ID: 1011577977

View in Genome Browser
Species Human (GRCh38)
Location 6:88825851-88825873
Sequence CAGAGTGAGGAGAAGGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 610}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011577977_1011577985 20 Left 1011577977 6:88825851-88825873 CCACTATCCTTCTCCTCACTCTG 0: 1
1: 0
2: 5
3: 85
4: 610
Right 1011577985 6:88825894-88825916 AGGCAAGACTGATGGCACAATGG 0: 1
1: 0
2: 0
3: 14
4: 212
1011577977_1011577984 12 Left 1011577977 6:88825851-88825873 CCACTATCCTTCTCCTCACTCTG 0: 1
1: 0
2: 5
3: 85
4: 610
Right 1011577984 6:88825886-88825908 ACAAAGTAAGGCAAGACTGATGG 0: 1
1: 0
2: 0
3: 36
4: 384
1011577977_1011577980 0 Left 1011577977 6:88825851-88825873 CCACTATCCTTCTCCTCACTCTG 0: 1
1: 0
2: 5
3: 85
4: 610
Right 1011577980 6:88825874-88825896 CACCCGTGTCCAACAAAGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011577977 Original CRISPR CAGAGTGAGGAGAAGGATAG TGG (reversed) Intronic
900701224 1:4049741-4049763 GAGAGGGGGGAGAAGGAGAGAGG + Intergenic
900851953 1:5150738-5150760 CAGAGAGAGGATGAGGAGAGTGG - Intergenic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901305315 1:8228519-8228541 GAGGTTGGGGAGAAGGATAGGGG + Intergenic
901453967 1:9352841-9352863 AAGAGTGAGGAGGAGGCTGGGGG - Intronic
901493123 1:9606692-9606714 CAGAGGGAAGAGAGGGACAGAGG - Intronic
902058710 1:13623688-13623710 CAGAGTCAGGGGAAGAAAAGTGG - Intergenic
902704207 1:18193199-18193221 CAGAGGGAAGAGCAGCATAGAGG + Intronic
902843956 1:19094898-19094920 CTGAGTGAGGACAAGGTGAGTGG - Exonic
903051974 1:20608084-20608106 CAGAGTGAAGGGCAGGGTAGAGG + Intronic
903093406 1:20944534-20944556 AAAAGTGGGGAGAAGGAGAGAGG + Intronic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
904119877 1:28190998-28191020 AAAAGAGAGGAGAATGATAGCGG - Intronic
904485886 1:30824386-30824408 GAGAGAGAGGAGAAGGACAGAGG + Intergenic
905003638 1:34693364-34693386 CAGAGTGAAGGGATGGATAAAGG - Intergenic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
905349057 1:37331895-37331917 GAGGGTGAGGAGGAGGAGAGTGG - Intergenic
905435757 1:37954135-37954157 CAAAGTAAGGAGGAGGAAAGGGG - Intergenic
905491386 1:38346727-38346749 GAGAGAGAGGAGAAGGGGAGGGG + Intergenic
905741045 1:40372201-40372223 CAGAGTGAGGAGATGAAGATGGG + Intronic
905850991 1:41274818-41274840 CAGGGTGAGGAGAAAGAGAGGGG - Intergenic
906346555 1:45019198-45019220 AAGACTGAGGCGCAGGATAGTGG + Exonic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907293362 1:53433033-53433055 CCGAGTGAGGGCAAGGATGGGGG - Intergenic
907310755 1:53537736-53537758 CAGAGTGAAGAGGAGGTTTGGGG + Intronic
909185725 1:72482885-72482907 AGCAGTCAGGAGAAGGATAGAGG - Intergenic
909976932 1:82056743-82056765 GAAAGTGAGGAGAAGGACAATGG - Intergenic
909979114 1:82077395-82077417 CAGAGTTAGGATAAGGACAGCGG - Intergenic
910519731 1:88106128-88106150 AAGAGAGAGGAAAAGGATAGTGG - Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911368657 1:96970986-96971008 CAGAGAGAGGAGAATGGGAGAGG - Intergenic
911701981 1:100964088-100964110 CAGAGAGATCAGAAGGCTAGAGG + Intronic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
911832882 1:102576986-102577008 CAAAGTGAGGAGAGGGACTGGGG + Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912623293 1:111187491-111187513 CAGAGTGAGGATATGGATTTTGG + Exonic
912864533 1:113245602-113245624 CAGAATGTGGAGAAAGAGAGAGG - Intergenic
913095900 1:115514959-115514981 CAGAGTGATGGCAAGGACAGGGG + Intergenic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
913585572 1:120272270-120272292 AAGAGTGAGGGGAAGGGAAGTGG - Intergenic
913599626 1:120410610-120410632 CAGCTTGAGGTGAAGGATATAGG - Intergenic
913622612 1:120626097-120626119 AAGAGTGAGGGGAAGGGAAGTGG + Intergenic
914087752 1:144469005-144469027 CAGCTTGAGGTGAAGGATATAGG + Intergenic
914310859 1:146465199-146465221 CAGCTTGAGGTGAAGGATATAGG - Intergenic
914567578 1:148884129-148884151 AAGAGTGAGGGGAAGGGAAGTGG - Intronic
914591245 1:149107947-149107969 CAGCTTGAGGTGAAGGATATAGG + Intergenic
914605244 1:149246116-149246138 AAGAGTGAGGGGAAGGGAAGTGG + Intergenic
914783564 1:150807877-150807899 CTTAGTGAGGAGGAGGAGAGTGG - Intronic
914815214 1:151058122-151058144 GAGGGGGAGGAGAAGGAGAGAGG + Exonic
915412573 1:155714071-155714093 TAGAATGAGCAGAAGTATAGAGG + Intronic
915590104 1:156865806-156865828 CAGAGAGATGGGAAGGATGGTGG + Intronic
916718515 1:167464665-167464687 CAGGGTGAGTAGAAGAAGAGGGG + Intronic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917218137 1:172699130-172699152 CTGAGGGAGGATAAGGACAGGGG + Intergenic
917297736 1:173539409-173539431 TAGAGCTTGGAGAAGGATAGAGG + Intronic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919823038 1:201484793-201484815 CAGAGAGAGGAGAGAGATAAGGG + Intronic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920217926 1:204374686-204374708 CAGACAGAGGAGGAGGATAAAGG - Intronic
920866790 1:209759947-209759969 AAGAGGGAGGAGAAGGGGAGGGG - Intronic
922146006 1:222945161-222945183 AAGAGTGAGGAGGGGGAAAGAGG + Intronic
922390804 1:225138799-225138821 GAGAGTGAGGAGAAGCAGTGGGG - Intronic
922593229 1:226794615-226794637 GAGAGAGAGGAGAAGGGTAGGGG + Intergenic
922598738 1:226833990-226834012 CGGAGTGAGGGTGAGGATAGGGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
924851848 1:247838902-247838924 AAGAGTGAGGAGAACAAGAGTGG - Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1063121323 10:3106941-3106963 CAGGGTGAGGAGAGGGGCAGGGG - Intronic
1063135164 10:3209841-3209863 CAGAGAGAGGAGACAGAGAGAGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1064333999 10:14422136-14422158 CAGAGGGAGGAGCAGGCTTGCGG - Intronic
1064722710 10:18246160-18246182 CAGAGCCAGGGGAAGGGTAGTGG - Intronic
1064859957 10:19816208-19816230 CAAAGTGTGGAGAAGGAGCGCGG + Intergenic
1065065724 10:21961875-21961897 CTGAGTGTGGAGAAAGTTAGAGG - Intronic
1065480908 10:26193037-26193059 CATGGTGAGGAGTAGGATAAGGG + Intronic
1065991171 10:31011920-31011942 GTGAGTGAGGAGGAGGACAGTGG - Intronic
1066365042 10:34768733-34768755 CAGAGTGCAGAGAAGAAAAGTGG - Intronic
1067922379 10:50472915-50472937 CAGTGTGGGGAGCAGGATAGAGG - Intronic
1068814223 10:61291638-61291660 CAGTTTGGGGAAAAGGATAGGGG - Intergenic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070461786 10:76677690-76677712 GAGAATGAGGAGAAGGCTAAGGG - Intergenic
1070490321 10:76969899-76969921 CAGGGTGAGGAGAGGGCGAGGGG + Intronic
1070747925 10:78946043-78946065 CAGTGAGAGAAGCAGGATAGGGG - Intergenic
1070959721 10:80490158-80490180 CAGAGTGAGGGGATGGATGGTGG + Intronic
1071294178 10:84207250-84207272 GAGAGTGAGGAGGAGGAGAGGGG + Intronic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1072652645 10:97307653-97307675 GAGAGTGGGAAGAAGGAGAGTGG + Intergenic
1073679643 10:105688799-105688821 CAGAGTGGGGAGGAAGAGAGGGG - Intergenic
1074234392 10:111570356-111570378 CAGAGTGAGGCAGAAGATAGTGG + Intergenic
1074234947 10:111575872-111575894 AATTGTGAGGAGAAGGAAAGTGG + Intergenic
1074616792 10:115077674-115077696 CAGAAAGAGAAGAATGATAGAGG - Intergenic
1074841632 10:117358563-117358585 CAGAGGGAAGAGAAAGATAAGGG - Intronic
1075001560 10:118802491-118802513 AAGAGTGGGGAGGAGGACAGAGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075579573 10:123606872-123606894 AAGAGAGAGGAGAAGAAGAGGGG - Intergenic
1075628963 10:123988200-123988222 CAGAGGGTGGAGAAGCTTAGGGG - Intergenic
1076715600 10:132362340-132362362 CAACGTGAGGGGAAGGGTAGGGG + Intronic
1077485910 11:2838366-2838388 CAGAGTGAGGCCAGGGATGGGGG + Intronic
1078472970 11:11606509-11606531 CAGAGTGATGATTCGGATAGAGG - Intronic
1078774869 11:14384622-14384644 CAGAGTGAGGACTAGAATACAGG + Intergenic
1078788997 11:14524740-14524762 CAGAGTGAGGGTGAGGACAGCGG - Intronic
1078954640 11:16177823-16177845 CAGAGTGAGGTGCAGCAGAGTGG - Intronic
1079230424 11:18644661-18644683 CAGCCTGGGGAGAAGGAGAGAGG - Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079333794 11:19553806-19553828 CAGACTGAGGAGAGGTACAGAGG + Intronic
1080369645 11:31620105-31620127 GAGAGTGAGGATATGTATAGTGG + Intronic
1080447454 11:32350814-32350836 CAGAGTGATGAAAAGAATAAGGG + Intergenic
1080574714 11:33587761-33587783 CAGAGGGAGGAGAGAGAAAGTGG + Intronic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1082632633 11:55559847-55559869 CGGAGTGAGGTCAAGGACAGGGG - Intergenic
1082988067 11:59184971-59184993 CAGAGAGAGGAGGGGGAAAGGGG - Intronic
1083079822 11:60079648-60079670 CAGGGTGAGGAGGAGCAGAGGGG - Intergenic
1083147778 11:60771754-60771776 CAAAGGTAGGAGAAGGAAAGTGG + Intronic
1083793285 11:64999735-64999757 CAGAGTGTGGAGCAGGACTGAGG - Intergenic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084604096 11:70162446-70162468 CAAAGTGGGGACAAGGAGAGAGG + Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1085532228 11:77198649-77198671 CAGACAGAGGGGAAGGAGAGGGG + Intronic
1086237872 11:84653824-84653846 CATAGTGAGGAAGAGGACAGAGG + Intronic
1087168140 11:95024529-95024551 CAGAGTGAGGGTGAGGACAGGGG + Intergenic
1087241803 11:95789472-95789494 GAGACTGAGGAGCAGGATGGCGG - Exonic
1087431562 11:98062795-98062817 AGGAGAGAGGAGAAGGAAAGGGG + Intergenic
1087524251 11:99287991-99288013 CAAAGTGAAGAGGAGGATAAGGG - Intronic
1089457404 11:118633664-118633686 AGGAGTGAGGAGAAGAGTAGGGG - Intronic
1089539549 11:119181713-119181735 AAGAGCAGGGAGAAGGATAGGGG + Intronic
1089942576 11:122434990-122435012 GAGAGAGAGGAGAGGGAGAGAGG - Intergenic
1091074391 11:132601504-132601526 CAAGGTGAGGAGAAGGATGGAGG - Intronic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1093808298 12:23463536-23463558 AAGATTCAGGAGAAGGAGAGTGG - Intergenic
1095213649 12:39523685-39523707 CAGAGTCAGGATTAGGATTGTGG - Intergenic
1095739307 12:45589802-45589824 CAGAAAGAGGAGTAGGATAGAGG + Intergenic
1095902056 12:47338428-47338450 CAGAGAGATGACAAGGATACTGG - Intergenic
1096478781 12:51924339-51924361 GAGAGTGGGGAGAAGGGCAGTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1097645134 12:62227097-62227119 TAAAGTGAGGATAAGGAAAGGGG - Intronic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1098066876 12:66627927-66627949 GAGTGTGAGGAGGAGGCTAGGGG + Intronic
1098508497 12:71283201-71283223 CGAAGTGAAGATAAGGATAGTGG + Intronic
1098919667 12:76292175-76292197 CAGAGTGAGGGCAAGGACAGCGG - Intergenic
1099713568 12:86262112-86262134 CAGTGAGATGAGAAGGCTAGTGG - Intronic
1100569854 12:95837399-95837421 GAGAGGGAGGAGAGGGAGAGAGG + Intergenic
1100848438 12:98684374-98684396 GAGAGAGAGGAGAGGGAAAGGGG - Intronic
1102648389 12:114418652-114418674 CAGAGTGATAAGATGGAGAGAGG - Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103941946 12:124506030-124506052 CAGAATGTGGGGAATGATAGAGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104301443 12:127568676-127568698 GAGAGAGAGGAGAAAGAGAGAGG + Intergenic
1104301449 12:127568711-127568733 GAGAGAGAGGAGAGGGAGAGAGG + Intergenic
1104301460 12:127568784-127568806 GAGAGAGAGGAGAGGGAGAGAGG + Intergenic
1104405042 12:128510131-128510153 TAAGGTGAGGAGAAGGATCGGGG + Intronic
1104566783 12:129892508-129892530 GAGAGGGAGGAGAAGGGAAGAGG - Intronic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1105592914 13:21811121-21811143 CAGAGTGGAGAGAAAGAAAGGGG + Intergenic
1105953515 13:25256140-25256162 CAGAGTGAGTATTAGAATAGGGG - Intronic
1106832437 13:33599524-33599546 CTTAATGAGGAGGAGGATAGAGG - Intergenic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107645654 13:42492009-42492031 CATAGGGAGGAGAAGGACGGAGG + Intergenic
1107880576 13:44828882-44828904 ACAAGTGAGGAGAAGGAAAGGGG + Intergenic
1108282277 13:48871958-48871980 CAGAGTGAGGGTGAGGACAGGGG + Intergenic
1109240157 13:59876843-59876865 CAGGGTGAGGGGCAAGATAGGGG - Intronic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110510976 13:76350065-76350087 GAGAGGGAGGATAAGGATAAAGG + Intergenic
1110512871 13:76373634-76373656 GAAAGTGAGCAGAAGCATAGAGG + Intergenic
1110958860 13:81594650-81594672 CAGATTGAGAAGAAGTATACTGG + Intergenic
1112492873 13:99883048-99883070 CAGAGTGAAGAAAAGGAAACAGG + Intronic
1112805270 13:103157998-103158020 CAGAGAGAGGAGAAAATTAGTGG + Intergenic
1112870706 13:103967668-103967690 CATAGGGAGGGCAAGGATAGAGG + Intergenic
1112930679 13:104732520-104732542 CAGAAGGAGGAGAAGAAAAGGGG - Intergenic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1114255758 14:21000195-21000217 GAGAGTGAGGAGAACCAGAGAGG + Intronic
1114456005 14:22853856-22853878 CAGGGTGAGGACGAGGACAGGGG - Intergenic
1114466889 14:22929355-22929377 CAGCGCGAGGAGAAAGATGGCGG - Exonic
1114490434 14:23097686-23097708 AAGAGAGATGGGAAGGATAGTGG - Exonic
1114771262 14:25430471-25430493 CAGAGTGAGGGCAAGGACAGGGG + Intergenic
1114873865 14:26691082-26691104 GAGAGGGAGGAGAAGGACACAGG - Intergenic
1115135001 14:30097253-30097275 GATAGAGAGTAGAAGGATAGTGG + Intronic
1115140645 14:30167558-30167580 CTGAGTGAGGAAAAGGTTATAGG - Intronic
1115726535 14:36223303-36223325 CAGAGGAAGGATAAGGAAAGAGG + Intergenic
1115752428 14:36505895-36505917 CAGTGTGGAGAGAAGGAGAGGGG - Intronic
1115982191 14:39065643-39065665 CAGTGTGAGGAGAGGCATAGAGG - Intronic
1116344016 14:43766298-43766320 GGGACTGAGGAGGAGGATAGGGG - Intergenic
1116731518 14:48628411-48628433 GAGAGAGAGGAGAGGGAGAGGGG - Intergenic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117173931 14:53129222-53129244 CGGAGTGAGGGCAAGGACAGGGG - Intronic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118350298 14:64968874-64968896 CAGAAAGACGAAAAGGATAGGGG + Intronic
1119451240 14:74712847-74712869 GAGAGGGAGGAAAAGGGTAGGGG - Intronic
1119560576 14:75586001-75586023 CAGAGTGAGGGTGAGGACAGGGG + Intronic
1119641255 14:76316692-76316714 CAGAGAGGAGAGAAGGATAGGGG - Intronic
1119678394 14:76573460-76573482 CAGAGGGAGAAAAAGGAAAGGGG + Intergenic
1119771336 14:77221993-77222015 CAGGGTGAGGGGAAGGATATGGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120407776 14:84110289-84110311 TAGAGAGAGGAGAATGATTGAGG + Intergenic
1121193541 14:92049676-92049698 CGGAGTGAGGGCAAGGACAGGGG + Exonic
1121469981 14:94145038-94145060 GCGAGGGAGGACAAGGATAGGGG + Intergenic
1121505628 14:94474584-94474606 CAGGGTGGGGAGAAGCAAAGTGG - Intronic
1121524942 14:94613234-94613256 TAGAGAGAGGAGAAGAAAAGGGG - Intronic
1121597898 14:95179844-95179866 GAGAGTGGCGAGAAGGACAGGGG + Intergenic
1121745364 14:96285718-96285740 CAGTGTGAAGATAAGGAGAGTGG - Exonic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122507401 14:102240370-102240392 CGGAGTGAGGGCAAGGACAGGGG - Intronic
1122846389 14:104502031-104502053 CAGAGCGAGGAGAGAAATAGGGG - Intronic
1123111405 14:105868727-105868749 GAGAGTGAGGAGAAGGTCTGAGG + Intergenic
1124587637 15:31024390-31024412 CAGAAAGAGGAGAAGGCTTGAGG - Intronic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1126939360 15:53749470-53749492 AAGACTGAGGAGAGGGAGAGAGG - Intronic
1127300595 15:57649823-57649845 CAGAGTAAGAAAGAGGATAGAGG - Intronic
1127889990 15:63241763-63241785 CAAAGAGAGGTAAAGGATAGAGG + Intronic
1129243430 15:74265387-74265409 GAAAAGGAGGAGAAGGATAGAGG - Intronic
1130248849 15:82281910-82281932 TAAAGTGAGGAGATGGGTAGAGG + Intronic
1130273326 15:82463673-82463695 CAGAGTGGGGAGAAATATGGTGG - Intergenic
1130451209 15:84054242-84054264 TAAAGTGAGGAGATGGGTAGAGG - Intergenic
1130465678 15:84191044-84191066 CAGAGTGGGGAGAAATATGGTGG - Intergenic
1130487014 15:84403776-84403798 CAGAGTGGGGAGAAATATGGTGG + Intergenic
1130498587 15:84482492-84482514 CAGAGTGGGGAGAAATATGGTGG + Intergenic
1130587967 15:85195639-85195661 CAGAGTGGGGAGAAATATGGTGG - Intergenic
1131475402 15:92734269-92734291 TAAAGTGAGGTGAAGGAGAGCGG - Intronic
1131832188 15:96361124-96361146 CGGAGCTAGGAGAAGGATGGGGG - Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133159492 16:3900959-3900981 GAGGGTGAGGATAAGGGTAGGGG + Intergenic
1133598275 16:7313850-7313872 CACAGTGAGGAGGAGGACATAGG - Intronic
1133796646 16:9051844-9051866 AATAGTGAGGAGAAGGAATGTGG - Intergenic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1134151674 16:11810289-11810311 CAGAGTAGGGAGCAGGTTAGAGG + Intergenic
1134173104 16:11984606-11984628 GAGAGGGAGGAGAGGGAGAGAGG - Intronic
1134323967 16:13189939-13189961 CAGAGGGAGGAGAAGAGAAGGGG + Intronic
1134449525 16:14354513-14354535 GAGAGGGAGGAGGAGGAGAGAGG + Intergenic
1134771358 16:16812249-16812271 GAGGGAGAGGAGGAGGATAGAGG + Intergenic
1135038489 16:19098416-19098438 CACAGTGAGCAGAGGGGTAGTGG + Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1135870594 16:26146366-26146388 CTGAGTGAAGAGGAGGATACAGG - Intergenic
1135907719 16:26528596-26528618 TGAAGTGAGGAGAAGGACAGGGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136529719 16:30859925-30859947 CGGAGTGAGGGCAAGGACAGGGG - Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1138812110 16:60163488-60163510 AAGAGAGAGGAGAAAGAGAGAGG + Intergenic
1139402481 16:66694041-66694063 AAGAGTGAGAAGAAAGAGAGAGG + Intronic
1139492064 16:67291521-67291543 CAGTGTGAGGAGGGGGAGAGGGG + Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140123521 16:72102765-72102787 CAGAGTGAGCAGAAGAGGAGTGG - Intronic
1141493911 16:84393689-84393711 CAAAGAGGGGAGGAGGATAGAGG + Intronic
1142158836 16:88546924-88546946 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158843 16:88546948-88546970 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158859 16:88546996-88547018 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158875 16:88547044-88547066 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158882 16:88547068-88547090 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142437087 16:90067251-90067273 CAGAGTTAGGCCAAGCATAGTGG - Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1143403494 17:6660685-6660707 CAGAGGGAGATGAAGGAGAGGGG + Intergenic
1143520972 17:7444207-7444229 CAGAGTCTGGAGAAGGGCAGAGG + Exonic
1143665903 17:8359935-8359957 TAGAGTGGGGAGGAGGAAAGAGG + Intergenic
1144499007 17:15769455-15769477 AAGACTGAGGCGCAGGATAGTGG + Intergenic
1145080895 17:19893422-19893444 CGGAGTGAGGGCAAGGACAGGGG + Intergenic
1145162387 17:20584490-20584512 AAGACTGAGGCGCAGGATAGTGG + Intergenic
1146061233 17:29608416-29608438 CAGAGTGAAGAGAATAATAATGG - Intronic
1146175478 17:30663654-30663676 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146293622 17:31631025-31631047 CGGAGTGAGGGCAAGGACAGGGG + Intergenic
1146348929 17:32079700-32079722 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146398059 17:32484405-32484427 CAGAGTGGGAAGCAGGGTAGTGG + Intergenic
1146411274 17:32587736-32587758 CAGAGGGAGGGGAAGACTAGGGG - Intronic
1147323933 17:39661466-39661488 CAGGGTGAGGAGGACGAAAGGGG - Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147562657 17:41518645-41518667 CAGGGTCAGGAGGAGGATATGGG - Exonic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148775287 17:50091802-50091824 GAAAGTGAGGAGAGGGAAAGGGG - Intergenic
1148984974 17:51613347-51613369 GAGAGTGGGGAGAGGGAGAGGGG - Intergenic
1149386862 17:56151002-56151024 CAGAGTGAGAGGCAGGATGGAGG + Intronic
1149839451 17:59946196-59946218 GTGAGTGAGGAGAAGGGCAGAGG + Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1151580210 17:74973091-74973113 CAGACTGAGAAGGAGGAAAGTGG - Intronic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152042122 17:77910141-77910163 CAGCGTGAGGACAGGGAGAGGGG - Intergenic
1152336676 17:79702975-79702997 CAGAGGGAGGAGGAAGATAGAGG - Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153552745 18:6279309-6279331 AAGAGTGAGGAGAAGAGGAGGGG + Intronic
1154999756 18:21674835-21674857 CAGAGGGAGGAGGGGTATAGAGG - Intronic
1155045209 18:22097260-22097282 CAGAGTAGGGAGGAGGATACTGG + Intronic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155325715 18:24662968-24662990 GAGAATGGGGAGAAGGAAAGAGG - Intergenic
1155839080 18:30625557-30625579 CAGAGAGAGGAGCTGGAGAGGGG + Intergenic
1156109031 18:33700954-33700976 CAGAGAGAAGAGCACGATAGGGG + Intronic
1156109257 18:33703670-33703692 AAAAGTGAGGAGAGGGATGGGGG - Intronic
1156273117 18:35555564-35555586 CAAAATGTGGAGAAGGATGGAGG + Intergenic
1157215914 18:45783315-45783337 CTGAGTGAGGAGTAGGAGTGGGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157475269 18:48020027-48020049 CAGAGTGGGGTGAAGGGAAGTGG + Intergenic
1157477263 18:48031348-48031370 GGGAGTGAGGAGAAGGGAAGTGG + Intronic
1157507301 18:48237318-48237340 CATTGTGAGGAGAAGAATGGAGG + Intronic
1158050857 18:53217512-53217534 CAGAGAGAGAAAAAGGAGAGAGG - Intronic
1158227106 18:55212901-55212923 CTGAGTGAAGAGAAGGCCAGAGG - Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1159050133 18:63414092-63414114 CAGAGTGAGGCCAAGCACAGTGG + Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1160988426 19:1850872-1850894 CAGGGTGAGGAGGGGGAGAGAGG + Intergenic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161257916 19:3320147-3320169 CAGAGTGAGGAGGGAGAGAGAGG + Intergenic
1161262334 19:3344956-3344978 CGGAGGGAGGAGAGGGAGAGAGG + Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161442604 19:4300812-4300834 CAGAGTGAGGACAGGGAGAGAGG + Intronic
1161625403 19:5323645-5323667 CAGAGTGAGGACGGGGAGAGAGG + Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1161634220 19:5377179-5377201 CAGAGTGAGGAAGGGGAGAGAGG + Intergenic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162185065 19:8898360-8898382 CAGAGTGATGACCAGGGTAGGGG + Intronic
1162844710 19:13383279-13383301 CTGAGTGTGGAGCAGGAGAGAGG + Intronic
1162983488 19:14254257-14254279 CAGACTGTGGATAAGGATGGAGG + Intergenic
1163049765 19:14673870-14673892 CTGAGGGAGTAGAAGGACAGTGG - Intronic
1163326302 19:16605575-16605597 CAGAGAGAGCAGCAGGAAAGGGG + Intronic
1164786568 19:30935784-30935806 CAGTGTGAGGAGAAAGACTGTGG - Intergenic
1164861246 19:31563913-31563935 AAGAGTGAGGAGCTGGACAGAGG + Intergenic
1165362872 19:35347390-35347412 CAGAGTGGGGATGAGGAGAGGGG + Intergenic
1165412397 19:35670211-35670233 CTGAGTGAGGAGGAGGTTGGGGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166171689 19:41032158-41032180 CAGAGTGATGACAAGGATAAAGG + Intergenic
1166177330 19:41083683-41083705 CAGAGTGATGACAAGGATTAGGG - Intergenic
1167222178 19:48206978-48207000 AACAGAGAGGAGAAGGTTAGGGG - Intronic
1167697526 19:51024104-51024126 CAGCGTGAGGAGAGGGTGAGGGG + Exonic
1167980599 19:53272099-53272121 CAAAGTGAGAAGAAGTATAAAGG - Intergenic
1168095977 19:54115070-54115092 CTGAGGGAGGAGAAGGTTAGGGG - Intronic
925500540 2:4499420-4499442 GAGGGTGGGGAGAAGGAGAGAGG + Intergenic
926266873 2:11330971-11330993 GAGGGGGAGGAGAAGGAAAGAGG + Intronic
926280892 2:11444946-11444968 CAGAGGGAGGAAAAGCATTGAGG + Exonic
926343198 2:11921863-11921885 CAGAGTCAGGAGAAACATAGAGG - Intergenic
927372330 2:22370871-22370893 CAGAGTGAGGAGGTAGAGAGTGG + Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
930592622 2:53347145-53347167 CAGAGGCTGGAGAAGGGTAGAGG - Intergenic
930955668 2:57199420-57199442 GAGAGTGAGAAGAAGGTGAGGGG + Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932145074 2:69309014-69309036 CAGAGGGAGGAAAAGGCAAGTGG + Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
933775851 2:85770785-85770807 AAGAGAGAGGAGGAGGAAAGGGG - Intronic
934919507 2:98331580-98331602 CTGAGAGGGGAGAAGCATAGTGG - Exonic
935210227 2:100933301-100933323 TAGAGAGAGGAGAAGGACAGAGG + Intronic
935661373 2:105469544-105469566 CAGAAGGAGGAGAAGGTTAGAGG - Intergenic
936870564 2:117131044-117131066 CAGAGTGAGGGCGAGGACAGGGG - Intergenic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937648401 2:124292601-124292623 TAGATTGAAGAGAAGCATAGAGG + Intronic
938100130 2:128492891-128492913 GTGAGTGAGGAGGAGGAGAGAGG - Intergenic
938429926 2:131225023-131225045 AAGAGTAAGGAGTAGGAGAGAGG - Intronic
938995930 2:136677573-136677595 AAGAGGGAGGACTAGGATAGAGG + Intergenic
939364883 2:141218936-141218958 CAGAGTGAGGAAAAGCAGGGTGG + Intronic
940268854 2:151869701-151869723 CAGAGGGATGAGCAGGAGAGTGG - Intronic
941169161 2:162116733-162116755 GAGAGAGAGGAGAAAGATAGAGG + Intergenic
941265829 2:163360668-163360690 CATAGAGAGGAGGAGGACAGAGG - Intergenic
942419037 2:175788794-175788816 CAGGGTGTGGAGAAGGCCAGAGG + Intergenic
942619146 2:177829177-177829199 CAGAGAGAGGAGCAGGCTTGGGG + Intronic
943598525 2:189886740-189886762 CATAGGGAAGAAAAGGATAGAGG + Intronic
944093342 2:195939169-195939191 TGGGGTGAGGAGAAGGAAAGGGG - Intronic
944196425 2:197059128-197059150 CAGAGAGAGTAGAGGGGTAGGGG + Intronic
944425702 2:199580497-199580519 GAGAGCAAGGAGAAGGCTAGTGG - Intergenic
945554471 2:211262229-211262251 CAGAATGAGGGCAAGGACAGGGG - Intergenic
945764617 2:213959652-213959674 GAGGGTGAGGAGCAGGAGAGAGG - Intronic
945853163 2:215034407-215034429 CAGAGTGTGGAGAGGAATGGGGG + Intronic
945857896 2:215090354-215090376 CAGAGTGAGGACAAGGACAGGGG - Intronic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946549910 2:220789949-220789971 CAGAGTGAAGAGAAGAATTTTGG - Intergenic
947158940 2:227192677-227192699 AAGGGTGGGGAGAAGGTTAGGGG + Intronic
947249662 2:228087839-228087861 GAGAGAGAGGAGAAAGAGAGAGG + Intronic
947792907 2:232877977-232877999 CAGAGTGGGGAAAGGGAAAGAGG - Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948309721 2:236975953-236975975 GAGAGTGAGGAGAGGGAAAGCGG - Intergenic
948963715 2:241359645-241359667 CAGAGAGAGCAGAAAGAAAGAGG - Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170545688 20:17434040-17434062 GAGAGAGAGGAGAGGGAGAGAGG - Intronic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1171142443 20:22754965-22754987 CAGAGTGTGGAGCAGGATTCTGG - Intergenic
1172221272 20:33276686-33276708 CAGAGAGAGGAGAGAGACAGTGG + Intronic
1172429539 20:34877865-34877887 CAGACTGAGGGCAAGGGTAGGGG - Intronic
1172447920 20:35002790-35002812 CAGAGTGGGGAGGAAGATATGGG - Exonic
1172713028 20:36941925-36941947 CAAACTGATGAGGAGGATAGGGG - Intronic
1172773157 20:37393100-37393122 GAAAGTGAGGAGAAGGAGTGGGG - Intronic
1173185422 20:40836590-40836612 CAGAGTGTAGAGGAGGATAAAGG - Intergenic
1173219354 20:41118883-41118905 CGGAGTTAGGAGGAGGAAAGAGG - Intronic
1174572074 20:51509022-51509044 CAGGGGAAGGGGAAGGATAGGGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1175423851 20:58852377-58852399 CAGAGAGAGGCGAGGGAGAGGGG - Intronic
1175487439 20:59355875-59355897 AAGAGAGGGGAGAAGGAGAGAGG - Intergenic
1175921412 20:62452055-62452077 GAGAGTGGGGAGAGGGAGAGGGG + Intergenic
1176251299 20:64121653-64121675 CTAGGTGAGGAGAAGGATAGAGG + Intergenic
1177388016 21:20432871-20432893 CAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1178728939 21:35081182-35081204 CAGAGTTAGGATAATGAGAGGGG + Intronic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1179154745 21:38840184-38840206 CACAGGGTGGAGAAGGACAGAGG - Intergenic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1180971644 22:19819136-19819158 CTGAGTGTGGTGAAGGACAGTGG - Intronic
1181398242 22:22636032-22636054 CAGAGTGGGGAAGAGGAGAGTGG - Intergenic
1181651172 22:24260028-24260050 CAGAGTGGGGAAGAGGAGAGTGG + Intergenic
1181675670 22:24450061-24450083 CACAGTGAGGAGCAGGGTAGTGG - Intergenic
1181706209 22:24650711-24650733 CAGAGTGGGGAAGAGGAGAGTGG - Intergenic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1182142431 22:27972693-27972715 CAGAGAGAGGAGAAGCGAAGAGG - Intergenic
1184433925 22:44458613-44458635 GAGAGTGAGGTCAAGGCTAGAGG - Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
950168102 3:10816529-10816551 GATAGTGAGGAGAAGGGGAGGGG + Intronic
950394016 3:12719684-12719706 GAGACAGAGGAGAAGGAGAGAGG + Intergenic
950511886 3:13434352-13434374 CAAAGTGTGGATAAGGTTAGGGG - Intergenic
950995876 3:17495055-17495077 GAGAGTGAGGAAAAGCATAGTGG - Intronic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
952410915 3:33048972-33048994 CAGAGGGAGGGGCAGGAGAGAGG + Intronic
952472092 3:33666003-33666025 CTGACTTAGGATAAGGATAGAGG + Intronic
952791736 3:37205889-37205911 CAGAGTGAGGGTGAGGATGGGGG - Intergenic
952920132 3:38278234-38278256 CAGGGTGAGGGAAAGGGTAGAGG + Exonic
953072023 3:39530273-39530295 CAGCTTGAGGAGAAGAAAAGGGG + Intergenic
953336405 3:42098087-42098109 CAGGGTGAGGAGGAGGGGAGGGG - Intronic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
954485838 3:50850698-50850720 CATCCTGAGGAGAAGGAGAGAGG - Intronic
954573545 3:51662365-51662387 CAGGGAGAGAAGAAGGGTAGAGG - Intronic
954652258 3:52172260-52172282 CAGAGTGAGGAGAGGTCTAATGG + Intergenic
955195320 3:56800740-56800762 CAGAGTGAGGTGTGGGAGAGTGG + Intronic
955584460 3:60461772-60461794 CAGAGGCAGGATAAGGATGGGGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955856308 3:63277688-63277710 CAGAGAGAGGACCAGGACAGAGG - Intronic
956001737 3:64736995-64737017 CAAAGTGAGGAGTAAGATAAGGG - Intergenic
956639461 3:71401961-71401983 CCTGGTGAGGAGTAGGATAGGGG - Intronic
956776321 3:72568352-72568374 CAGCGTGAGGAGCAGGTGAGGGG + Intergenic
957167869 3:76698357-76698379 CAGAGTGAGGATAGTGACAGTGG + Intronic
957537318 3:81523645-81523667 CAGAGGCTGGAGAAGGGTAGTGG - Intronic
958421716 3:93938490-93938512 CGGAGTGAGGACGAGGACAGGGG - Intronic
959471705 3:106760399-106760421 GAGAGTGATGAGAGGGATAACGG + Intergenic
959543947 3:107571641-107571663 CAGAGTGAGGGCGAGGACAGGGG + Intronic
959693536 3:109224726-109224748 CAGAGAGGGGAGCCGGATAGGGG + Intergenic
960181474 3:114585334-114585356 CTGAGTGAGGAGGAGGTTAAGGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
963306516 3:143659664-143659686 CAGGGTGATGACAGGGATAGGGG - Intronic
964282383 3:155080231-155080253 AAGAGTGAGGGGAGGGAGAGGGG + Intronic
964849334 3:161078202-161078224 CAGAGTGAGGAGAGAAAAAGGGG + Exonic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
967683384 3:192391909-192391931 CAGATTGAGGAGTGGGAGAGAGG + Intronic
967954707 3:194869280-194869302 CTGAGGGAGGGGAAGGAAAGGGG + Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
969353923 4:6614179-6614201 CAGAGTGAGGAGAGGGTTTGGGG - Intronic
970520205 4:16875877-16875899 GAGTGGAAGGAGAAGGATAGAGG - Intronic
970675551 4:18445079-18445101 AGGAGAGAGGAGAAGGATAAAGG + Intergenic
972347890 4:38208895-38208917 CAGAGAGATGAGAAGGATTTGGG - Intergenic
972577404 4:40364502-40364524 CAGAGTGAGGACAAAGAATGAGG - Intergenic
972965861 4:44508763-44508785 CACAGTGAGGAGAAGGAAAAAGG + Intergenic
973129316 4:46630590-46630612 GAGAGTGAAGAGTAGGAGAGTGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
976052191 4:81022360-81022382 CAGACAGGGGAGAAGGAAAGAGG + Intergenic
976132915 4:81904061-81904083 GAGAGGGAGGAGAAGGATACAGG - Intronic
976195563 4:82528553-82528575 GAGAGAGAGGAGAATGAGAGAGG - Intronic
976527944 4:86115328-86115350 CAGAGTGAGGAAAAGCAGGGTGG - Intronic
976615249 4:87069550-87069572 GAGAGAGAGGAGAGGGAAAGGGG - Intronic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
977524456 4:98126541-98126563 GAGAGTGAGGAAAAGCAGAGTGG - Intronic
978102331 4:104857534-104857556 GAGAGGGAGGAGAGGGACAGGGG + Intergenic
978195754 4:105970023-105970045 CAGAGTGAGAGGAAGCATAGGGG + Intronic
978303461 4:107295404-107295426 CAGAGTGAGGACAAGGACAGAGG + Intergenic
978472538 4:109085693-109085715 CAAAGGGAGGAGAAGGAAATAGG - Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979538597 4:121853424-121853446 CAGAGGGAGGAGCAGTATTGAGG - Intronic
979561326 4:122105194-122105216 CCTAGTGAGGAGAAGGATGGAGG + Intergenic
979798552 4:124877155-124877177 CAGACTGAGGGCAAGGACAGGGG + Intergenic
980158886 4:129136691-129136713 AAGACTGAGGCGCAGGATAGTGG + Intergenic
981143621 4:141300182-141300204 CTGAGTTAGGAAAAGGAAAGAGG + Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
983064569 4:163193849-163193871 CAGAGTGGAGAGGAAGATAGTGG + Intergenic
983830332 4:172318755-172318777 CTGAATGAGGACAAGGATAAGGG + Intronic
984220408 4:176967621-176967643 CAGAGTGGGGAAAAGTATATTGG + Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984802821 4:183730333-183730355 AAGACTGAAGAGAAGGGTAGTGG - Intergenic
985236415 4:187880284-187880306 GAGAGAGAGGAGAAGGGTTGGGG + Intergenic
985636312 5:1037561-1037583 CACAGTGGGGACAAGGCTAGAGG + Intronic
986063054 5:4209698-4209720 CAGAGTTAGGAGAGGCATTGTGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986919327 5:12664302-12664324 CAGGGTGAGGAACAGGAAAGAGG + Intergenic
987098793 5:14574368-14574390 CACGGTGAGGAGGAGGAAAGTGG + Intergenic
987637420 5:20563213-20563235 CAGAGTGAGAAAAAGTATATTGG + Intronic
988331809 5:29850953-29850975 AAGAAGGAGGAGAAGGAAAGAGG + Intergenic
988718188 5:33848382-33848404 CATAGTGAGGTGAAAGATGGAGG + Intronic
988839181 5:35066579-35066601 AAGAGGGAGGAGAAGGGAAGGGG - Intronic
989162287 5:38403121-38403143 AAGAGTGAGGGAAAGGACAGAGG + Intronic
990812190 5:59740380-59740402 AAGAGTGTGGAAAAGGATAATGG + Intronic
992167628 5:74070652-74070674 TAAAGTGAGGACAAGAATAGAGG + Intergenic
992874880 5:81044024-81044046 GAGAATGAGGAGAGGGATTGGGG + Intronic
994646743 5:102479500-102479522 AAGAGTGAGCGGAAAGATAGGGG - Intronic
995484442 5:112625888-112625910 GAGAGTGAAGAGATGAATAGAGG - Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
995904108 5:117102762-117102784 CAGAGTGATGAGTAAGAAAGGGG + Intergenic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996486959 5:124047088-124047110 TAGAGTGAAGAGAAAGAGAGAGG + Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
998046655 5:138992416-138992438 CAGAGTGAGGGGTAGGATTTTGG - Intronic
998105817 5:139468557-139468579 CAGAGGGAGCCGAAGGACAGGGG - Intergenic
998161566 5:139815501-139815523 CTGAGTGTGGAGAAAGAAAGGGG - Intronic
998350529 5:141497483-141497505 CAGAGAGAGGAGAGAGAGAGAGG - Intronic
998484203 5:142487397-142487419 TGGAGTGATGAGAAGGAGAGCGG + Intergenic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
999252657 5:150191810-150191832 GAGAGGGAAGAGAAGGAGAGTGG - Intronic
999433064 5:151540475-151540497 GAGAGTGAGGAGCAGGAGAAGGG - Intronic
999517349 5:152314554-152314576 GAGAGGGAGGAGGAGGAGAGGGG - Intergenic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001876422 5:175205759-175205781 CACAGTGAAGAAAAGGATACAGG + Intergenic
1001945649 5:175775369-175775391 CAGAGTTTGGAAAAGGATGGGGG - Intergenic
1002527876 5:179824982-179825004 CAGAGTGGGAGGAAGGAGAGGGG + Intronic
1002795709 6:469697-469719 CAGAGAGAGGAGGGGGAGAGAGG - Intergenic
1002885716 6:1292164-1292186 CAGAGTTAAGAGCAGAATAGGGG - Intergenic
1003487536 6:6592519-6592541 CAGGGTGAGGGGAAGCATAAGGG + Intronic
1003820802 6:9895037-9895059 AAGAGTGAGGAGGATGAGAGGGG - Intronic
1004474476 6:15958704-15958726 AATAGGAAGGAGAAGGATAGAGG + Intergenic
1005387235 6:25297449-25297471 CAGAGAGAGTAAAATGATAGAGG - Intronic
1005428567 6:25729351-25729373 CACAGTGTGGAGAAGGGCAGAGG - Intergenic
1005713419 6:28524198-28524220 GATAGTGAGGGGAAGGAAAGTGG + Intronic
1006014412 6:31068250-31068272 GAGAGGGAGGAGAGGGAGAGGGG + Intergenic
1006210090 6:32386079-32386101 GAGAGGGAGGAGAGGGAGAGGGG + Intergenic
1006809801 6:36812544-36812566 CAGAGAGAGGTTAAGGAAAGTGG + Intronic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1008490995 6:52087229-52087251 CAGAGAGAGGAGAGAGAGAGAGG - Intronic
1008757660 6:54816753-54816775 CTGAGTGACTAGAAGAATAGTGG - Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1010948732 6:82009567-82009589 TAGAGGGAGGAGAAAGAGAGTGG + Intergenic
1011099795 6:83708751-83708773 CAGGGTGCGGAGAAGGGCAGCGG - Intronic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012750001 6:103147848-103147870 CAGATTGGGGATAAGGATGGGGG + Intergenic
1013080633 6:106808880-106808902 CAGAGAGAGGAGAGAGAGAGAGG - Intergenic
1014191782 6:118504545-118504567 CAGATTGAAGAGATGCATAGGGG - Intronic
1014901716 6:126973742-126973764 CAAAGTCAGGAGAAGTGTAGAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015353854 6:132254075-132254097 CAGAGAGAGGAGAATGGCAGAGG + Intergenic
1015846165 6:137522896-137522918 AAGAGGGAGGAGAAAGAGAGGGG + Intergenic
1016514442 6:144878850-144878872 TAGGGGGAGGAGAAGGAAAGTGG - Intergenic
1016802780 6:148183428-148183450 CAGTGTGAGGAGATGGCTACGGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017616359 6:156250703-156250725 AAGAGTGAGGAGAAAGAGACTGG - Intergenic
1018421630 6:163645084-163645106 CAGAGTGAGGAGAACATCAGAGG - Intergenic
1018508202 6:164494184-164494206 CGGAGTGAGAAGAAGGAACGAGG + Intergenic
1018678107 6:166240863-166240885 CAGAGTGGGGAGGTGGAGAGTGG + Intergenic
1019404747 7:877472-877494 CAGAGGGAGGACAGGGAGAGAGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020625638 7:10575591-10575613 CGGAGGGAGGAGAAGCAAAGAGG + Intergenic
1021049750 7:15968012-15968034 CAGAAGGAGGAGAAGGGAAGTGG - Intergenic
1021483349 7:21142693-21142715 CACAGTGAGGAGTAGGGGAGGGG + Intergenic
1021697062 7:23286192-23286214 GAGAGAGAGGGGAAGGAGAGGGG - Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021936713 7:25638605-25638627 CAGAGTGATGACAAGGAGACTGG - Intergenic
1021977649 7:26025967-26025989 CAGGGTGAGGAACAGGAAAGAGG + Intergenic
1022447172 7:30480000-30480022 CAGAGTGAGGGTGAGGACAGGGG - Intergenic
1023294718 7:38702650-38702672 CAGAGTGAAGAGAAGCAGTGAGG - Intergenic
1023548324 7:41342547-41342569 CAGGGTTAGGGTAAGGATAGGGG + Intergenic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1024666360 7:51550955-51550977 CAGAGTGAGAGGAAGGGGAGAGG + Intergenic
1024747832 7:52428430-52428452 CATGGTAAGGAGAAGGACAGGGG - Intergenic
1025607682 7:63051190-63051212 CAGAGTGAGAGGAAGGAAAGAGG - Intergenic
1025945393 7:66100450-66100472 AAGAATGAGGAGGAGGAAAGAGG + Intronic
1026214439 7:68335781-68335803 GAGAGGGAGGAGAAGGACAGAGG + Intergenic
1026262836 7:68770633-68770655 CAGAGAGAGAAGAAGGAAATAGG + Intergenic
1026427371 7:70310033-70310055 TAGAGTGAGTAGAAGGTTAATGG + Intronic
1026494062 7:70887823-70887845 AAGAGGGAGGAGAAAGAAAGGGG + Intergenic
1026571148 7:71532169-71532191 CAAAGTCAGGAGAAGGAAACAGG - Intronic
1026955052 7:74371751-74371773 GAGAGGGAGGAGAAGGAGAGAGG + Intronic
1028590141 7:92484772-92484794 CAGAGTGAGGGCAAGGACAGGGG + Intergenic
1028658202 7:93235235-93235257 GTGAGTGAGGAGAAGAGTAGTGG + Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1030810449 7:113966316-113966338 CAGAGTGAGGAGGATGAAAGAGG + Intronic
1030829119 7:114198785-114198807 AAGAGTGGGGAGAAGGAGAGAGG + Intronic
1031336591 7:120541030-120541052 TAGGGTGGGGAGAAGGATAAAGG - Intronic
1031597969 7:123669578-123669600 AAGAGTGTGGAGAATGACAGAGG + Intergenic
1031654209 7:124332249-124332271 GAGAGGGAAGAGAAGGAGAGAGG + Intergenic
1032504595 7:132425690-132425712 AAGAGAGAGGAGAAGGACAGGGG + Intronic
1032601378 7:133299863-133299885 CAAAGAGAGGAGAAGGACTGAGG - Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033443150 7:141398018-141398040 CAGAGTCAGGAGATTGGTAGTGG + Intronic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1035216624 7:157372431-157372453 CTGAGTGAGGAGGAGCACAGCGG + Intronic
1035442016 7:158909937-158909959 GAGTGTGAGGTGAAGGATCGGGG + Intronic
1036410150 8:8492397-8492419 CAGTGTCAGGAGGAGGACAGAGG + Intergenic
1036546182 8:9771781-9771803 GAGAGAGAGGAGAAGGGAAGTGG + Intronic
1037492271 8:19407581-19407603 CAGAGTCAGGATGAGAATAGAGG - Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1038883876 8:31641145-31641167 CAGAGTGTGGAGATGGTTAGGGG + Intronic
1039499227 8:38003627-38003649 CGGAGTGAGGGCAAGGACAGGGG + Intergenic
1039850839 8:41363779-41363801 AAGAGGGAGAAGAAGGGTAGGGG - Intergenic
1040090208 8:43390837-43390859 TAGAGTGAGGAGGAAGAAAGAGG - Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040826179 8:51623138-51623160 CAGAGAGAGGACAATGAAAGAGG - Intronic
1041240868 8:55848043-55848065 GATAGTGAGGAGGAAGATAGTGG + Intergenic
1042030366 8:64469560-64469582 CAGAGGAAGGAGAAAGGTAGAGG - Intergenic
1043052082 8:75396743-75396765 GAGAGTGGTGAGAAGGAAAGAGG - Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1044289109 8:90446941-90446963 GAGGGAGAGGAGAAGGAAAGAGG - Intergenic
1044503109 8:92985276-92985298 CAGAGAGAGAAGAAGAAGAGAGG + Intronic
1044747421 8:95384260-95384282 CAGATTGAGGAGTGGGATGGAGG + Intergenic
1045342259 8:101265712-101265734 CAGAGTGAAGTCAAGGAAAGAGG - Intergenic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045695976 8:104809310-104809332 CAGAGTGTGAGGAAGGACAGGGG - Intronic
1045949963 8:107840501-107840523 GAGAGAGATGAGAAGGAAAGAGG - Intergenic
1046709915 8:117499296-117499318 CAGAGAGAGGAGGTGGAAAGGGG - Intergenic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1048846859 8:138610441-138610463 CTGAGCGAGGAGAAGGATTCTGG - Intronic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050044124 9:1525889-1525911 GAGAGTGAGGGGAAGATTAGAGG - Intergenic
1050544901 9:6701441-6701463 CAGGGAGGGGAGTAGGATAGAGG + Intergenic
1052325019 9:27208413-27208435 CAGAATGAAGAGAAGGCTATTGG - Intronic
1055391240 9:75824284-75824306 CAGGGTGAGGTGCAGGATTGAGG - Intergenic
1055731063 9:79279679-79279701 CAGAGTTGGCAGAAGGCTAGGGG + Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1057558323 9:96107349-96107371 CAGAGGAGGGAGAAGAATAGGGG + Exonic
1058197672 9:101998846-101998868 CAGAGTGGGGATAAGAATAGAGG + Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058424838 9:104867219-104867241 CAGAGTGGGGAACAGGAGAGAGG + Intronic
1058438076 9:104982202-104982224 CAGAATCAGGAGAAGGTTAGTGG + Intergenic
1059021354 9:110579785-110579807 GAGAGAGAGGAGGAGGAGAGAGG - Exonic
1059642826 9:116234350-116234372 CAGAGTGCGGAGAAGCTCAGTGG + Intronic
1059949597 9:119448574-119448596 CAGACTGAAGAGGAGGATTGAGG - Intergenic
1060449625 9:123724452-123724474 TGGAGTGAGGGGAAGGAGAGGGG + Intronic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060860023 9:126946571-126946593 CAGAGTTAGGAAAAGGAAATGGG + Intronic
1061164245 9:128913235-128913257 CAGAGTGAGGAGAGAGACAGCGG + Intronic
1061281686 9:129601350-129601372 CAGAGGGGGAAGAAGGAGAGAGG + Intergenic
1061625567 9:131838936-131838958 CAGGGTGTGGAGAGGGAGAGGGG + Intergenic
1061806973 9:133142139-133142161 CAGAGTGGGGAGATGGGGAGGGG + Intronic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1062248272 9:135581222-135581244 CTGAGTGAGGAGTAGGAGTGTGG + Intergenic
1062304159 9:135893186-135893208 AAGAGAGAAGAGAAGGAGAGAGG + Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062546639 9:137066537-137066559 CAGTGTGAGGAGCTGGAAAGGGG - Intronic
1062689536 9:137834164-137834186 CACAGCGAGGAGAAGGCTGGCGG + Intronic
1185569716 X:1124194-1124216 CGGAGTGAGCAGAAGGACAGAGG + Intergenic
1185683741 X:1910103-1910125 GAGAGAGAGAAGAGGGATAGAGG - Intergenic
1185751190 X:2610643-2610665 GAGAGTGAGGAGATAGAGAGAGG - Intergenic
1185849655 X:3473618-3473640 CAGAGTGAGGGTGAGGACAGGGG + Intergenic
1186575511 X:10761426-10761448 CAGGGAGAGGTGAAGGATTGGGG - Intronic
1187103870 X:16220883-16220905 CAGCTTGAGGAGAAGGGGAGAGG + Intergenic
1187452844 X:19413783-19413805 GAGGGTGAGGAGGAGGAGAGTGG + Intronic
1188720969 X:33523039-33523061 GAGACTGGGGAGAGGGATAGAGG + Intergenic
1189010289 X:37040095-37040117 GAGAGAGAGGAGAAGGTAAGAGG + Intergenic
1189038291 X:37515613-37515635 GAGAGAGAGGAGAAGGTAAGAGG - Intronic
1190221532 X:48515288-48515310 CAGACTGAGAAGAGGGATCGAGG + Intronic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1191806043 X:65134643-65134665 CAGAGTGAGGGTGAGGACAGAGG + Intergenic
1191902851 X:66056668-66056690 GGGAGTGGGGAGAAGGAGAGGGG + Intergenic
1192034746 X:67549877-67549899 AGGAGAGAGGAGAAGGAAAGAGG - Intronic
1192082475 X:68061575-68061597 CATAGTGAGAAGAGGGACAGGGG + Intronic
1192190057 X:68985565-68985587 CAGTGGGAGGAGAAGGACAGGGG + Intergenic
1192359053 X:70426925-70426947 CAGGGTGAGGAGATGCATAGGGG - Exonic
1192661703 X:73048856-73048878 CAGAGTGAGGAGTATTATGGTGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193431888 X:81417635-81417657 CAAAGCAAGGAGAAGGATAGGGG - Intergenic
1194537632 X:95125622-95125644 GAGAAGGAGGAGAAGGAAAGAGG + Intergenic
1195883263 X:109614520-109614542 CAGAGAGAGGAGAGAGAGAGAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197767745 X:130069986-130070008 GAGAGTGAGGGGATGGATGGCGG + Intronic
1198833390 X:140775870-140775892 CAGATTGAGGAGAAAGTTACTGG - Intergenic
1199564461 X:149199517-149199539 AAGAGTGAGGAAAAGTAGAGTGG - Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1200013524 X:153140061-153140083 TAGAGGGAGGAGAAAGATAATGG + Intergenic
1200026077 X:153259857-153259879 TAGAGGGAGGAGAAAGATAATGG - Intergenic
1200050345 X:153426168-153426190 GACAGTGAGGAGCAGGAAAGAGG - Intergenic
1200137771 X:153883309-153883331 CAGAGGGAGGAGACGGGGAGTGG + Intronic
1201701061 Y:16882709-16882731 GAGAGAGAGGAGACGGAGAGAGG + Intergenic
1202369557 Y:24187683-24187705 CAGAGTGGGGAGAAATATAGTGG + Intergenic
1202501228 Y:25482434-25482456 CAGAGTGGGGAGAAATATAGTGG - Intergenic