ID: 1011574544

View in Genome Browser
Species Human (GRCh38)
Location 6:88781239-88781261
Sequence GCATTTTGCTTGCCTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011574544 Original CRISPR GCATTTTGCTTGCCTAAAAC AGG Intronic
902681452 1:18046732-18046754 GCATTTTCAGTGCCTAGAACAGG + Intergenic
908918855 1:69166167-69166189 GCCATTTCCTTGTCTAAAACAGG - Intergenic
909328240 1:74380066-74380088 TCATATTGCTTGCATAAACCTGG + Intronic
909900769 1:81131870-81131892 GAATTGTGCTTTTCTAAAACTGG + Intergenic
921066767 1:211628764-211628786 GCATTTTGATTTGCTAAATCTGG - Intergenic
921713118 1:218392747-218392769 GCTTTTTACTTCTCTAAAACTGG + Intronic
921900645 1:220446892-220446914 GTATATTGCTTTCCTAAAACAGG - Intergenic
924578507 1:245302442-245302464 CAATTTTGGTTGCATAAAACTGG - Intronic
1063286719 10:4696350-4696372 TCATTTTGCTGGCATCAAACTGG + Intergenic
1065399157 10:25276729-25276751 GCATTTTTCTTGATTAAAAATGG - Intronic
1068230503 10:54165399-54165421 GCATTTTTCTTCCCAAAAAAAGG + Intronic
1069453881 10:68538499-68538521 AAATTTTCCATGCCTAAAACAGG - Intergenic
1071172316 10:82880704-82880726 GCATTTTTATTGACTAAATCTGG - Intronic
1078059594 11:8034507-8034529 GCGATTTCCCTGCCTAAAACAGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1088044385 11:105429913-105429935 TCATTTTTCTTGCCAACAACTGG - Intergenic
1098052598 12:66470330-66470352 GCATTTTGAATGACTAAAATAGG - Intronic
1098507349 12:71268990-71269012 TAATTTTGCTTGCATTAAACAGG + Intronic
1100107299 12:91191525-91191547 GTATTTTGCATGCCTAAAACAGG + Intergenic
1103727794 12:123007353-123007375 CCATTTTGCTTTCATAAACCTGG + Intronic
1105584096 13:21727659-21727681 GCATGTTAATTGCCTAAATCCGG - Intergenic
1106054530 13:26226097-26226119 GAATTTCCCTTGGCTAAAACAGG - Intergenic
1107431099 13:40341143-40341165 ACATTTTGCCTGTCTAAAGCAGG - Intergenic
1110103028 13:71633681-71633703 GCTTTCTGCTTTCATAAAACTGG - Intronic
1110322913 13:74180432-74180454 GCATTTGGCTTTCCTGAAATGGG + Intergenic
1111868918 13:93805825-93805847 GCACTTTGCTTGAATAAAAGGGG - Intronic
1115103032 14:29726081-29726103 GCAATTTGTTTGCAAAAAACTGG + Intronic
1117693271 14:58331545-58331567 CCATTTTGATTGCCAAAAACGGG + Intronic
1118088428 14:62445209-62445231 GCAATATGCTTACCTAAAAAGGG + Intergenic
1118402502 14:65392833-65392855 GCATTTTTATTGGCTAAATCTGG - Intergenic
1125125209 15:36211787-36211809 TCCTTTTGCTTGCCCAAAGCAGG - Intergenic
1129251906 15:74313856-74313878 CCACTTTGCCTGCCTATAACAGG + Intronic
1130219851 15:82010294-82010316 GCATTTGCCTTGCCTATAAGTGG - Intergenic
1130549266 15:84879464-84879486 GCATTCTGCCTGCCTTAAAGTGG - Intergenic
1131348314 15:91672303-91672325 ACATTTTTCTTGCCTTCAACTGG + Intergenic
1132815744 16:1825895-1825917 GCATCTTGCTTCCCTTGAACTGG + Intronic
1133344104 16:5058760-5058782 GCATTTTGATTTGCTAAATCTGG + Intronic
1139139908 16:64248701-64248723 ACATTTGCGTTGCCTAAAACAGG + Intergenic
1139157538 16:64461981-64462003 GCATTTAAATTGCTTAAAACTGG - Intergenic
1140884491 16:79230952-79230974 GGATATCACTTGCCTAAAACTGG + Intergenic
1141178832 16:81738815-81738837 GCATTTTTATTTCCTAAATCTGG + Intergenic
1143746870 17:9001534-9001556 GCATGTTGCTAGCATTAAACAGG - Intergenic
1144400476 17:14893824-14893846 TCATTTTGGTTGTCTAAAGCTGG - Intergenic
1148239472 17:45990656-45990678 GCATTTCTCTTGCCAAAATCAGG - Intronic
1149853803 17:60060556-60060578 GCATTCTGCTTGAATAAACCAGG - Intronic
1150174725 17:63040199-63040221 ACATTTTGCTTTCATAAAAGAGG - Intronic
1150304986 17:64077042-64077064 GCAATTTGTTTGCCAGAAACTGG - Intronic
1155386311 18:25281909-25281931 GAATCCTGCTGGCCTAAAACTGG + Intronic
1160171800 18:76561529-76561551 GCATTTTGCTTGTGTGTAACTGG + Intergenic
1160445916 18:78926590-78926612 GCATCTAGCTTCACTAAAACCGG + Intergenic
1166819371 19:45568108-45568130 GCATTTTGGGAGGCTAAAACTGG - Intronic
932035544 2:68242738-68242760 GCATACTGCATGCCTAAAATAGG + Intronic
934875801 2:97918704-97918726 GCATTTGGTTTGTCCAAAACAGG - Intronic
936987948 2:118329514-118329536 GCATTTTGATTGCAGAAAAGCGG - Intergenic
940590681 2:155721506-155721528 GCATTTTGGGTGGCCAAAACAGG + Intergenic
943854649 2:192773843-192773865 GTCTGTTGCTTGCCTAAAGCAGG - Intergenic
1170878760 20:20275872-20275894 GCATTTTCCTTGGCTGAAAGAGG - Intronic
1174492589 20:50911783-50911805 GTCTTTTGCTTATCTAAAACAGG - Intronic
1174978175 20:55359073-55359095 TCATTTTGTTTGCCAACAACTGG - Intergenic
1177457810 21:21365967-21365989 CCTTTTTTCCTGCCTAAAACGGG - Intronic
1178059514 21:28835820-28835842 GCATTTTGCATTTCTAAAAGTGG - Intergenic
1179418526 21:41217454-41217476 GGAAGTTGCTTGGCTAAAACGGG - Intronic
1183817766 22:40317867-40317889 GCATTTTGTATGTCAAAAACAGG - Intronic
949101124 3:146366-146388 GCATTTTTCATGTGTAAAACTGG + Intergenic
952461414 3:33530226-33530248 GCATTTTGCAAGGCTAAAGCAGG + Intronic
958751128 3:98194023-98194045 GCATTTTACCTGTCCAAAACCGG + Intronic
960447983 3:117771186-117771208 AGATTTTTCTTGCCCAAAACTGG - Intergenic
960819766 3:121716565-121716587 GCATTTTTCTTGCCTCTGACTGG - Intronic
962163363 3:133022794-133022816 GCATTTTGATTAGCTAAATCTGG + Intergenic
962919826 3:139940448-139940470 GCATTTTACATGCCCCAAACTGG - Intronic
966378209 3:179318538-179318560 ACAATTTGCTTTCCTAAAATGGG - Intergenic
966740371 3:183227301-183227323 GCCTATTTGTTGCCTAAAACAGG + Intronic
968580487 4:1389623-1389645 GCACTTTGCTAGGCTAAGACAGG - Intergenic
969096378 4:4735794-4735816 CCCCTTTGCTTGCCTAAACCAGG + Intergenic
973121761 4:46529843-46529865 TCATTTTGCTTGCAAATAACAGG + Intergenic
978002358 4:103572130-103572152 GCAGTTTGCTGGCCTAGACCTGG + Intergenic
978290231 4:107129216-107129238 GCATTTTGATTTCTTAATACAGG - Intronic
978359388 4:107912551-107912573 GGATTTTGCTCTCCTAACACTGG + Exonic
978564349 4:110066030-110066052 ACATTTTAATTGCCTAATACTGG - Intronic
987813368 5:22868599-22868621 GCAGTATGCTTGACTAACACAGG - Intergenic
988989662 5:36658006-36658028 GCACATTGCCTGCCCAAAACAGG - Intronic
992612713 5:78520929-78520951 GCATTTTAGTTGTCTGAAACAGG - Intronic
996406407 5:123109744-123109766 GCATTTTGCTTACTGAAATCAGG - Intronic
996973120 5:129396977-129396999 GCAATGTTGTTGCCTAAAACTGG + Intergenic
998227217 5:140336279-140336301 GCTTTTTCCATGCCTAGAACAGG - Intronic
1000437290 5:161228569-161228591 GCATTTTGCTTGCATGATTCAGG - Intergenic
1002783688 6:385432-385454 GCATTTTTATTTGCTAAAACTGG + Intergenic
1005586366 6:27280084-27280106 GCTTTTTCCTTGTCGAAAACAGG + Intergenic
1006880501 6:37334939-37334961 GCATTTGGCTTGCCTTGGACTGG + Intergenic
1007405468 6:41633561-41633583 GCATTTTGGTAGGCTAAGACAGG + Intergenic
1008293349 6:49746474-49746496 GCATTTTGCTTGTCAAATATTGG + Intergenic
1008644278 6:53497416-53497438 GCAATTTGCTTGTGTAAATCAGG - Exonic
1009636195 6:66267494-66267516 GGATTTTGTTTTCCCAAAACAGG + Intergenic
1011574544 6:88781239-88781261 GCATTTTGCTTGCCTAAAACAGG + Intronic
1013076641 6:106777563-106777585 GGATTTTGCTTGACACAAACTGG - Intergenic
1014232145 6:118915611-118915633 TCATTTTGCTGGTCTAAAGCTGG - Intronic
1014383245 6:120770491-120770513 ACATTTTGCTTTCCAAAACCTGG - Intergenic
1016980673 6:149851185-149851207 GCATTTTTCTTGCCTTCAAGAGG - Intronic
1021577933 7:22121469-22121491 GCATTTTGCGTACCTCATACAGG - Exonic
1021792967 7:24224940-24224962 ACATTGTGCTTGCCAAAACCAGG - Intergenic
1023580963 7:41682045-41682067 GCTTTTTGATTGCCTTAAAGCGG - Intergenic
1029036926 7:97532279-97532301 GGATTTTGCTTGGCAAACACAGG + Intergenic
1030005462 7:105113800-105113822 ACATTTTGCTTGCAAATAACTGG - Exonic
1030796665 7:113797107-113797129 GCATTTTGCTGGTTTTAAACTGG - Intergenic
1031005380 7:116464483-116464505 TCATTTTTCTTGCGTAAAACAGG - Intronic
1038917391 8:32038843-32038865 TCATTTTGCTTGCGTGAAAGAGG + Intronic
1041650720 8:60299609-60299631 GCATTTTGTTTCTCTAAACCAGG + Intergenic
1044363914 8:91320993-91321015 ACATTTTGATTGGCTAAAACTGG - Intronic
1044533607 8:93335786-93335808 GCATGTTGCCTGTCTAAAGCCGG - Intergenic
1044747077 8:95381162-95381184 GCATTATCCATGCCTCAAACAGG - Intergenic
1046614285 8:116459046-116459068 TCAGTTTCTTTGCCTAAAACTGG + Intergenic
1046817530 8:118601028-118601050 GCATTTTGCTTGCCTTTTAGTGG - Intronic
1047539977 8:125755207-125755229 ACATTTCTGTTGCCTAAAACGGG - Intergenic
1053279481 9:36808601-36808623 GCATTTAGTTTGCCAAAAAGAGG - Intergenic
1053527793 9:38847278-38847300 GCACTTTGAATGCTTAAAACTGG + Intergenic
1054200015 9:62071706-62071728 GCACTTTGAATGCTTAAAACTGG + Intergenic
1054638340 9:67516651-67516673 GCACTTTGAATGCTTAAAACTGG - Intergenic
1055025510 9:71715489-71715511 GCATTTTGGGAGGCTAAAACAGG - Intronic
1056088659 9:83182987-83183009 CCATTTTTATTGCCTAAGACCGG + Intergenic
1058099666 9:100905136-100905158 ATATTTTCATTGCCTAAAACAGG + Intergenic
1059501223 9:114755860-114755882 GCCTTCTCCTTGCTTAAAACAGG + Intergenic
1059855222 9:118389105-118389127 GCACTTTGGGAGCCTAAAACTGG + Intergenic
1061571392 9:131479593-131479615 CAATTTTCCTTGCCTAAAATTGG + Intronic
1186146857 X:6633251-6633273 GCCTTTTTCTTTCCTGAAACTGG - Intergenic
1186771639 X:12823975-12823997 GCATTTATCTGGCCAAAAACAGG + Intronic
1186817086 X:13248711-13248733 GCATCTTGCTTGCATTAAAAAGG + Intergenic
1187812549 X:23195552-23195574 GGATTTTTGTTGCCTAAAAGAGG + Intergenic
1188085100 X:25894202-25894224 TCATGCTGCTTGCCTAAGACAGG - Intergenic
1188620667 X:32219058-32219080 GCATTTTGGTAGCATAAAAAAGG + Intronic
1189617201 X:42795962-42795984 GCAATGTGCTTGCATAAATCTGG - Intergenic
1194745015 X:97618627-97618649 GCATATTGCTTTCTTAAAACAGG - Intergenic
1197974086 X:132146823-132146845 GTATCTTGCTTGCCCAAAATAGG - Intergenic
1201628044 Y:16036736-16036758 GCTTTTTTCTTTCCCAAAACTGG - Intergenic