11:35240885-35240907 TGACTGACCATCCATGTGCCAGG - Intergenic
1081252978 11:40858416-40858438 ATAGGCATGAACCATGTGCCTGG - Intronic
1084724979 11:70935654-70935676 AAACACATCTACCATGTGCCGGG + Intronic
1085034454 11:73291778-73291800 ATACTGATCACCAGTGTGCTGGG - Intronic
1085167894 11:74419990-74420012 TTAAGCATCAACCATGTGCCAGG - Intergenic
1087097408 11:94332439-94332461 ATAGTGTTCATCCATGTGCAAGG + Intergenic
1088639811 11:111861090-111861112 TTATTGAGCAACTATGTGCCAGG - Intronic
1092069647 12:5622311-5622333 ATACTGATAAATCATAGGCCTGG + Intronic
1092640589 12:10504531-10504553 ATTCTTATCAACAATGTGCTAGG - Intergenic
1098506558 12:71258517-71258539 ATACCCATCAACAATGTGCAAGG - Intronic
1098632352 12:72739866-72739888 ATACTGATGAAGCAAGTTCCTGG + Intergenic
1101931882 12:109021354-109021376 TTACTGAGCACCTATGTGCCAGG + Intergenic
1102535785 12:113579936-113579958 ATACTGAGCGACCATGAGCCTGG - Intergenic
1102951469 12:117034349-117034371 ATACTCTTCAGCCATCTGCCAGG - Intergenic
1103390369 12:120568456-120568478 AAATTAATAAACCATGTGCCAGG - Intronic
1104465839 12:128989638-128989660 ATTCTGAGCAGCCATGTGCCTGG + Intergenic
1104988470 12:132610944-132610966 TTTGTGATCGACCATGTGCCAGG + Intergenic
1106749947 13:32752431-32752453 CTTCTGATCATCTATGTGCCAGG + Intronic
1107409307 13:40143699-40143721 ATCCTGCTCTACCATGTGCCAGG - Intergenic
1107699113 13:43029860-43029882 AGGCAGAGCAACCATGTGCCTGG - Intronic
1110640655 13:77820078-77820100 ACACTGATCAACCAAGGACCTGG - Intergenic
1115209279 14:30949150-30949172 ATAATGAACAACCAAGTGTCAGG - Intronic
1117058653 14:51938611-51938633 ATAGTGAGAAAACATGTGCCAGG - Intronic
1117185852 14:53240148-53240170 CTACTGCTCAACCAGTTGCCTGG - Intergenic
1119178074 14:72584245-72584267 ATATTGAACACCCATGTGCCAGG + Intergenic
1120035950 14:79698459-79698481 ATCCTGATTAATCATGTGTCAGG + Intronic
1120164524 14:81181922-81181944 ACACTGCACAACCATTTGCCAGG - Intronic
1122256019 14:100477089-100477111 AAAGTGACCAACCATGTGGCCGG - Intronic
1125335410 15:38621543-38621565 ATATTTATCCACTATGTGCCAGG - Intergenic
1131743361 15:95418494-95418516 ATTCTGGGCAGCCATGTGCCCGG + Intergenic
1131761919 15:95633422-95633444 ATACTGATCAGCTATGTGCTTGG + Intergenic
1132883974 16:2174340-2174362 TCACTGATCACACATGTGCCTGG - Intronic
1135514983 16:23124418-23124440 ACAGTGATAATCCATGTGCCTGG - Intronic
1137402707 16:48166216-48166238 TTCCTGATCAATCATGTGCTAGG - Intergenic
1137484714 16:48881628-48881650 ATATTTATCTACCTTGTGCCAGG - Intergenic
1138976761 16:62217096-62217118 ATAATGTTCAACCAAGTGTCTGG + Intergenic
1140207799 16:72947841-72947863 AAACTGATTATGCATGTGCCGGG + Intronic
1147445097 17:40470300-40470322 CTACAGACCTACCATGTGCCAGG + Intergenic
1148887427 17:50784051-50784073 ATAGTGTTCAGCAATGTGCCTGG + Intergenic
1150544325 17:66138123-66138145 ATACTGATCTCCCATCTGCTTGG - Intronic
1153757807 18:8301574-8301596 ATATTGATCTGCCATGTGCCAGG + Intronic
1154275423 18:12955459-12955481 ATACAGATCCACTATGTGTCTGG - Exonic
1156323419 18:36049924-36049946 ATTCTGACCAGCAATGTGCCAGG + Intronic
1156345327 18:36252113-36252135 GTATTGAGCAACTATGTGCCAGG - Intronic
1156888276 18:42160630-42160652 TTTCTGATCTATCATGTGCCAGG + Intergenic
1157171610 18:45412018-45412040 ATACTGATTAAATAAGTGCCAGG - Intronic
1164887446 19:31794120-31794142 ATACAGGTAAAACATGTGCCAGG + Intergenic
1166170352 19:41024030-41024052 CTACAGAACTACCATGTGCCAGG - Intergenic
1166525165 19:43506059-43506081 ACACTGATAGGCCATGTGCCAGG + Intergenic
1167023972 19:46900935-46900957 ATACTCCTCTACCACGTGCCGGG + Intergenic
937250707 2:120522122-120522144 TTACTGATCTAACATGTGCCAGG - Intergenic
938843297 2:135183299-135183321 ATTCTGAGCAGCCATGGGCCAGG - Intronic
939590004 2:144053057-144053079 AAAATGATCAAGCATGTGCTAGG + Intronic
941220829 2:162778568-162778590 ATGCTTATCTACCGTGTGCCAGG - Intronic
946147245 2:217740377-217740399 ATCATAATCAACCATGTGGCTGG - Intronic
1173870434 20:46338313-46338335 TTGTTGATCAACTATGTGCCTGG + Intergenic
1174547465 20:51336348-51336370 ATTCTGAGCATCTATGTGCCAGG + Intergenic
1176143616 20:63555661-63555683 ATAATGAGCACCCATGTGGCAGG + Exonic
1178342970 21:31801627-31801649 TTACACAACAACCATGTGCCTGG - Intergenic
1179835758 21:44031662-44031684 TCACTGTTCAACCAAGTGCCAGG - Intronic
1182646510 22:31814253-31814275 ATACTAATCAGCTTTGTGCCAGG - Intronic
1183272449 22:36870633-36870655 ATACAGATCAGCCATATCCCTGG + Intronic
949167428 3:959209-959231 ATACTGCCCAACCAGGTTCCAGG + Intergenic
949639464 3:6019030-6019052 ATGATGCTCACCCATGTGCCTGG + Intergenic
951844614 3:27072224-27072246 ATATTTATAAACCATGTGCCTGG - Intergenic
952667340 3:35922602-35922624 ATACAGAGCACCCATTTGCCTGG - Intergenic
953497041 3:43396630-43396652 AAACTTATCAAACATGGGCCGGG - Intronic
956741755 3:72280945-72280967 ATTCTGGGCAGCCATGTGCCTGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
964020193 3:152000747-152000769 AAACTGATCAACTATTTGGCAGG - Intergenic
964020410 3:152003621-152003643 AAACTGATCAACTATTTGGCAGG + Intergenic
965352365 3:167629406-167629428 GTACTGCTCCACCATGTCCCTGG + Intronic
969435490 4:7186812-7186834 TTACTGAGCACCTATGTGCCTGG - Intergenic
975818658 4:78246784-78246806 ATTCTGATCTCCCATGTCCCTGG - Intronic
976126613 4:81839892-81839914 ATACTGAGCATTCATGTTCCAGG + Intronic
982399065 4:154945913-154945935 TTACTTATCTACCATATGCCAGG + Intergenic
986192797 5:5512319-5512341 CTACTCATCTACCATGTGCATGG - Intergenic
990894975 5:60689131-60689153 TTAGTTCTCAACCATGTGCCAGG - Intronic
991478811 5:67054334-67054356 ATAATGTTCAACCATGTTCCCGG - Intronic
992373288 5:76167375-76167397 ATACTAATCAATCATGTTCAAGG - Intronic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
997893148 5:137693088-137693110 TTACTGAACATCTATGTGCCAGG + Intronic
1000806927 5:165806603-165806625 ATGCTTACCAACTATGTGCCAGG - Intergenic
1001007758 5:168069162-168069184 ATACTGTTCAACGAAATGCCAGG - Intronic
1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG + Intronic
1002240706 5:177837399-177837421 CTCCTGGTCAACCATGTGGCAGG - Intergenic
1011223916 6:85086302-85086324 ATACTGATTAACTGTGTTCCAGG + Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1012044292 6:94249604-94249626 GTATTGATCAACTATGTGCCTGG - Intergenic
1015384922 6:132611047-132611069 ATATTGATCAGGCATGTCCCAGG - Intergenic
1016905975 6:149151315-149151337 ACAGTGATAAACCATGTGACTGG + Intergenic
1018790369 6:167143592-167143614 ACACTGACCCTCCATGTGCCTGG + Intergenic
1023210978 7:37804452-37804474 ATACAGAGGAACCATGTGGCTGG + Intronic
1024581602 7:50805272-50805294 AGCCTGATGAACCATGGGCCTGG - Intergenic
1025302221 7:57826920-57826942 ATTATGAGCTACCATGTGCCAGG - Intergenic
1029534448 7:101148072-101148094 AGCCTGAGCCACCATGTGCCTGG + Intergenic
1032792249 7:135251128-135251150 ATAATGTTCAATTATGTGCCAGG + Intronic
1039817848 8:41110583-41110605 ATGCTGACCAAACATGTGGCTGG + Intergenic
1040014844 8:42691726-42691748 ACACTGAAGCACCATGTGCCAGG - Intergenic
1041004627 8:53486525-53486547 TTACTGTTCAACCCTGTACCTGG - Intergenic
1042029406 8:64459232-64459254 ATACTTAAGAAACATGTGCCAGG - Intergenic
1042198201 8:66252531-66252553 ATGCTGATCAGCTGTGTGCCTGG + Intergenic
1042530684 8:69811749-69811771 TTAGTGTTTAACCATGTGCCAGG + Intronic
1042850622 8:73212502-73212524 ATATTGATCTTCCATGTACCAGG - Intergenic
1045333783 8:101180260-101180282 GTACTGATCACCTAGGTGCCAGG - Intronic
1047469454 8:125155017-125155039 TTACTGAACAGCCATGTGCCAGG + Intronic
1047990366 8:130279938-130279960 ATAAACATCAACTATGTGCCAGG + Intronic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1048968890 8:139633364-139633386 ATACTGAGTGACTATGTGCCAGG - Intronic
1051031121 9:12680138-12680160 TTATTGATCATCTATGTGCCAGG - Intergenic
1051366204 9:16323219-16323241 AGACTGAGCAACCACCTGCCAGG + Intergenic
1057216156 9:93230032-93230054 AGACAGATCAACCATCTCCCTGG - Intronic
1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG + Intronic
1060482624 9:124026102-124026124 ATATTGACCTGCCATGTGCCGGG + Intronic
1062370915 9:136238249-136238271 AAACTGATCAGCCAGGGGCCAGG + Intronic
1187246856 X:17560623-17560645 ATAGTGCTGAACCATGTGCTGGG - Intronic
1190598121 X:52066430-52066452 ATACTCATCATCCAGGTGCTTGG + Exonic
1190610703 X:52187643-52187665 ATACTCATCATCCAGGTGCTTGG - Exonic
1196442416 X:115728673-115728695 ATGCTGATCCGCCATGTGCGGGG - Intergenic
1196443141 X:115732231-115732253 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196443800 X:115735199-115735221 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196444373 X:115737692-115737714 ATGCTGATCCGCCATGTGCGGGG - Intergenic
1196445462 X:115844146-115844168 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196446133 X:115847127-115847149 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196446804 X:115850108-115850130 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196447472 X:115853091-115853113 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196448143 X:115856070-115856092 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196448812 X:115859061-115859083 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196449483 X:115862052-115862074 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196450152 X:115865035-115865057 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196450822 X:115868020-115868042 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196451493 X:115870999-115871021 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196452164 X:115873986-115874008 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196452834 X:115876955-115876977 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196453504 X:115879948-115879970 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196454173 X:115882957-115882979 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196454840 X:115885946-115885968 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1196455254 X:115888028-115888050 ATGCTGATCCGCCATGTGCGGGG + Intergenic
1202051594 Y:20786883-20786905 ATTCTCATCAACAATGTGCATGG + Intergenic
1202624332 Y:56842092-56842114 GTACTGATCAGCCATGTGATGGG + Intergenic