ID: 1011565351

View in Genome Browser
Species Human (GRCh38)
Location 6:88666944-88666966
Sequence AAAGGCCTATTGAACTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 3, 2: 39, 3: 39, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011565346_1011565351 5 Left 1011565346 6:88666916-88666938 CCAAGTGCATGGGGCATTATACA 0: 5
1: 5
2: 13
3: 18
4: 93
Right 1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG 0: 1
1: 3
2: 39
3: 39
4: 142
1011565340_1011565351 18 Left 1011565340 6:88666903-88666925 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG 0: 1
1: 3
2: 39
3: 39
4: 142
1011565344_1011565351 9 Left 1011565344 6:88666912-88666934 CCCTCCAAGTGCATGGGGCATTA 0: 4
1: 14
2: 18
3: 31
4: 109
Right 1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG 0: 1
1: 3
2: 39
3: 39
4: 142
1011565345_1011565351 8 Left 1011565345 6:88666913-88666935 CCTCCAAGTGCATGGGGCATTAT 0: 4
1: 15
2: 20
3: 28
4: 107
Right 1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG 0: 1
1: 3
2: 39
3: 39
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011565351 Original CRISPR AAAGGCCTATTGAACTCAGG GGG Intronic
902790049 1:18761680-18761702 AAAGGCAGCTTGAAGTCAGGGGG + Intergenic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
903333158 1:22607785-22607807 AAAGACTGATTGAGCTCAGGAGG - Intergenic
906390511 1:45411371-45411393 AAATGCCTGATGATCTCAGGTGG - Intronic
906435683 1:45794498-45794520 AAATGCCTGATGAACTGAGGTGG + Intronic
907334075 1:53689027-53689049 AAAGTGCTATTGAAAGCAGGGGG - Intronic
908222290 1:62019427-62019449 AATTGCATCTTGAACTCAGGAGG + Intronic
910799047 1:91127656-91127678 AAAGGCCTAATGAGCTCAGTGGG + Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
917253799 1:173092503-173092525 AAAGGCCTTTTGTACAGAGGAGG - Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065945017 10:30598266-30598288 AAGGGCCTATTAAACACAGCCGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068253734 10:54479284-54479306 AAAGGACTAATAAAATCAGGAGG - Intronic
1068890738 10:62146242-62146264 GAAGGCCTGATGAACTGAGGTGG - Intergenic
1071118292 10:82249279-82249301 GAAGGGCTATTGAATTCATGTGG + Intronic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1071434767 10:85637445-85637467 CAAGGCCTATAGAACTCAGGAGG + Intronic
1073501004 10:103937063-103937085 GAAGATCTATTGAGCTCAGGAGG + Intergenic
1076479378 10:130774939-130774961 ACAGGCTTGTTGAACTCATGGGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078463216 11:11531041-11531063 AAAGGCCTATTGCAGGCAGGGGG - Intronic
1080820497 11:35801337-35801359 AAAGGATTATTTAACTCAGGAGG - Intronic
1081927382 11:46842242-46842264 AAAGAACTATTGAAACCAGGGGG + Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085307849 11:75498388-75498410 AAAGCCAAATTCAACTCAGGTGG + Intronic
1088637500 11:111837285-111837307 ATAAGCCTAATGAACACAGGAGG + Intronic
1088991385 11:114956519-114956541 AAAGGGTTATGGAAATCAGGCGG - Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092443228 12:8527734-8527756 CAAGGCCTACTGAACTCCTGGGG - Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1094367323 12:29698024-29698046 AAAGGCCCTTGGAAATCAGGAGG + Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1098340749 12:69448485-69448507 AAAGGCATCTCGAACTCAGCAGG - Intergenic
1098704433 12:73670091-73670113 AAATGCAAATTGAACTCATGGGG - Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1098824262 12:75273148-75273170 AGAGGCTTATTAAATTCAGGAGG + Intergenic
1100339899 12:93668888-93668910 AAGTGCCTATTGAACTCCAGTGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1104743307 12:131194416-131194438 AAAGGCCTGGTGGATTCAGGGGG + Intergenic
1105610825 13:21968433-21968455 AAAGGCCTTTTGGATTTAGGTGG + Intergenic
1105869422 13:24491029-24491051 GAGGATCTATTGAACTCAGGAGG - Intronic
1106484292 13:30158848-30158870 AAATGCCTTCTGAACTCAGCTGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1112190174 13:97169273-97169295 AAGGGGCTAATCAACTCAGGTGG + Intergenic
1116672268 14:47858535-47858557 AAAGGCCTATTGCTCATAGGTGG - Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1118187758 14:63552624-63552646 AAAGGTCACTTGAACCCAGGAGG + Intergenic
1118527892 14:66666429-66666451 TAAAGCCTATTTAACTCTGGTGG - Intronic
1122756682 14:103985876-103985898 AAATGTCTATGGAACCCAGGAGG - Intronic
1127668412 15:61171403-61171425 ACAGACCTACTGAACTCTGGGGG - Intronic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1132304841 15:100803570-100803592 AAAGGCCTATCGATTTCAGTAGG + Intergenic
1133306094 16:4810418-4810440 AAAAATCTATTGAACCCAGGAGG + Intronic
1133422983 16:5663298-5663320 AAAGACCTCTTGAACCCAGGAGG - Intergenic
1133601810 16:7347036-7347058 ACAGGCCTAGTGATCTCAGCAGG + Intronic
1137231672 16:46572580-46572602 AAAGGCAGATTTAATTCAGGAGG + Intergenic
1143377491 17:6475476-6475498 AAAGAGCTATTGAAATCATGTGG + Intronic
1145688621 17:26706801-26706823 AAAGGAATATTCAACTCTGGGGG - Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1145879207 17:28341610-28341632 AGAGGCCTTTGGAACTCAGCAGG + Intronic
1146729483 17:35181805-35181827 AAAAGCATATTAAAGTCAGGGGG + Intronic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1148404880 17:47402642-47402664 AAAGGCCTTTTGAAGTTAAGAGG + Intronic
1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG + Intronic
1151837230 17:76590225-76590247 CAAGGCAGCTTGAACTCAGGAGG - Intergenic
1156099383 18:33575620-33575642 ACATGCCAATTGAACTCTGGAGG + Intergenic
1156447675 18:37249263-37249285 AGAGGCCTAAGGAACTAAGGAGG + Intronic
1156762883 18:40614602-40614624 AAAGGCCTAGTGAATTCCAGAGG + Intergenic
1157791263 18:50533259-50533281 GATGGCATATTGAACTAAGGTGG + Intergenic
1158293677 18:55970312-55970334 AAAGGCTTATTTAACAGAGGTGG - Intergenic
1160705019 19:525581-525603 GAAGGCATCTTGGACTCAGGAGG - Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164219514 19:23180688-23180710 AAAGGCCTAATTGACTTAGGTGG + Intergenic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1167960844 19:53103251-53103273 CAAGGCCTATTTACCTGAGGTGG + Exonic
927110770 2:19862378-19862400 AAAGTCATAGTGAAGTCAGGTGG - Intergenic
929778006 2:44940508-44940530 AAAGGCCCATAGAACACAGAGGG - Intergenic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930902804 2:56528177-56528199 AAAGCCATGTTGAAATCAGGTGG + Intergenic
931229290 2:60360477-60360499 AAAGCCCTGTGGAAATCAGGAGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933250141 2:80020282-80020304 AAAGGCCTATTGTATACAAGGGG + Intronic
933508500 2:83209253-83209275 AATGACATATTGAACTAAGGAGG + Intergenic
936669868 2:114644659-114644681 AAAGGCCTGTTGACCTAAGTTGG + Intronic
938682732 2:133708422-133708444 AAAGGCCTATGGCACAGAGGAGG + Intergenic
939330990 2:140760797-140760819 AAATGCCTCTTGAACCCGGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941498503 2:166238793-166238815 ATAGGCCTATAGAACACAGAGGG + Intronic
942487434 2:176454186-176454208 AAACTCCTATAGAACTTAGGTGG - Intergenic
947561708 2:231159846-231159868 TAATGCCTACTGAACTGAGGTGG - Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947977245 2:234377581-234377603 AAAGGATCCTTGAACTCAGGGGG + Intergenic
1169253023 20:4074684-4074706 AAAGAACAGTTGAACTCAGGTGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173082192 20:39878940-39878962 AAAGAGCTCTTGAAGTCAGGAGG - Intergenic
1174704372 20:52640541-52640563 AATGGACTTTGGAACTCAGGGGG - Intergenic
1181299823 22:21871735-21871757 GAAGGTCTCTTGAACTCAGGAGG + Intergenic
1181624916 22:24116733-24116755 GATGGCCTAGTGAACTCAGGGGG - Intronic
1182658722 22:31909970-31909992 GAAGGTCGCTTGAACTCAGGAGG + Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
952189158 3:31003972-31003994 AATGTCCTCTTGCACTCAGGAGG + Intergenic
952988881 3:38813576-38813598 ATAGGCCTTGTGAACTCAGCTGG - Intergenic
955155779 3:56415153-56415175 TAAGGCCTCTTGAGCTCATGAGG - Intronic
956699370 3:71945261-71945283 AAATGCCTGCTGAACTAAGGGGG - Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961790341 3:129371394-129371416 AAAGATCTCTTGAACCCAGGAGG - Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
965012557 3:163113534-163113556 CAAGGCATATTTAACTCAGCAGG + Intergenic
967192526 3:186997197-186997219 AAAGGACTATAGAGGTCAGGAGG - Intronic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
967942015 3:194773406-194773428 AATGTCCTATTGACCTAAGGAGG - Intergenic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969749588 4:9100051-9100073 GAAGGGTTATTGAACTGAGGGGG + Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970167131 4:13250621-13250643 AAAGGCCTTTTTAGCTCATGAGG - Intergenic
972892008 4:43568634-43568656 AAAGGCCTATGAAATTGAGGGGG + Intergenic
973174266 4:47184990-47185012 GAAGGCCTGTTGCACTTAGGAGG - Intronic
973388771 4:49534462-49534484 AAATGGGTATTGAACACAGGTGG - Intergenic
979426051 4:120568680-120568702 AAAGGGCTGTTGATCTCTGGTGG - Intergenic
979738010 4:124112779-124112801 AGGGGCTAATTGAACTCAGGAGG - Intergenic
979807959 4:124998408-124998430 AAAGTCCAATTGAAGTCATGTGG + Intergenic
980467895 4:133209230-133209252 AAAGGCCTATTCTGCACAGGAGG + Intergenic
980579353 4:134729772-134729794 AAAGGCCTGGTGATCTGAGGTGG + Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
986243943 5:5988308-5988330 AGAGAATTATTGAACTCAGGAGG - Intergenic
988165470 5:27583516-27583538 AGAAGCCTATTGAACTCCTGGGG + Intergenic
989245487 5:39249641-39249663 AAAAGCCTATTGAACATAGTTGG + Intronic
990313393 5:54561425-54561447 AAGGACCTCTTGAGCTCAGGAGG - Intergenic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
994075287 5:95643337-95643359 AAAGCCCTATTAACCTCAGTAGG - Intergenic
995865269 5:116683660-116683682 ATAGACCTATTGTACTCATGAGG + Intergenic
999626144 5:153522397-153522419 AGAGGGACATTGAACTCAGGTGG + Intronic
1000062550 5:157670012-157670034 AAAAGCCTCCTGAACCCAGGTGG + Intronic
1000189396 5:158894776-158894798 AAAAGCCCATTGAAATCAGCAGG - Intronic
1001567268 5:172707586-172707608 GAAGGCCTGCTGAACTCAGAGGG + Intergenic
1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG + Intergenic
1001948628 5:175800393-175800415 AAAGTCCCCTTGAACCCAGGAGG + Intronic
1003595895 6:7473923-7473945 AAAGGCCCATTGAAGGCATGTGG + Intergenic
1006925642 6:37653233-37653255 AAAGGCCAAATGGAATCAGGTGG + Intronic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1011593411 6:88993092-88993114 AAAGGCCTATTGATACCAGAGGG - Intergenic
1012300293 6:97578885-97578907 AAAGGCTTATGGAACTCATTTGG - Intergenic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1014388570 6:120832119-120832141 AAGGGTCTCTTGAGCTCAGGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022844476 7:34196260-34196282 AAAGGCGTATTTCATTCAGGTGG - Intergenic
1022984457 7:35637262-35637284 AAAGAGCTATTGAAGTCAAGTGG + Intronic
1026271498 7:68840992-68841014 ACAGGACTTTGGAACTCAGGTGG - Intergenic
1027689321 7:81322462-81322484 ACAGGCCTTTGGATCTCAGGAGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1034143523 7:148847105-148847127 AAAAACTTATTGAACTTAGGAGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1037635457 8:20697972-20697994 CAAGGCCTATTTATCTCATGGGG - Intergenic
1038121941 8:24627077-24627099 AAAGGCCTATTAAAATGAGTGGG - Intergenic
1038282128 8:26174990-26175012 AAAGGCCTCTTCTCCTCAGGAGG - Intergenic
1038286217 8:26208565-26208587 AAAGGTCACTTGAACCCAGGAGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1040306652 8:46215396-46215418 AAAGGCCGCAGGAACTCAGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1042323455 8:67503384-67503406 GAGGACCTGTTGAACTCAGGAGG - Intronic
1047163539 8:122409605-122409627 AGAGGCCTGGTGAAATCAGGTGG + Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1049448310 8:142641885-142641907 AGAGGCATATTGAACACAGAGGG + Intergenic
1051330703 9:16022436-16022458 ATAGGCCTAGTGAGCGCAGGTGG - Intronic
1051802337 9:20949791-20949813 AAATGCCTCTTGAACTCAGCGGG - Intronic
1053037395 9:34836897-34836919 AAAGGCATAATTATCTCAGGAGG - Intergenic
1056785497 9:89589944-89589966 AAAGGCCTTTTCAACTCAGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060734628 9:126059183-126059205 AAAGGGATGGTGAACTCAGGGGG - Intergenic
1061872993 9:133530521-133530543 AAAGTCCACTTGGACTCAGGCGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062224516 9:135441988-135442010 GAAGGGTTATTGGACTCAGGGGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1186787573 X:12968041-12968063 TAATGCCTAATGATCTCAGGTGG + Intergenic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1195437094 X:104857164-104857186 AAATACCTATTGGACTCTGGAGG + Intronic
1198831230 X:140752837-140752859 AAGGGCCGAATTAACTCAGGAGG - Intergenic
1199515054 X:148666748-148666770 AAAGGCCTATTTATATCAAGTGG + Intronic
1199525150 X:148783891-148783913 ACAGGCCTTTTGAACTAAGGGGG + Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG + Intergenic