ID: 1011578098

View in Genome Browser
Species Human (GRCh38)
Location 6:88827189-88827211
Sequence CTGGCTCATCTCGTTGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1720
Summary {0: 1, 1: 5, 2: 95, 3: 626, 4: 993}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011578090_1011578098 30 Left 1011578090 6:88827136-88827158 CCCAGCGAGATCAATGCAGAAGG 0: 52
1: 311
2: 577
3: 799
4: 1384
Right 1011578098 6:88827189-88827211 CTGGCTCATCTCGTTGGGATTGG 0: 1
1: 5
2: 95
3: 626
4: 993
1011578092_1011578098 29 Left 1011578092 6:88827137-88827159 CCAGCGAGATCAATGCAGAAGGC 0: 32
1: 198
2: 452
3: 696
4: 1249
Right 1011578098 6:88827189-88827211 CTGGCTCATCTCGTTGGGATTGG 0: 1
1: 5
2: 95
3: 626
4: 993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011578098 Original CRISPR CTGGCTCATCTCGTTGGGAT TGG Intronic
900038946 1:441032-441054 CTGGTTCATCTCACTGGGACTGG + Intergenic
900060378 1:676008-676030 CTGGTTCATCTCACTGGGACTGG + Intergenic
901147567 1:7076644-7076666 CAGGCTCATGTCTTTGGGAATGG + Intronic
902134307 1:14291703-14291725 CTGGTTCATCTCTTTGGGACTGG - Intergenic
902141658 1:14361727-14361749 CTGGCTCATCTTATTGGGACTGG - Intergenic
902558992 1:17265312-17265334 CTGCCTCATCTCCTTGGAATGGG - Intronic
902666361 1:17941702-17941724 CTGGCTCAACTTGTTGGGGTGGG - Intergenic
904447319 1:30585625-30585647 CTGGTTCATCTCACTGGGACTGG - Intergenic
904974431 1:34445019-34445041 GTGGCTCATCTCCTTGGCCTTGG - Intergenic
905355527 1:37381083-37381105 CTGGTTCATCTCATTGAGACTGG - Intergenic
905843386 1:41205168-41205190 CTGGTTCATCTCATTGGGACTGG + Intronic
905897127 1:41555514-41555536 CTGGTTCATCTCATTGGGACTGG - Intronic
906585694 1:46976072-46976094 CTGGTTCATCTCATTGGGACTGG + Intergenic
906753322 1:48285779-48285801 CTGGCTCATCCCACTGGGACTGG - Intergenic
906835102 1:49074410-49074432 CTGGTTCATCTCATTGGGACTGG - Intronic
906839598 1:49122228-49122250 CTGGTTCATCTCATTGGGACTGG - Intronic
907015090 1:51005036-51005058 CTGGCTCATCTCACTGAGACTGG + Intergenic
907857826 1:58321386-58321408 CTGGTTCATCTCACTGGGACTGG + Intronic
908178413 1:61579170-61579192 CTGGTTCATCTCTTTGGGAATGG - Intergenic
908576762 1:65468057-65468079 CTGGTTCATCTCATTGGGACTGG - Intronic
908592778 1:65651780-65651802 CTGGCTCATCTCACTGGGACTGG + Intergenic
908813590 1:68009103-68009125 CTGGCTTATCTCATTGGGACAGG - Intergenic
909261322 1:73492177-73492199 CTGGTTCTTCTCATTGGGACTGG - Intergenic
909301090 1:74014457-74014479 CTGGTTCATCTCATTGGGACTGG + Intergenic
909384150 1:75036463-75036485 CTGGTTCATCTCTCTGGGACTGG + Intergenic
909668095 1:78158801-78158823 CTGGTTCATCTCATTGGGACTGG + Intergenic
909807968 1:79894616-79894638 CTGGTTCATCTCATTGGGACTGG - Intergenic
910177104 1:84442869-84442891 CTGGCTCATCTCATTGGGACTGG + Intergenic
910281684 1:85508444-85508466 CTGGTTCATCTCATTGGGACTGG + Intronic
910318824 1:85921059-85921081 CTGGCTCATCTCATTGGGACTGG + Intronic
910383546 1:86657540-86657562 CTGGTTCATCTCATTGGGACTGG + Intergenic
910799438 1:91131060-91131082 CCGGCTCATCTCACTGGGACTGG + Intergenic
910829081 1:91441916-91441938 CTGATTCATCTCATTGGGACTGG + Intergenic
911079747 1:93916664-93916686 CTGGTTCATCTCATTGGGACTGG - Intergenic
911120700 1:94293499-94293521 CTGGTTCATCTCACTGGGACTGG - Intergenic
911218053 1:95216871-95216893 CTGGTTCATCTCATTGAGACTGG - Intronic
911339319 1:96617874-96617896 CTGGTTCATCTCATTGGAACTGG - Intergenic
911342029 1:96651357-96651379 CTGGTTCATCTCACTGGGACTGG + Intergenic
911399521 1:97357927-97357949 CTGGTTCATCTCATTGGGACTGG + Intronic
911517238 1:98881614-98881636 CTGGTTCATCTCATTGAGACTGG - Intergenic
911596180 1:99800929-99800951 CTGATTCATCTCATTGGGACTGG - Intergenic
911632561 1:100199696-100199718 CCGGTTCATCTCATTGGGACTGG + Intronic
911692144 1:100845978-100846000 CTGGCTCATCTCACTGGGACTGG - Intergenic
912150430 1:106853049-106853071 TTGGCTCATCTCATTGGGACTGG + Intergenic
912225722 1:107732338-107732360 CTGGTTCATCTCACTGGGACTGG + Intronic
912271125 1:108209783-108209805 CCGGCTCATCTCACTGGGACTGG - Intergenic
912463167 1:109851161-109851183 CTGGTTCATCTCATTGGGACTGG + Intergenic
912636136 1:111295623-111295645 CGGGTTCATCTCATTGGGACTGG + Intronic
912636144 1:111295685-111295707 CGGGTTCATCTCATTGGGACTGG + Intronic
912646116 1:111393860-111393882 CTGGTTCATCTCATTGGGACTGG + Intergenic
912662024 1:111540340-111540362 CTGCTTCATCTCCTTGGCATGGG + Intronic
912875260 1:113351432-113351454 CTGGCTCTGCTCTTTGGAATGGG - Intergenic
913102826 1:115584865-115584887 TTGGTTCATCTCATTGGGACTGG - Intergenic
913342256 1:117769979-117770001 CTGGTTCATCTCACTGGGACTGG - Intergenic
913408072 1:118517804-118517826 CTGGTTCATCTCATTGGGACGGG - Intergenic
913430198 1:118781622-118781644 CTGGTTCATCTCATTGGGACTGG - Intergenic
913473638 1:119215430-119215452 CTGGTTCATCTCCTTGGGACTGG - Intergenic
913507140 1:119527201-119527223 CCGGTTCATCTCATTGGGACTGG - Intergenic
913512438 1:119573973-119573995 CTGGTTCATCTCATTGGGACTGG + Intergenic
913526390 1:119697404-119697426 CTGGCTCATCTCATTGTGACTGG - Intronic
913987992 1:143583314-143583336 CAGGTTCATCTCATTGGGACTGG - Intergenic
914967217 1:152270468-152270490 CTGGTTCCTCTCATTGGGATTGG - Intergenic
914969150 1:152291648-152291670 CTTGTTCCTCTCATTGGGATTGG + Intergenic
915061453 1:153188993-153189015 CTGGTTCATCTCATTGGGACTGG - Intergenic
915648996 1:157294059-157294081 CTGGCTCATCTCACTGCGAGTGG + Intergenic
915654580 1:157348613-157348635 CCGGCTCATTTCATTGGGACTGG - Intergenic
915711313 1:157901979-157902001 CTGGTTCATTTCATTGGGACTGG + Intergenic
915976176 1:160390916-160390938 CTGGTTCATCTCATTGGGACTGG - Intergenic
916038437 1:160941920-160941942 CTGGTTCATCACATTGGGACTGG - Intergenic
916469568 1:165109585-165109607 CTGGTTCATCTCACTGGGATTGG - Intergenic
916545579 1:165801232-165801254 CCGGCTCATCTCATAGGGATTGG + Intronic
916645952 1:166785177-166785199 CTGGTTCATCTCACTGGGACTGG - Intergenic
916878815 1:168998909-168998931 CTGGTTCATCTCAATGGGACTGG - Intergenic
917041539 1:170810847-170810869 CTGGTTCATCTCATTGGGACTGG + Intergenic
917091636 1:171359322-171359344 CCGGCTCATCTCATTGGGAGTGG + Intergenic
917111824 1:171556441-171556463 CTGGTTCATCTCACTGGGACTGG - Intronic
917157855 1:172024601-172024623 CTGGCTCGTCTCACTGGGACTGG + Intronic
917163241 1:172080967-172080989 CTGGCTCATCTCACTGGGACTGG - Intronic
917257594 1:173132262-173132284 CCAGCTCATCTCATTGGGACTGG - Intergenic
917308845 1:173656122-173656144 CTGGTTCATCTCATTGGGACTGG - Intronic
917323832 1:173811790-173811812 CTGGTTCATCTCACTGGGACTGG + Intronic
917357670 1:174143671-174143693 CCAGCTCATCTCATTGGGACTGG + Intergenic
917743632 1:177986125-177986147 CTGGTTCATCTCACTGGGACTGG + Intergenic
917764198 1:178199321-178199343 CTGGTTCATCTCATTGGGACTGG - Intronic
918159253 1:181882326-181882348 CTGGTTCATCTCATTGGGACTGG + Intergenic
918167323 1:181962241-181962263 CTGGTTCACCTCATTGGGACTGG - Intergenic
918195568 1:182218560-182218582 CTGGCTCATCTCATTCGGACTGG + Intergenic
918353770 1:183684930-183684952 CTAGCTCATCTCACTGGGACTGG - Intronic
918501585 1:185201592-185201614 CCGACTCATCTCATTGGGACTGG - Intronic
918537136 1:185586503-185586525 CTGGTTCATCTCATTGGGACTGG + Intergenic
918632163 1:186730852-186730874 CTGGTTCATCTCATTGGGACTGG - Intergenic
918832571 1:189416540-189416562 CTGGTTCATCTCACTGGGACTGG - Intergenic
919378023 1:196817951-196817973 CTGGTTCATCTCATTGGGACTGG - Intergenic
919387709 1:196941988-196942010 CTGGTTCATCTCACTGGGACTGG - Intronic
919391670 1:196992543-196992565 CTGGTTCATCTCACTGGGACTGG - Intronic
919436720 1:197572041-197572063 ATGGTTCATCTCATTGGGACTGG + Intronic
920064359 1:203256581-203256603 CTGGTTCATCTAATTGGGACAGG + Intronic
920428610 1:205899406-205899428 CTGGTTCATCTCACTGGGACTGG + Intergenic
920588760 1:207196061-207196083 CTGGTTCATCGCATTGGGACTGG + Intergenic
920631775 1:207659629-207659651 CTGGTTCATCTCACTGGGACTGG + Intronic
920643411 1:207776375-207776397 CTGGTTCATCTCACTGGGACTGG - Intronic
920993203 1:210959925-210959947 CTGGTTCATCTCATTGGGACTGG - Intronic
921296950 1:213712854-213712876 CTGGCTTACCTCATTGGGACTGG - Intergenic
921447202 1:215260799-215260821 CTGGTTCATCTCATTAGGACTGG - Intergenic
921626092 1:217379468-217379490 CTGGCTTATCTCATTGGGACTGG + Intergenic
921631253 1:217437031-217437053 CTGGTTCATCTCACTGGGACTGG + Intronic
921916078 1:220611576-220611598 CTGGTTCATCTCACTGGGACTGG - Intronic
921964269 1:221071260-221071282 CTGGTTCACCTCGTTGGTGTGGG + Intergenic
922380121 1:225014296-225014318 CTGGTTCATCTCATTGGGACTGG - Intronic
922406308 1:225316693-225316715 CTGGTTCATCTCATTGGGACTGG - Intronic
922715920 1:227871988-227872010 CTGGTTCATCTCACTGGGACTGG + Intergenic
923061334 1:230476944-230476966 CAGGCTCATCTCACTGGGACTGG - Intergenic
923416795 1:233770182-233770204 CTGGTTCATCTCATTGGGACTGG - Intergenic
924253497 1:242158656-242158678 CTGTTTCATCTCACTGGGATTGG - Intronic
924865908 1:247979674-247979696 CTGGTTCATCTCATTGGGACAGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1065076866 10:22089375-22089397 CTGGTTCATCTCATTGGGACTGG + Intergenic
1065119447 10:22514389-22514411 CTGGTTCATCTCATTGGGACTGG - Intergenic
1065156976 10:22880755-22880777 CTGGTTCATCTCACTGGGACTGG + Intergenic
1065231100 10:23599130-23599152 CTGGTTCATCTCATTGGGACTGG - Intergenic
1065364547 10:24922770-24922792 CTGGTTCATCTTATTGGGACGGG + Intronic
1066297492 10:34067584-34067606 CTGGTTCTTCTCATTGGGACTGG + Intergenic
1066546421 10:36505188-36505210 GTGGCTCATCTGGATGGCATGGG - Intergenic
1066965837 10:42263806-42263828 CTGGTTCATCTCATTGGGACTGG - Intergenic
1067127661 10:43533498-43533520 CTGGTTCATCTCATTGGGACTGG - Intergenic
1067162258 10:43836890-43836912 CCGGCTCGTCTCATTGGGACTGG - Intergenic
1067172622 10:43920780-43920802 CTGGTTCATCTCACTGGGACTGG - Intergenic
1067231178 10:44411737-44411759 CTGGTTCATCTCATTGGGACTGG - Intergenic
1067239729 10:44480409-44480431 CTGGTTCATCTCATTGGGACCGG + Intergenic
1067332364 10:45333965-45333987 CCGGCTCATCTCATTTGGACTGG - Intergenic
1067335399 10:45358849-45358871 CAGGTTCATCTCATTGGGACTGG + Intergenic
1068126400 10:52846652-52846674 CTGGTTCATCTCATTGGAACTGG - Intergenic
1068169028 10:53370215-53370237 CTGGTTCATCTCATTGGGACTGG + Intergenic
1068534767 10:58229824-58229846 CTGGTTCACATCATTGGGATTGG + Intronic
1068609579 10:59043870-59043892 CTGGTTCATCTCATTGGGACTGG - Intergenic
1068622918 10:59207227-59207249 CCAGCTCATCTCATTGGGACTGG + Intronic
1068651549 10:59528296-59528318 CTGGTTCATCTCATTGGGACTGG + Intergenic
1068759313 10:60690209-60690231 CTGGTTCATCTCATTGGGACTGG + Intronic
1068951481 10:62782104-62782126 CCAGCTCATCTCATTGGGACTGG + Intergenic
1069259883 10:66382056-66382078 CTGGTTCATCTCACTGGGACTGG + Intronic
1069264382 10:66439034-66439056 CTGACTCATCTCATTGGGACTGG - Intronic
1069300284 10:66899476-66899498 CTAGTTCATCTCATTGGGACTGG + Intronic
1069349063 10:67503309-67503331 CTGGCTCATCTCATTGGGACTGG - Intronic
1070003033 10:72395407-72395429 CTGGTTCATCTCATTGGGACTGG + Intronic
1070007122 10:72435516-72435538 CTGGTTCATCTCACTGGGACTGG + Intronic
1070061641 10:72989668-72989690 CTGGTTCATCTCATTGGTACTGG + Intergenic
1070064639 10:73021615-73021637 CTGGTTCATCTCATTGGGACTGG + Intronic
1070343707 10:75521727-75521749 CTGGTTCATCTCATTGGGACTGG - Intronic
1070632377 10:78096177-78096199 CTTGCTCATCTCATTGGGACTGG + Intergenic
1070936711 10:80304154-80304176 CTGGTTCATCTCATTGGGACTGG + Intergenic
1071002107 10:80842093-80842115 CTGGCTCATCTCACTGGGACTGG - Intergenic
1071189962 10:83088999-83089021 CTGGTTCATCTAATTGGGACTGG + Intergenic
1071304686 10:84288332-84288354 CTGGGTCACCTTGTTGGCATGGG + Intergenic
1071349611 10:84727234-84727256 CTGATTCATCTCATTGGGACTGG + Intergenic
1071421565 10:85505089-85505111 CTGGTTCATCTCATTGGGACTGG - Intergenic
1071922946 10:90371838-90371860 CTGGTTCATCTCACTGGGACTGG - Intergenic
1071975949 10:90955642-90955664 CCAGCTCATCTCATTGGGACTGG - Intergenic
1072044785 10:91643941-91643963 CTGGCTCATCTCACTGGGACTGG + Intergenic
1072359047 10:94640669-94640691 CTGGTTCATCTCATTGGGACTGG - Intergenic
1072394362 10:95023518-95023540 CTGGTTCATCTCATTGGGACTGG - Intergenic
1072404313 10:95135986-95136008 CTGGTTCATCTCAATGGGACTGG + Intergenic
1072477659 10:95778163-95778185 CTGGTTCATCTCATTGGGACTGG - Intronic
1072775116 10:98183057-98183079 CTGGTTCATCTCATTGGGACTGG - Intronic
1073694446 10:105849456-105849478 CTGATTCATCTCATTGGGACTGG + Intergenic
1074031253 10:109690979-109691001 CTTTCTCATCTTGTTGTGATAGG + Intergenic
1074117862 10:110471055-110471077 CTGGTTAATCTCATTGGGACTGG - Intergenic
1074590894 10:114811970-114811992 CTGGCTTATCTCCTTGGTGTGGG - Intergenic
1074985265 10:118652620-118652642 CTGGCTCATCTCACTGGGACTGG - Intergenic
1075175379 10:120155809-120155831 TTGGTTCATCTCATTGGGACTGG + Intergenic
1075805406 10:125185001-125185023 CTGGTTCATCTCACTGGGACTGG - Intergenic
1076159245 10:128229599-128229621 CTGGTTCATGTCATTGGGACTGG - Intergenic
1076591011 10:131581989-131582011 CTGGTTCATCTCATTGGGACTGG - Intergenic
1076965153 11:76943-76965 CTGGTTCATCTCACTGGGACTGG + Intergenic
1077655733 11:4017090-4017112 CTGGTTCATCTCATTGGGACTGG - Intronic
1078119269 11:8490043-8490065 CTGGTTCATCTCATTGGGATGGG + Intronic
1078283784 11:9930724-9930746 CTGTTTCATCTCATTGGGACTGG + Intronic
1078429099 11:11273983-11274005 CTGGTTCATCTCATTCGGACTGG + Intronic
1078482575 11:11691643-11691665 CTGGTTCATTTCATTGGGACTGG + Intergenic
1078560360 11:12366061-12366083 CTGGTTCCTCTCATTGGGACTGG + Intergenic
1078689955 11:13569943-13569965 CTGGTTCATCTCATTGGGACTGG + Intergenic
1078697703 11:13651348-13651370 CTGGTTCATCTCACTGGGACTGG + Intergenic
1078732997 11:13992895-13992917 CTGGTTCATCTCATTGGGACTGG - Intronic
1078981122 11:16536428-16536450 CTGGTTCATCTCACTGGGACTGG + Intronic
1078993992 11:16678576-16678598 CTGGTTCATCTCATTGAGACTGG + Intronic
1079585457 11:22121494-22121516 CTGGTTCATCTCACTGGGACTGG - Intergenic
1079696025 11:23483810-23483832 CTGGTTCATCTCATTGGGACTGG + Intergenic
1079714807 11:23731691-23731713 CTGGTTCATCTCATTGGGACTGG + Intergenic
1079867810 11:25758091-25758113 CTGGCTCACCTCTTTGGGACTGG + Intergenic
1079957432 11:26882297-26882319 CTGGTTCATCTTGTTGGGACTGG + Intergenic
1080033707 11:27688751-27688773 CGGGCTCATCTCATTGGGACTGG - Intronic
1080117636 11:28638763-28638785 CTGGTTCATCTCACTGGGACTGG + Intergenic
1080187426 11:29506567-29506589 CTGGCTCATTTTGTTGGTGTTGG + Intergenic
1080235894 11:30067641-30067663 CTGGTTCATCTCATTGGGACTGG - Intergenic
1080346911 11:31335420-31335442 CTGGTTCATCTCATTGGGACTGG - Intronic
1080489521 11:32747964-32747986 CTGGTTTATCTCGTTGGGACTGG - Intronic
1080736591 11:35022074-35022096 CTGGTTCATCTCATTGGGACTGG + Intergenic
1080897282 11:36457077-36457099 CTGGCTCATCCCAGTGGGCTGGG + Intronic
1080977071 11:37356371-37356393 CCAGCTCATCTCATTGGGACTGG + Intergenic
1081118188 11:39231871-39231893 CCGGCTCATCTCATTGGGACTGG + Intergenic
1081143873 11:39536824-39536846 CTGGTTCATCTCACTGGGACTGG - Intergenic
1081241465 11:40711211-40711233 CTGGTTCATCTCACTGGGACTGG - Intronic
1081308672 11:41544822-41544844 CTGGTTCATCTCATTGTGACTGG + Intergenic
1081363207 11:42205164-42205186 CTGGCTCATCTCATTGGGACTGG + Intergenic
1081682467 11:45017829-45017851 CTGGTTCATGTCATTGGGACTGG - Intergenic
1082249532 11:49963441-49963463 CTGGTTCATCTCATTGGGACTGG + Intergenic
1082670614 11:56032924-56032946 CTGGCTCATCTCATTGGGACTGG + Intergenic
1082729869 11:56782594-56782616 CCGGCTCATCTCATTGGGACTGG + Intergenic
1082860160 11:57847952-57847974 CTGGTTCATCTAATTGGGACTGG + Intergenic
1082903683 11:58283629-58283651 CCAGTTCATCTCGTTGGGATTGG - Intergenic
1083003726 11:59321475-59321497 CTGGTTCATCTCATTGGGACTGG - Intergenic
1083008543 11:59372131-59372153 CTGGTTCATCTCATTGGGAACGG + Intergenic
1083385617 11:62307002-62307024 CCAGCTCATCTCATTGGGATTGG - Intergenic
1083503500 11:63133331-63133353 CTGGTTCATCTCATTGGGACTGG - Intronic
1083510134 11:63201944-63201966 CTGGCTCATCTTATTGGGACTGG + Intronic
1083516320 11:63262153-63262175 CCGGCTCGTCTCATTGGGACTGG - Intronic
1083531517 11:63427886-63427908 CTGGTTCATCTCATTGGGACTGG + Intergenic
1085003278 11:73061111-73061133 CTGGTTCATCTCATTGGGACTGG + Intronic
1085287027 11:75369753-75369775 CTGACTCAACAGGTTGGGATGGG - Intergenic
1085433708 11:76480716-76480738 CTGGCTTATCTCACTGGGACTGG + Intronic
1085536608 11:77224211-77224233 CTGGTTCATCTCACTGGGACTGG - Intronic
1085800661 11:79586194-79586216 CTGGTTCATCTCACTGGGACTGG + Intergenic
1086090671 11:83001704-83001726 CTGTCTCATCACATGGGGATTGG - Intronic
1086117270 11:83266231-83266253 CTGGTTCATCTCATTGGGACTGG + Intronic
1086298176 11:85395380-85395402 CTGGTTCATCTCATTGGGACTGG + Intronic
1086300413 11:85421286-85421308 CCAGCTCATCTCATTGGGACTGG - Intronic
1086307321 11:85496025-85496047 CTGATTCATCTCATTGGGACTGG + Intronic
1086410624 11:86540938-86540960 CTGGCTCATCTCATTGGGATTGG + Intronic
1086421821 11:86644860-86644882 CTGGCTCATCTCACTGGGACTGG + Intronic
1086505201 11:87497479-87497501 CTGGCTCATCTCATTGGGACTGG + Intergenic
1086506346 11:87508267-87508289 CTGGTTCATCTCATTGGGACTGG - Intergenic
1086532452 11:87801524-87801546 CCAGCTCATCTCATTGGGAATGG - Intergenic
1086644943 11:89209064-89209086 CTGATTCATCTCATTGGGACTGG + Intronic
1086812082 11:91322317-91322339 CTGGTTCATCTCACTGGGACTGG - Intergenic
1086907413 11:92433574-92433596 TTGGCTCATCTCATTGGGACTGG - Intronic
1087003512 11:93445104-93445126 CTGGTTCATCTCATTGAGACTGG - Intergenic
1087004664 11:93458191-93458213 CTGGTACATCTCATTGGGACTGG + Intergenic
1087149954 11:94850355-94850377 CTGTCTCAACTCCTTGGAATTGG - Intronic
1087311100 11:96545106-96545128 CTGGTTCATCTCACTGGGACTGG + Intergenic
1087321175 11:96660669-96660691 CTGGCTTACCTTGTTGGCATGGG + Intergenic
1087332126 11:96793567-96793589 CTGGTTCATCTCATTGGGATTGG - Intergenic
1087364250 11:97198739-97198761 CTGGTTCGTCTCATTGGGACTGG - Intergenic
1087482461 11:98718495-98718517 CTGGTTCATCTCATTGGGACTGG - Intergenic
1087695383 11:101370113-101370135 CTGGCTCATCTCACTGGGTCTGG - Intergenic
1087780991 11:102301380-102301402 CTGGTTCATCTAATTGGGACTGG - Intergenic
1087831067 11:102820258-102820280 GTGGTTCATCTCATTGGGACTGG - Intergenic
1087898231 11:103611325-103611347 CTGGTTTATCTCATTGGGACTGG + Intergenic
1088078389 11:105879232-105879254 CTGGCTCATCTCACTGGGACTGG - Intronic
1088152220 11:106758519-106758541 CTGGTTCATCTCATTGAGACTGG - Intronic
1088197666 11:107293821-107293843 CTGGTTCATCTCTTTGGGACTGG + Intergenic
1088212020 11:107466796-107466818 CCAGCTCATCTCATTGGGACTGG - Intergenic
1088294579 11:108277722-108277744 ATGGCTCATCTCATTGGGACTGG - Intronic
1088381110 11:109193364-109193386 CTGGTTCATCTCACTGGGACTGG - Intergenic
1088702452 11:112425871-112425893 CTAGTTCATCTCATTGGGACTGG + Intergenic
1088852275 11:113714683-113714705 CTGGTTCATCTCATTGGGACTGG - Intergenic
1089213496 11:116821692-116821714 CTGGCTCACCTCATTGGCATGGG + Exonic
1089766122 11:120766794-120766816 CTGGTTCATTTCACTGGGATTGG - Intronic
1090103832 11:123830238-123830260 CTGGTTCATCTCATTGGGACTGG - Intergenic
1090513325 11:127398573-127398595 CAGGCTGATCTCTCTGGGATGGG - Intergenic
1090720315 11:129466847-129466869 CTGGTTCATCTCACTGGGACTGG + Intergenic
1090722933 11:129493579-129493601 CTGGTTCATCTCATTGGGACTGG + Intergenic
1091712068 12:2749236-2749258 CTGGCTCATCTCATTGGGACTGG + Intergenic
1091867205 12:3851234-3851256 CTGGTTCATGTCATTGGGACTGG + Intronic
1091958653 12:4672041-4672063 CTGGTTCATCTCATTGGGACTGG + Intronic
1092160990 12:6315543-6315565 CTGGCTCATCTCCTGGGGTGGGG - Exonic
1092304268 12:7283352-7283374 CTGGCTCATCTCACTGGGACTGG + Intergenic
1092327021 12:7543729-7543751 CTGGTTCATCTCACTGGGACTGG + Intergenic
1092440312 12:8495703-8495725 CTGGTTCATCTCATTGGAACTGG + Intergenic
1092661974 12:10748252-10748274 CTGGTTCATCTCACTGGGACTGG - Intergenic
1092690814 12:11108467-11108489 ATGGCTCATCTCACTGGGACTGG + Intronic
1093085989 12:14867364-14867386 CTGGTTCATCTCATTGGGACTGG - Intronic
1093545147 12:20336970-20336992 CTGGTTCATCTCATTGGGACTGG - Intergenic
1093597739 12:20981748-20981770 CTGGTTCATCTCATTGGGACTGG - Intergenic
1093649621 12:21627594-21627616 CTGGTTCATCTCACTGGGACTGG - Intergenic
1093694665 12:22146283-22146305 CCAGCTCATCTCATTGGGACTGG + Intronic
1093714403 12:22365718-22365740 CCGGCTCATCTCATTAGGACTGG + Intronic
1093992935 12:25610356-25610378 CTGGTTCATCTCATTGGGACTGG - Intronic
1094135456 12:27120320-27120342 CTGGTTCATCTCATTGGGACTGG - Intergenic
1094140116 12:27172218-27172240 ATGGCTCATTTCATTGGGACTGG - Intergenic
1094311774 12:29092473-29092495 CTAGTTCATCTCATTGGGACTGG + Intergenic
1094430808 12:30367373-30367395 CTGGTTCATCTCATTGGGACTGG - Intergenic
1094482381 12:30895067-30895089 CTGGTTCATCTCACTGGGACTGG - Intergenic
1094579312 12:31719191-31719213 CTGGTTCATCTCACTGGGACTGG - Intronic
1094757766 12:33492366-33492388 CTAGCTCATCTAATTGGGACTGG + Intergenic
1094791576 12:33920943-33920965 CTGGTTCATCTCATTGAGACTGG - Intergenic
1095120023 12:38405708-38405730 GTGGCTCATCTCATTGGGACTGG - Intergenic
1095128255 12:38507977-38507999 CTGATTCATCTCATTGGGACTGG + Intergenic
1095140496 12:38657002-38657024 CTGGATCATCTCACTGGGACTGG + Intronic
1095186577 12:39207845-39207867 CTGGTTCATCTCATTGGGACTGG + Intergenic
1095406254 12:41870321-41870343 CCGGCTCATCTCATTGGGACTGG + Intergenic
1095488397 12:42707991-42708013 ACAGCTCATCTCATTGGGATTGG + Intergenic
1095495810 12:42782434-42782456 CTGGCTCACCTAGTTGGTGTAGG + Intergenic
1095646900 12:44558458-44558480 CTGGCTCATGTTATTGGGACTGG + Intronic
1095706499 12:45242591-45242613 CTGGTTCATCTCATTGGGACTGG - Intronic
1095720160 12:45391976-45391998 CTGGTTCATCTCATTGGGATTGG + Intronic
1095778045 12:46031554-46031576 CTGGCTTATCTCATTGAGACTGG + Intergenic
1095793849 12:46195970-46195992 CTGGTTCATCTCACTGGGACTGG - Exonic
1095798386 12:46246131-46246153 CTGGTTCATCTCATTGGGACTGG + Intronic
1095845206 12:46737086-46737108 CTGGTTCATCTCACTGGGACTGG + Intergenic
1096030586 12:48410454-48410476 CTGGTTCATCTCATTGGGACTGG - Intergenic
1096941768 12:55355025-55355047 CCGGTTCATCTCATTGGGACTGG + Intergenic
1096950058 12:55459410-55459432 CTGGTTCGTCTCATTGGGACAGG + Intergenic
1097148493 12:56958343-56958365 CTGGTTCATCTCACTGGGACTGG + Intronic
1097301427 12:58023169-58023191 CTGGTTAATCTCATTGGGACTGG - Intergenic
1097364883 12:58701429-58701451 CTGGTTCATCTCATTGGGACTGG + Intronic
1097375902 12:58841703-58841725 CTGGTTCATCTCACTGGGACGGG - Intergenic
1097635288 12:62114332-62114354 CCAGCTCATCTCATTGGGACTGG - Intronic
1097700960 12:62819900-62819922 CTGGTTCATCTCATTGGGACTGG + Intronic
1097737294 12:63196314-63196336 CCAGCTTATCTCATTGGGATTGG + Intergenic
1097912215 12:64982381-64982403 CTTGTTCATCTCATTGGGACTGG - Intergenic
1097948896 12:65403946-65403968 CTGGCTCATCTCACTGGGACTGG - Intronic
1098176083 12:67792649-67792671 CTGGTTCATCTCACTGGGACTGG - Intergenic
1098704504 12:73671193-73671215 CTGGTTCATCTCATTGGGACTGG + Intergenic
1098906732 12:76170193-76170215 ATGGCTCATCTCATTGGGACTGG - Intergenic
1098993943 12:77096474-77096496 CTGGTTCATCTCATTGGGACTGG - Intergenic
1099053555 12:77809512-77809534 CTGACTCATCTCATTGGGACTGG - Intergenic
1099183852 12:79497202-79497224 CCGGCTCATCTCATTGGGACTGG - Intergenic
1099216598 12:79861436-79861458 CTGCTTCATCTCATTGGGACTGG + Intronic
1099314225 12:81064728-81064750 CTGGTTCATCTCAATGGGACTGG + Intronic
1099410142 12:82314879-82314901 CTGGTTCATCTCATTGGGACTGG - Intronic
1099435349 12:82635508-82635530 CCGGTTCATCTCATTGGGACTGG - Intergenic
1099523608 12:83693696-83693718 CTGGTTCATCTCATTGGGACTGG + Intergenic
1099798105 12:87423004-87423026 CTGGCTCATCTCACTGGGACTGG - Intergenic
1099878345 12:88436771-88436793 CTGGTTCATCTCACTGGGACTGG + Intergenic
1099897464 12:88667254-88667276 CCGGCTCATCTCATTGGGACTGG + Intergenic
1100136190 12:91556583-91556605 ATGGCTCATCTCATTGGGACTGG + Intergenic
1100381301 12:94064380-94064402 CTGGTTCATCTCAATGGGACTGG + Intergenic
1100417096 12:94389596-94389618 CTGGTTCATCTCACTGGGACTGG + Intronic
1100797902 12:98201783-98201805 CTGGCTCTTCTCACTGGGACTGG + Intergenic
1100808242 12:98310860-98310882 CCGGTTCATCTCATTGGGACTGG + Intergenic
1100900748 12:99238023-99238045 CTGGTTCATCTCATTGAGACTGG + Intronic
1101069958 12:101063226-101063248 CCAGCTCATCTCATTGGGACTGG - Intronic
1101295992 12:103424473-103424495 TTGGCTCATCTCACTGGGACTGG + Intronic
1101301765 12:103489968-103489990 CTGGGTCATCTCACTGGGACTGG - Intronic
1101361763 12:104034265-104034287 CTCGTTCATCTCATTGGGACTGG + Intronic
1101615199 12:106329425-106329447 TTGGCTCTTCTCTTAGGGATCGG - Intronic
1101628665 12:106471483-106471505 CTGGTTCATCTCACTGGGACTGG - Intronic
1102345666 12:112159530-112159552 CTGGCTCATCTCAATGGGACTGG - Intergenic
1103032611 12:117629219-117629241 CTGGTTCATCTCATTGGGACTGG - Intronic
1103255488 12:119538434-119538456 CTGGTTCATCTCATTGGGACTGG - Intronic
1103255743 12:119540022-119540044 CTGGCTCATCTCATTGGGACTGG - Intronic
1104115698 12:125746888-125746910 CCGGCTCATCTCATTGGGACTGG - Intergenic
1104175425 12:126326667-126326689 CTGGTTCATCTCACTGGGACTGG - Intergenic
1105355009 13:19652229-19652251 CCGGTTCATCTCATTGGGACTGG + Intronic
1105737473 13:23285950-23285972 CTGGCTCATCTCATTGGGACTGG - Intronic
1105769315 13:23593901-23593923 CCAGCTCATCTCATTGGGACTGG + Intronic
1106025714 13:25953652-25953674 CTGGTTCATCTCACTGGGACTGG + Intronic
1106042055 13:26103048-26103070 CTGGCTCATCTCACTGGGACTGG + Intergenic
1106095083 13:26636528-26636550 CTGGTTCCTCTCATTGGGACTGG - Intronic
1106153092 13:27125581-27125603 CTGGTTCATCTCATTGGGACTGG + Intronic
1106326400 13:28694224-28694246 CTGGTTCATCTCACTGGGACTGG - Intergenic
1106391256 13:29337487-29337509 ATGGCTCATCTCATTGGGACTGG - Intronic
1106612399 13:31296153-31296175 CTGGTGCATCTCATTGGGACTGG - Intronic
1106816824 13:33418063-33418085 CTGGTTCATCTCATTGGTACTGG + Intergenic
1107473547 13:40713194-40713216 CCGGCTCATCTCATTGGGACTGG - Intergenic
1107642055 13:42453504-42453526 CGGGCTCATCTCATTGGGACAGG - Intergenic
1107674172 13:42777290-42777312 CTGGTTCATCTCATTGGGACTGG - Intergenic
1108048895 13:46409432-46409454 CCAGCTCATCTCATTGGGACTGG - Intronic
1108188040 13:47908061-47908083 CTGGTTCATCTCATTGGGACTGG + Intergenic
1108234953 13:48394051-48394073 CTGGCTCATCTCATTGGGACTGG + Intronic
1108262889 13:48675989-48676011 CCAGCTCATCTCATTGGGACTGG - Intronic
1108471800 13:50774285-50774307 CTGGTTCATCTCACTGGGACTGG - Intronic
1108674145 13:52721633-52721655 CTGGCTTATCTCACTGGGAGTGG - Intronic
1108796978 13:54043939-54043961 CTGGTTCATCTCACTGGGACTGG + Intergenic
1108865364 13:54917231-54917253 CTGGTTAATCTCATTGGGACTGG + Intergenic
1108998225 13:56762944-56762966 ACGGCTCATCTCATTGGGACTGG + Intergenic
1109216017 13:59590776-59590798 CTGGTTCATCTCACTGGGACTGG + Intergenic
1109293655 13:60504738-60504760 CTGGCTCATCTCATTGGAACTGG + Intronic
1109328564 13:60900134-60900156 CTGGCTCATCTCAATGGGACTGG + Intergenic
1109385979 13:61629337-61629359 CTGGTTCATCTCACTGGGACTGG - Intergenic
1109465879 13:62730228-62730250 CTGGTTCATCTCATTGGGACTGG - Intergenic
1109541427 13:63782778-63782800 CCAGCTCATCTCATTGGGACTGG - Intergenic
1109626718 13:64983364-64983386 CTGGCTCACCTCATTGAGACTGG - Intergenic
1109659080 13:65435511-65435533 CTGGTTCATCTCATTGGGACTGG + Intergenic
1109806588 13:67452375-67452397 CTTGTTCATCTCATTGGGACTGG + Intergenic
1109963853 13:69666926-69666948 CTGGTTCATCTCATTGGGACTGG + Intergenic
1110019864 13:70457104-70457126 CTGGTACATCTCATTGGGATTGG + Intergenic
1110247780 13:73346186-73346208 CTGGTTCATCTCATTGGGACTGG - Intergenic
1110818486 13:79887129-79887151 CTGGTTCATCTCATTGGGACTGG + Intergenic
1110824563 13:79957683-79957705 CTGGATCATCTCATTGGGACTGG + Intergenic
1110824588 13:79957909-79957931 CTGGATCATCTCATTGGGACTGG + Intergenic
1110826255 13:79975029-79975051 CTGGTTCATCTCACTGGGACTGG + Intergenic
1110876467 13:80516960-80516982 CTGGTTCATCTCATTGGGACTGG + Intergenic
1110968695 13:81733415-81733437 CTGGCTCATTTCACTGGGATTGG - Intergenic
1111352001 13:87043441-87043463 CTGGCTCATCTCATTGCGACTGG + Intergenic
1111627865 13:90813000-90813022 CCGGCTCACCTCATTGGGACTGG + Intergenic
1111634984 13:90892495-90892517 CTAGCTCATCTCACTGGGACTGG + Intergenic
1111932570 13:94526746-94526768 CTGGTCCATCTCATTGGGACCGG + Intergenic
1112075293 13:95906905-95906927 CTGGTTCATCTCAATGGGACTGG + Intronic
1112131148 13:96524874-96524896 CTGGTTCATCTCACTGGGACAGG - Intronic
1112165761 13:96918495-96918517 ATGGCTCATCTCATTGGGACTGG + Intergenic
1112363078 13:98734407-98734429 CTGGTTCATCTCACTGGGACTGG + Intronic
1112412102 13:99173337-99173359 CTGGTTCATCTCACTGGGACTGG - Intergenic
1112546606 13:100377151-100377173 CCGGCTCATCTCACTGGGACTGG - Intronic
1113348844 13:109508326-109508348 CTGGTTCATCTCATTGGGACTGG - Intergenic
1114133653 14:19821270-19821292 CCAGCTCATCTCATTGGGACTGG - Intronic
1114335931 14:21690063-21690085 CCAGCTCATCTCCTTGGGACTGG + Intergenic
1114341855 14:21753874-21753896 CTGGTTCATCTCACTGGGACTGG + Intergenic
1114342530 14:21760164-21760186 CTGGTTCATCTCACTGGGACTGG + Intergenic
1114573282 14:23690569-23690591 CTGGTTCATCTCATTGGGACTGG - Intergenic
1114603739 14:23978524-23978546 CTGGCTCAACTCACTGGGACTGG + Intronic
1114608751 14:24021298-24021320 CTGGCTCAACTCACTGGGACTGG + Intergenic
1114741661 14:25104365-25104387 CCGGCTCATCTCAATGGGACTGG + Intergenic
1114817567 14:25978950-25978972 CCAGCTCATCTCATTGGGACTGG + Intergenic
1114964320 14:27939058-27939080 CTGGTTCATCTCACTGGGACTGG + Intergenic
1114981241 14:28168093-28168115 CTGGTTCATCCCATTGGGACTGG + Intergenic
1115008268 14:28512109-28512131 CTGGTTCATCTCATTGGGACTGG - Intergenic
1115018264 14:28642951-28642973 CTGGCTCTTCTCATTGGGAGTGG - Intergenic
1115116721 14:29889353-29889375 CTGGTTCATCTCATTGGGACTGG + Intronic
1115294713 14:31812653-31812675 CTGGTTCATCTCACTGGGACTGG - Intronic
1115359906 14:32488852-32488874 CTACCTCATTTCGTTGGGACTGG - Intronic
1115481183 14:33862730-33862752 CTGGCTCTTCTCAGTGGGTTGGG + Intergenic
1115511175 14:34139440-34139462 CTGGCTCATCTCATTGGGACTGG + Intronic
1115537960 14:34391307-34391329 CTGGCTCATCTCATTGGGACTGG + Intronic
1115584544 14:34797782-34797804 CTGGTTCATCTCATTGGGACTGG + Intronic
1115774443 14:36699965-36699987 CTGGTTCATCTCACTGGGACTGG - Intronic
1115818389 14:37187860-37187882 CTGGTTCATCTCATTGGGACTGG + Intergenic
1115833141 14:37364153-37364175 CCAGTTCATCTCATTGGGATTGG - Intronic
1115843609 14:37501722-37501744 CTGGTTCATCTCGTTGGGACTGG + Intronic
1115940432 14:38602172-38602194 GTGGCTCATCTCATTGGGACTGG - Intergenic
1115974499 14:38981534-38981556 CCGGTTCATCTCATTGGGACTGG - Intergenic
1116009353 14:39332761-39332783 CTGGTTCATCTCACTGGGACTGG - Intronic
1116165599 14:41330381-41330403 CTGGTTCATCTCATTGGGACTGG - Intergenic
1116212758 14:41968825-41968847 CTGGTTCATCTCATTGGGACTGG - Intergenic
1116236538 14:42285661-42285683 CTGGTTCATCTCATTGGGACTGG - Intergenic
1116433689 14:44873975-44873997 CTGGTTCATCTCATTGGGACTGG - Intergenic
1116482738 14:45411506-45411528 CTGGTTCATCTCACTGGGACTGG + Intergenic
1116511973 14:45757097-45757119 CCAGCTCATCTCATTGGGACTGG - Intergenic
1116565314 14:46438283-46438305 CTGGTTCATCTCACTGGGACTGG + Intergenic
1116771571 14:49132131-49132153 CCAGCTCATCTCATTGGGACTGG - Intergenic
1117081635 14:52157869-52157891 GTGGTTCATCTCATTGGGACTGG + Intergenic
1117100639 14:52343037-52343059 CTGACTCATCTTGTTGGCATGGG + Intergenic
1117104175 14:52381936-52381958 CTGGCTCATCTCACTGGGATTGG + Intergenic
1117120966 14:52568103-52568125 CTGGCTCATCTCATTGGGACTGG + Intronic
1117123737 14:52596841-52596863 CTGGTTCATCTCATTGGGACTGG - Intronic
1117169985 14:53084750-53084772 CTGGTTCATCTCACTGGGACTGG + Intronic
1117172735 14:53117269-53117291 CTGGTTCATCTCATTGGGACTGG + Intronic
1117624123 14:57618336-57618358 CTGGTTCATCTCCCTGGGACTGG + Intronic
1117655384 14:57951102-57951124 CTGGCTCATCTCATTGGGACTGG + Intronic
1117710612 14:58525359-58525381 CTGGCTCATCTCATTGGGACTGG + Intronic
1117797169 14:59406265-59406287 CTGCCTCATCTCATTGGGACTGG - Intergenic
1117821758 14:59657543-59657565 CTGGCTCATCTCACTGGGACTGG + Intronic
1117859281 14:60073285-60073307 CCGGCTCATCTCATTGGGACTGG + Intergenic
1117887599 14:60381726-60381748 CTGGTTCATCTCATGGGGACTGG + Intergenic
1117892601 14:60443147-60443169 CTGGTTCATCTCAATGGGACTGG + Intronic
1117900682 14:60529308-60529330 CTGGTTCATCTCATTGGGACTGG - Intergenic
1118494607 14:66295894-66295916 ATGGTTCATCTCATTGGGACTGG + Intergenic
1118516186 14:66530800-66530822 CTGGCTCATCTCATTGGGACTGG - Intronic
1118544628 14:66873077-66873099 ACGGCTCATATCGTTGGGACTGG + Intronic
1118559938 14:67067972-67067994 CCAGTTCATCTCATTGGGATGGG - Intronic
1118830012 14:69422023-69422045 CTGGTTCATCTCACTGGGACGGG - Intronic
1119018572 14:71085184-71085206 CCGGCTCATCGCATTGGGACTGG - Intronic
1120065709 14:80038901-80038923 CTGGTTCATTTCATTGGGACTGG + Intergenic
1120071183 14:80105196-80105218 CTGGCTTAACTCATGGGGATGGG - Intergenic
1120201223 14:81540316-81540338 CTGGCTCATCTCACTGGGACTGG + Intergenic
1120271872 14:82322435-82322457 ATGGCTCATCTCACTGCGATTGG - Intergenic
1120619953 14:86751020-86751042 CTGGTTCATCTCACTGGGACTGG - Intergenic
1120843250 14:89105167-89105189 CCAGCTCATCTCATTGGGACTGG - Intergenic
1121470684 14:94151881-94151903 CTGGCTCATCTTATTGGGACTGG - Intronic
1122443414 14:101750269-101750291 CTGGTTCATCTCATTGGGACTGG - Intergenic
1123576726 15:21676838-21676860 CCGGCTCATCTCATTGGGACTGG - Intergenic
1123613348 15:22119306-22119328 CCGGCTCATCTCATTGGGACTGG - Intergenic
1124084111 15:26531149-26531171 CTGGTTCATCTCATTGGGACTGG + Intergenic
1124666610 15:31598301-31598323 CAGGTTCATCTCATTGGGACTGG + Intronic
1124724725 15:32145939-32145961 CTGGTTCATCTCATTGGGACTGG - Intronic
1124885658 15:33683609-33683631 CTGGTTCATCTCACTGGGACTGG + Intronic
1124917987 15:33995806-33995828 CTGGTTCATCTCATTCGGACTGG + Intronic
1124935455 15:34166061-34166083 CTGGTTCATCTCACTGGGACTGG + Intronic
1124948462 15:34293032-34293054 CTGGTTCATCTCATTGGGACTGG - Intronic
1125330095 15:38573910-38573932 CTGGCTCATCTCATTGGGACTGG - Intergenic
1125375175 15:39021086-39021108 CTGCCTCATCTCTCTGGGATAGG + Intergenic
1125685890 15:41563032-41563054 CTGGCTCCTTTCCTTGGGAGGGG - Intronic
1125779554 15:42252265-42252287 CTGGCTCATCTCACTGGGAATGG - Intronic
1125784200 15:42301160-42301182 CTGACTCATCTCATTGGGACTGG + Intronic
1125837316 15:42764231-42764253 CTGGTTCATCTCACTGGGACTGG + Intronic
1126071168 15:44865885-44865907 CTAGTTCATCTCATTGGGAATGG + Intergenic
1126087102 15:45021104-45021126 CTGGTTCATCTCATTGGGACTGG - Intergenic
1126476268 15:49068651-49068673 CTGGTTCATCTCATTGGAACTGG + Intergenic
1126500667 15:49340462-49340484 CTGGTTCATCTCATTGGGACTGG - Intronic
1126520972 15:49593203-49593225 CTGCTTCATCTCATTGGGACTGG - Intronic
1126553986 15:49965919-49965941 CTGGCTAATCTCATTGGGACTGG + Intronic
1126742019 15:51786952-51786974 CTGGTTCATCTCACTGGGACTGG + Intronic
1126862662 15:52902362-52902384 CTGGTTCATCTCATTGAGACTGG + Intergenic
1127137959 15:55944112-55944134 CTGGTTCATCTCATTTGGACTGG + Intronic
1127157952 15:56149502-56149524 CTGGTTCATCTCACTGGGACTGG + Intronic
1127253930 15:57271607-57271629 CTGGTTCATCTAATTGGGACTGG - Intronic
1127255415 15:57287426-57287448 CTGGCTCATCATTTTGGGACAGG - Exonic
1127373632 15:58362697-58362719 CTGGCTCATCTCACTGAGACTGG + Intronic
1127452597 15:59131428-59131450 CTGGTTCATCTCATTGGGACTGG + Intergenic
1127525076 15:59784701-59784723 CTGGTTCATCTCATTGGGACTGG - Intergenic
1127688918 15:61375809-61375831 CTGGCCCCTCTCCATGGGATAGG + Intergenic
1128339894 15:66814017-66814039 CTGGTTCATCTCATTGGGACTGG - Intergenic
1129126672 15:73447792-73447814 CTGGTTCATCTCATTGGGACTGG + Intronic
1129499250 15:76019685-76019707 CTGGCTTATCTCATTGGGATGGG - Intronic
1129563107 15:76592620-76592642 CTGGCTCATCTCACTGGGACTGG + Intronic
1129578445 15:76780005-76780027 CTGGTTCATCTCATTGTGACTGG + Intronic
1130152122 15:81319192-81319214 CTACCTCATCTGGTTGGGTTTGG - Intronic
1130441828 15:83962816-83962838 CTGGCTCATCTCATTGGGACTGG + Intronic
1130577206 15:85103404-85103426 GTGGCTCACCTGGGTGGGATGGG - Intronic
1130703725 15:86211858-86211880 CTGGTTCATCTCATTGGGACTGG - Intronic
1130800947 15:87262594-87262616 CTGGTTCATCTCATTGGGACTGG - Intergenic
1131589327 15:93731227-93731249 CTGGTTCATCTCATTGGGACTGG - Intergenic
1131937549 15:97523121-97523143 CTGGCTCTTCTTGCTGGGAAGGG - Intergenic
1132442974 15:101886575-101886597 CTGGTTCATCTCACTGGGACTGG - Intergenic
1202985594 15_KI270727v1_random:411083-411105 CCGGCTCATCTCATTGGGACTGG - Intergenic
1133018743 16:2956640-2956662 CAGGCTTATTTCGGTGGGATGGG - Intergenic
1133619912 16:7516371-7516393 ATGGCTCATCTCGTAGCGACTGG + Intronic
1134051907 16:11143256-11143278 CTGGCTGGTCTAGTAGGGATGGG + Intronic
1134652080 16:15917550-15917572 CTGGTTCATCTCACTGGGACTGG + Intergenic
1135807466 16:25555940-25555962 CTGGCTTATCTCATTGGGACTGG + Intergenic
1135897284 16:26419339-26419361 CTGGCTCATCTCACTGGGACTGG + Intergenic
1136731516 16:32417820-32417842 CTGGTTCATCTCATTGGGACTGG - Intergenic
1137446178 16:48533966-48533988 CTGGCTCATCTCAGTGGTCTTGG + Intergenic
1137461561 16:48668659-48668681 CTGGTTCATCTCACTGGGACTGG - Intergenic
1137471013 16:48758786-48758808 CTGGTTCATCTCACTGGGACTGG + Intergenic
1137828033 16:51516729-51516751 CTGGCTTATCTCACTGGGACTGG + Intergenic
1137891003 16:52161793-52161815 CTGGTTCATCTCATTGGGACTGG - Intergenic
1137970083 16:52975912-52975934 CTGGCTCATCTCATTGGGACTGG - Intergenic
1138151459 16:54661461-54661483 CTGGTTCATCTCACTGGGACTGG + Intergenic
1138260321 16:55615542-55615564 CTGGTTCATCTCACTGGGATTGG + Intergenic
1138886820 16:61090567-61090589 CTGGCTCATCTCATTGGGACTGG + Intergenic
1139178290 16:64715724-64715746 CTGGCTCATGTTGTTGATATGGG + Intergenic
1140165143 16:72543305-72543327 CTGGCTCATCTCACTGGGACTGG + Intergenic
1142311250 16:89315296-89315318 CTTCCTCATCTCGTGGGGTTGGG - Intronic
1202994875 16_KI270728v1_random:99450-99472 CTGGTTAATCTCATTGGGACTGG + Intergenic
1203021562 16_KI270728v1_random:411792-411814 CTGGTTAATCTCATTGGGACTGG + Intergenic
1142896748 17:2984719-2984741 CTGGCACATCTGGATGGGAGTGG + Intronic
1142937036 17:3343275-3343297 CTGGTTCATCTCATTGGAACTGG - Intergenic
1143998258 17:11027888-11027910 CTGGCTCACCTCGTTGACCTGGG - Intergenic
1144293973 17:13855591-13855613 CTGGTTCATCTCACTGGGACTGG + Intergenic
1144371693 17:14597584-14597606 CTGGTTCATCTCACTGGGACTGG + Intergenic
1145738285 17:27249308-27249330 CTGGTTCATCTCATTGGGACTGG + Intergenic
1145861164 17:28211660-28211682 CTGATTCATCTCATTGGGACTGG + Intergenic
1146145544 17:30412897-30412919 CTGGTTCATCTCATTGGGACTGG - Intronic
1146742733 17:35300949-35300971 ATGGCTCATCTCACTGGGACTGG + Intergenic
1146746427 17:35334266-35334288 CTGGCTCATCTCACTGGGACTGG - Intergenic
1148403350 17:47386980-47387002 CCTGCTCATCTCATTGGGACTGG - Intronic
1149191985 17:54073443-54073465 CCGGTTCATCTCATTGGGATGGG - Intergenic
1149192917 17:54085744-54085766 CTGGTTCATCTCATTGAGACTGG + Intergenic
1149225576 17:54465947-54465969 GTGGTTCATCTCATTGGGATTGG - Intergenic
1149886256 17:60342942-60342964 CTGGTTCATCTCATTGGGACTGG - Intronic
1149932104 17:60767213-60767235 CTGGTTCATCTGGTTGGGACTGG - Intronic
1150025794 17:61673148-61673170 CTGGTTCATCTCATTTGGACTGG + Intergenic
1150094055 17:62357049-62357071 CTGGTTCATCTCATTGGGACTGG + Intergenic
1150492488 17:65584056-65584078 CAGCCTCATCTGGTTGGAATAGG - Intronic
1150594988 17:66595993-66596015 CTGGCTCATCCTGTAGGGATGGG + Intronic
1151064287 17:71132335-71132357 CCGGCTCATCTCACTGGGACTGG - Intergenic
1152445378 17:80339783-80339805 CTGGCTCACCTGGCAGGGATGGG + Exonic
1153059467 18:980435-980457 CCAGCTCATCTCATTGGGACTGG - Intergenic
1153419354 18:4886535-4886557 CTGGTTCATCTCATTGGGACTGG - Intergenic
1153441240 18:5122098-5122120 TTGGTTCATCTCATTGGGACTGG + Intergenic
1153562335 18:6383651-6383673 CCAGTTCATCTCATTGGGATTGG - Intronic
1153702516 18:7711131-7711153 CCGGCTCATCTCATTGGGACTGG + Intronic
1153941617 18:9983155-9983177 CTGGTTCATCTCCTTGGGACTGG - Intergenic
1154288634 18:13084642-13084664 CTGGTTCATCTCACTGGGACTGG - Intronic
1155006600 18:21735186-21735208 CTGGTTCATCTCACTGGGACTGG + Intronic
1155114130 18:22748409-22748431 CTGGTTCATCTCACTGGGACTGG + Intergenic
1155659342 18:28229015-28229037 CTGGTTCATCTCATTGGGACTGG - Intergenic
1155665270 18:28299856-28299878 CTGGTTCATCTCATTGGGACTGG - Intergenic
1156443905 18:37219846-37219868 CTGGTTCATCTCATTGGGACTGG - Intronic
1156626960 18:38920594-38920616 CTGGCTCATCTCACTGGGACTGG - Intergenic
1156908400 18:42381768-42381790 CTGGTTCATCTCAATGGGACTGG - Intergenic
1157036702 18:43984084-43984106 CTGGTTCATCTCACTGGGACTGG + Intergenic
1157058303 18:44256315-44256337 CTGGTTCATCTCATTGGGACTGG - Intergenic
1157066651 18:44357544-44357566 CTGGTTCATCTCACTGGGACTGG - Intergenic
1157067387 18:44367292-44367314 CCAGCTCATCTCATTGGGACTGG - Intergenic
1157178961 18:45478325-45478347 CCAGCTCATCTCATTGGGACTGG - Intronic
1157561423 18:48649080-48649102 CTGGTTCATCTCACTGGGACTGG + Intronic
1157780604 18:50435353-50435375 CTGGCTCATCTCATTGGGACTGG + Intergenic
1158145772 18:54310105-54310127 CTGGTTCATCTCACTGGGACTGG - Intronic
1158703654 18:59771458-59771480 CTGGTTCATCTCAATGGGACTGG + Intergenic
1158853277 18:61517386-61517408 CCGGCTCATCTCAATGGGAGTGG + Intronic
1159386061 18:67726368-67726390 CTAGTTCATCTCCGTGGGATTGG - Intergenic
1159581230 18:70236519-70236541 CCAGCTCATCTCATTGGGACTGG + Intergenic
1159901677 18:74053052-74053074 CGGGTTCATCTCATTGGGACTGG + Intergenic
1160295947 18:77637215-77637237 CTGGTTCATCTCACTGGGACTGG + Intergenic
1160641958 19:146573-146595 CTGGTTCATCTCACTGGGACTGG + Intergenic
1163380185 19:16961139-16961161 CTGGTTCATCTCATTGGGACTGG + Intronic
1163939961 19:20482541-20482563 CTGGTTCATCTCATTGGGACTGG + Intergenic
1164085683 19:21899974-21899996 CTGGTTCATCTCATTGGGACTGG - Intergenic
1164090933 19:21951773-21951795 ATGGCTCATCTCACTGGGACTGG + Intronic
1164110065 19:22148468-22148490 CTGGCTGATCTCATTTGGACTGG + Intergenic
1164394758 19:27852797-27852819 CTGGTTCATCTCATTGGTACTGG + Intergenic
1164406292 19:27949705-27949727 CTGGTTCATCTCATTGGCACTGG - Intergenic
1165003811 19:32787955-32787977 CTGGTTCATCTCACTGGGACTGG - Intronic
1165254677 19:34568557-34568579 CTGGCTCATTTCATTGGGACTGG - Intergenic
1165269805 19:34696474-34696496 CTTGTTCATCTCATTGGGACTGG + Intergenic
1165973000 19:39649310-39649332 CTGGTTCATCTCATTGGGACTGG + Intergenic
1166163734 19:40971486-40971508 CTGGTTCATCTCACTGGGACTGG - Intergenic
1166263099 19:41656838-41656860 CCAGCTCATCTCATTGGGACTGG + Intronic
1168170590 19:54585811-54585833 CTGGTTTATCTCATTGGGACTGG - Intronic
1168457597 19:56526165-56526187 CTGGCTCATCTCATTGGGACTGG + Exonic
925692247 2:6537464-6537486 CTGGCTCATCTCATTGGGACTGG + Intergenic
926074787 2:9933177-9933199 CTGGTTCATCTCACTGGGACTGG - Intronic
926366640 2:12139495-12139517 CTGGTTCATCTCACTGGGACAGG - Intergenic
926533448 2:14081915-14081937 TAGGCTCATCTCATTGGGACTGG + Intergenic
926648521 2:15316347-15316369 CTGGTTCATCTCACTGGGACTGG + Intronic
926941799 2:18145169-18145191 CTGGTTCATCTCATTGGGACTGG - Intronic
926970689 2:18464210-18464232 CTGGCTCATCTCACTGGGACTGG - Intergenic
927027889 2:19089361-19089383 CTGGTTCATCTCACTGGGACTGG + Intergenic
927221170 2:20711512-20711534 CTGGTTCATCTCATTGGGACTGG + Intronic
927286160 2:21359092-21359114 CTGGCTCACCTGGCTGGTATGGG - Intergenic
928481067 2:31684050-31684072 CTGGTTCATCTCATTGGAACTGG - Intergenic
928576806 2:32663508-32663530 CAGGCTCATCTCACTGGGACTGG - Intronic
928750554 2:34466316-34466338 CTGGCTCATCTCATTGGGACTGG + Intergenic
928900834 2:36315892-36315914 CAGGTTCATCTCATTGGGACTGG - Intergenic
929025790 2:37600210-37600232 CTGGTTCATCTCATTGAGACTGG - Intergenic
929063001 2:37942243-37942265 CTGGTGCATCTCATTGGGACAGG - Intronic
929837924 2:45425615-45425637 CTGGCTCATCTCATTGGGACTGG + Intronic
930143109 2:47973622-47973644 CTGGTTCATCTCACTGGGACTGG + Intergenic
930217056 2:48708044-48708066 CTGGTTCATCTCATTGGGACTGG - Intronic
930269026 2:49233680-49233702 CGGGTTCATCTCATTGGGACTGG - Intergenic
930274768 2:49298568-49298590 CTGGTTCATCTCACTGGGACTGG + Intergenic
930359233 2:50357878-50357900 CTGGTTCATCTCACTGGGACTGG + Intronic
930803007 2:55462260-55462282 CTGGTTCATCTCATTGGGACTGG + Intergenic
930860428 2:56065890-56065912 CTGGTTCATCTCACTGGGAATGG - Intergenic
931004009 2:57827721-57827743 CTGGCTCTTCTCACTGGGACTGG + Intergenic
931030306 2:58168249-58168271 CCGGCTCACCTCATTGGGACTGG + Intronic
931204717 2:60136224-60136246 CTGGTTCATCTCACTGGGACTGG - Intergenic
931305118 2:61021144-61021166 CTGGTTCATCTCACTGGGACTGG + Intronic
931479231 2:62622616-62622638 CCGGCTCATCTCATCGGGACTGG - Intergenic
931480292 2:62633086-62633108 CCGGCTCATCTCACTGGGACTGG + Intergenic
931566339 2:63619821-63619843 CCAGCTCATCTCATTGGGACTGG + Intronic
931594451 2:63926611-63926633 CTGGTTCATCTCATTGGGACTGG + Intronic
931814746 2:65889784-65889806 CTGGCTCATCTCATTGGGACTGG + Intergenic
931885807 2:66615644-66615666 CTGGTTCATCTCACTGGGACTGG - Intergenic
931986231 2:67744984-67745006 CTGGTTCATCTCACTGGGACTGG - Intergenic
932323894 2:70842297-70842319 CTGGTTCATCTCATTGGGACTGG + Intergenic
932327963 2:70876000-70876022 CTGGTACATCTCATTGGGACTGG + Intergenic
932377608 2:71251440-71251462 CTGGTTCATCTCAATGGGACTGG - Intergenic
932511906 2:72300870-72300892 CCGGTTCATCTCATTGGGACTGG - Intronic
932539917 2:72641189-72641211 CTGGTTCATCTAATTGGGACTGG + Intronic
932868754 2:75374919-75374941 CCGGTTCATCTCATTGGGACTGG - Intergenic
933366782 2:81362984-81363006 CTGGTTCATCTCACTGGGACTGG - Intergenic
933488379 2:82950865-82950887 CCGGCTCATCTCATTGGGACTGG - Intergenic
933880375 2:86663783-86663805 CTGGTTCATCTCACTGGGACTGG + Intronic
934052480 2:88222104-88222126 CTGGCTCACTTTGTTGGAATGGG - Intergenic
934531548 2:95092842-95092864 CTGGTTCATCTCACTGGGACTGG + Intronic
934617024 2:95778571-95778593 CTGGTTCATCTCACTGGGACTGG + Intergenic
934643869 2:96045988-96046010 CTGGTTCATCTCACTGGGACTGG - Intergenic
935273987 2:101460261-101460283 CTGGTTCATCTTGTTGGGACTGG - Intronic
935325740 2:101935468-101935490 CTGGCTCATCTCATTAGGACTGG + Intergenic
935399346 2:102644130-102644152 CCGGGTCATCTCATTGGGACTGG + Intronic
935565900 2:104607437-104607459 CTGGTTCATCTCATTAGGACTGG + Intergenic
935961398 2:108429244-108429266 CCAGCTCATCTCATTGGGACTGG + Intergenic
936142582 2:109953055-109953077 ATGGTTCATCTCATTGGGACTGG + Intergenic
936179270 2:110251020-110251042 ATGGTTCATCTCATTGGGACTGG + Intergenic
936202106 2:110418412-110418434 ATGGTTCATCTCATTGGGACTGG - Intronic
936775396 2:115966035-115966057 CTGGTTCATTTCATTGGGACTGG - Intergenic
936807812 2:116358534-116358556 CTGGCTCATCTCACTGGGACTGG + Intergenic
936909830 2:117579335-117579357 CTGGTTCATCTCATTGGGACTGG + Intergenic
937000066 2:118457623-118457645 CTGGCTGATCTCACTGGGACTGG - Intergenic
937465113 2:122125488-122125510 CTGGTTCATCTCACTGGGACTGG - Intergenic
937514717 2:122640419-122640441 CTGGCTCAGCTAGCAGGGATTGG + Intergenic
937573426 2:123391473-123391495 ATGGTTCATCTCATTGGGATTGG + Intergenic
937893206 2:126956386-126956408 CCAGCTCATCTCATTGGGACTGG + Intergenic
938144649 2:128823488-128823510 CCGGCTCATCTCACTGGGACTGG + Intergenic
938168185 2:129050705-129050727 CTGGTTCATCTCACTGGGACTGG - Intergenic
938224366 2:129602923-129602945 CTGGTTCATCTCATTGGGACTGG - Intergenic
938559432 2:132458149-132458171 CTGGTTCATCTCATTGGGACTGG - Intronic
938874520 2:135518598-135518620 TTGGCTCATCTCATTGAGACTGG - Intronic
939019985 2:136947002-136947024 CTGGTTCATCTCACTGGGACTGG - Intronic
939055502 2:137360341-137360363 CTGGTTCATCTCATTGGGACTGG + Intronic
939116987 2:138071580-138071602 CTGGCTCATCTCACTGGGACTGG - Intergenic
939180297 2:138795748-138795770 CTGGTTCATCTCACTGGGACTGG + Intergenic
939188394 2:138887021-138887043 CCGGCTCATTTTGTTGGCATGGG - Intergenic
939382129 2:141448738-141448760 CTGGCTGATCTCACTGGGAGTGG - Intronic
939687242 2:145214155-145214177 CTGGCTCATCTCAATGGGACTGG - Intergenic
939840522 2:147182314-147182336 CCGGTTCATCTCATTGGGACTGG + Intergenic
940370464 2:152895677-152895699 CCAGCTCATCTCATTGGGACTGG + Intergenic
940408175 2:153329145-153329167 CCGGTTCATCTCATTGGGACTGG - Intergenic
940528294 2:154844968-154844990 CTGGTTCATCTCATTGGGACTGG - Intronic
940720802 2:157279836-157279858 CTGGTTCATCTCATTGAGAGTGG - Intronic
940757849 2:157704277-157704299 CAAGCTCATCTCATTGGGACTGG + Intergenic
940821314 2:158359481-158359503 CTGGCTCATCTCATTGGGACTGG + Intronic
940925078 2:159355788-159355810 TTGGCTCATCTCATCGGGACTGG + Intronic
940995792 2:160148574-160148596 CTGCTTCATCTCATTGGGACTGG + Intronic
941076284 2:161010097-161010119 CTGGTTCATCTCATTGGGACTGG + Intergenic
941565445 2:167099848-167099870 CTGGTTCATTTCATTGGGACTGG - Intronic
941681457 2:168403802-168403824 CTGGGTCACCTCGTTGGTAATGG - Intergenic
941682430 2:168413385-168413407 CCAGCTCATCTCATTGGGACTGG - Intergenic
941845201 2:170125700-170125722 CTGATTCATCTCATTGGGACTGG + Intergenic
942010960 2:171761875-171761897 CTGGTTCATCTCACTGGGACTGG - Intergenic
942199813 2:173559712-173559734 CTGGCTCATCTCATTGGGACTGG + Intergenic
942434585 2:175957683-175957705 CTGGTTCATCTCACTGGGACTGG + Intronic
942668841 2:178352212-178352234 GTGGTTCATCTCATTGGGACTGG + Intronic
942732505 2:179075700-179075722 CTAGCTCATCTCCCTGGGACTGG + Intergenic
942744064 2:179212122-179212144 CTGGTTCATCTCACTGGGACTGG + Intronic
942779873 2:179629642-179629664 CTGGTTCATCTCATTGGGACTGG + Intronic
942873532 2:180765200-180765222 CTGGTTCATCTCATTGAGACTGG + Intergenic
942898664 2:181089020-181089042 CAGGTTCATCTCATTGGGACTGG + Intergenic
942951987 2:181731748-181731770 CTGGTTCATCTCACTGGGACTGG + Intergenic
943038521 2:182774878-182774900 CTGGTTCTTCTCATTGGGACTGG - Intronic
943106052 2:183546369-183546391 CTAGCTAATCTAGTGGGGATGGG - Intergenic
943112436 2:183622294-183622316 CTGGCTCATCTCACTGGGACTGG - Intergenic
943233563 2:185289944-185289966 CTAGCTCATCTCACTGGGACTGG + Intergenic
943408865 2:187520487-187520509 CTGGCTCATCTCATCGGGACTGG - Intronic
943409701 2:187532379-187532401 CCAGCTCATCTCATTGGGACTGG + Intronic
943512229 2:188840417-188840439 CTGGCTCATCTCACTGGGAATGG + Intergenic
943710742 2:191092671-191092693 CTGGTTCATCTCATTGGGACTGG + Intronic
943716732 2:191160669-191160691 CAGGTTCATCTCATTGGGACTGG + Intergenic
944033929 2:195269725-195269747 CTGGTTCATCTCACTGGGACTGG - Intergenic
944165133 2:196710520-196710542 CTGGTTCATCTCATTGGGACTGG - Intronic
944291942 2:198018031-198018053 CCGGTTCATCTCACTGGGATTGG + Intronic
944393639 2:199245612-199245634 CTGGTTCATCTCATTGGGACTGG - Intergenic
944607829 2:201369407-201369429 CTGGTTCATCTCATTGGGACTGG + Intergenic
944916205 2:204363168-204363190 CTGGCTCACATTGTTGGCATAGG + Intergenic
945161925 2:206900249-206900271 CTGGTTCATCTCATTGGGACTGG - Intergenic
945207138 2:207344260-207344282 CCGGCTCATCTCACTGGGACTGG + Intergenic
945329817 2:208525866-208525888 CTGGCTCATCTCATTGGGACTGG - Intronic
945486996 2:210407536-210407558 CCGGTTCATCTCATTGGGACTGG - Intergenic
945628334 2:212238418-212238440 CTGGCTCATCTCACTGGGACTGG - Intronic
945716157 2:213359792-213359814 CTGGTTCATCCCATTGGGAGTGG - Intronic
945776743 2:214114824-214114846 CTGGTTCATCTCACTGGGACTGG - Intronic
945788890 2:214278334-214278356 CTGGTTCATCTCACTGGGACTGG - Intronic
945927319 2:215819121-215819143 CTGGTTCATCTCATTGGGACCGG + Intergenic
945945117 2:215988194-215988216 CTGGCTTATCTCATTGGGACTGG + Intronic
946294522 2:218773271-218773293 CTGGTTCATCTCATTGGGACTGG - Intergenic
946787170 2:223259435-223259457 CTGGTTCATCTCATTGGGACTGG - Intergenic
946790306 2:223293964-223293986 CCAGCTCATCTCATTGAGATTGG - Intergenic
946794018 2:223330609-223330631 CTGGTTCATCTCATTGGGACTGG + Intergenic
946912895 2:224484932-224484954 CTGGTTCATCTCAATGGGACTGG + Intronic
947085958 2:226453725-226453747 CCGGCTCATCTCGTTGGGACTGG + Intergenic
947103912 2:226648790-226648812 CTGGCTAATCTAGTGGGGAGGGG + Intergenic
947275889 2:228391263-228391285 CTGGTTTATCTCATTGGGACTGG - Intergenic
947364586 2:229381072-229381094 CTGGCTCATCTCATTGAGACTGG + Intronic
947440642 2:230118136-230118158 CTGGTTCATCTCATTGGGACTGG - Intergenic
947483527 2:230525537-230525559 CTGGTTCATCTCATTGGGACTGG + Intronic
947492032 2:230603444-230603466 CTGGCTCATCTCATTGGGACTGG + Intergenic
947493948 2:230619357-230619379 CTGGTTCATCTCACTGGGACTGG + Intergenic
947681514 2:232037876-232037898 CTGGTTCATCTCACTGGGACTGG - Intronic
947902908 2:233737575-233737597 CTGGTTCATCTCATTGGGACTGG - Intronic
949059734 2:241949832-241949854 CTGGCTCCTCTCGGGGGGACAGG - Intergenic
1169320147 20:4625663-4625685 CTGGCTCATCTCACTGGGACTGG - Intergenic
1169795780 20:9461382-9461404 CTGGTTCATCTCATTGGAACTGG + Intronic
1170167992 20:13381414-13381436 CTGGCTTATCTCATTGGGACTGG - Intergenic
1170186131 20:13593332-13593354 CTGGTTCATCTCACTGGGACTGG + Intronic
1170229487 20:14028750-14028772 CTGGCTCATCTCACTGGGACTGG - Intronic
1170266485 20:14471264-14471286 CTGGCTCATCTCATTGGGACTGG - Intronic
1170454509 20:16519819-16519841 CTGGCTCATCTCACTGGGACTGG + Intronic
1171050445 20:21853537-21853559 CTGGTTCATCTCACTGGGACTGG + Intergenic
1171081784 20:22194230-22194252 CTGGTTCATCTCATTGGGACTGG + Intergenic
1171194351 20:23185928-23185950 CTGGTTCATCTCATTGGGACTGG - Intergenic
1171247244 20:23621352-23621374 CTGGTTCATCTCATTGGGACTGG - Intergenic
1171273591 20:23835555-23835577 ATGGTTCATCTCATTGGGACTGG + Intergenic
1171441301 20:25165735-25165757 CCAGCTCATCTCATTGGGACTGG + Intergenic
1171443574 20:25186870-25186892 CTGGTTCTTCTCATTGGGACTGG - Intergenic
1173751253 20:45478502-45478524 GTGGCTCATCTCATTGGGACTGG - Intronic
1173771855 20:45666441-45666463 CTGGTTCATCTCACTGGGACTGG - Intronic
1174224127 20:48983014-48983036 CTGGTTCATCTCACTGGGACTGG - Intronic
1174990234 20:55500894-55500916 CTGGTTCATCTCATTGGGACTGG - Intergenic
1175219454 20:57408679-57408701 CAGGATCCTCTCGGTGGGATGGG + Exonic
1176884808 21:14243012-14243034 CTGGCTCATGTTGTTGGTGTGGG + Intergenic
1176928403 21:14779000-14779022 CTGGTTCATCTCACTGGGACTGG + Intergenic
1177111453 21:17034234-17034256 CTGGTTCATCTCATTGGGACTGG + Intergenic
1177136287 21:17308400-17308422 ATGGCTCATCTCATTAGGACTGG + Intergenic
1177425802 21:20921879-20921901 CCGGCTCATCTCTTTGGGACTGG + Intergenic
1178393472 21:32219276-32219298 CCGGTTCATCTCCTTGGGACTGG + Intergenic
1179175232 21:39003264-39003286 CTGGCCCAGCTGGTTGGGACTGG - Intergenic
1180306500 22:11131050-11131072 CTGGTTCATCTCACTGAGATGGG + Intergenic
1180540958 22:16447320-16447342 CTGGTTCATCTCATTGGGACTGG + Intergenic
1180545019 22:16493233-16493255 CTGGTTCATCTCACTGAGATGGG + Intergenic
1180596143 22:16974811-16974833 CTGGCTCATCTCACTGGGACTGG + Intronic
949173968 3:1035470-1035492 CTGGTTCATCTCACTGGGACTGG - Intergenic
949423606 3:3891948-3891970 CCAGCTCATCTCATTGGGACTGG - Intronic
949440091 3:4071273-4071295 CTGGTTCATCTCATTGAGACTGG + Intronic
949449981 3:4174660-4174682 CTGGTTCATCTCATTGGGACTGG + Intronic
949456682 3:4246278-4246300 CTGGTTCATCTCATTGGGTCTGG - Intronic
949579787 3:5376630-5376652 CTGGTTCATCTCATTGGGACTGG + Intergenic
949580691 3:5384580-5384602 CTAGCTCATCTCATTGGGACTGG - Intergenic
949583269 3:5412320-5412342 CCGGATCATCTCTTTGGGACTGG + Intergenic
949632624 3:5944593-5944615 CTGGTTCATCTCATTGAGACTGG - Intergenic
949801293 3:7906677-7906699 CTGGCTCATCTCATTGGGACTGG - Intergenic
950299932 3:11868015-11868037 CTGGTTCATCTCATGGGGACTGG - Intergenic
950562073 3:13736726-13736748 CTGGTTCATCTCATTGGAACTGG - Intergenic
950903723 3:16518661-16518683 CTGGCTCCTATAGTTGGGAGGGG + Intergenic
951006271 3:17618919-17618941 CTGGTTCATCTCACTGGGACTGG - Intronic
951012108 3:17693208-17693230 CTGGTTCATCTCATTGGGACTGG + Intronic
951254590 3:20433455-20433477 CCGGCTCATCTCACTGGGACAGG - Intergenic
951439570 3:22707397-22707419 CTGGTTCATCTCATTAGGACTGG - Intergenic
951617695 3:24566838-24566860 CTGGTTTATCTCATTGGGAATGG + Intergenic
951629205 3:24699810-24699832 CTGGATCGTCTCATTGGGACTGG - Intergenic
951676530 3:25247662-25247684 CTGGTTCATGTCATTGGGATTGG - Intronic
951687687 3:25362813-25362835 CTGGTTCATCTCACTGGGACTGG - Intronic
951759591 3:26130497-26130519 CTAGTTCATCTCATTGGGACTGG - Intergenic
951777346 3:26324419-26324441 CTGGTTCATCTCATTGGAACTGG - Intergenic
952098691 3:29985689-29985711 CTGGCTCATCTCATTGGGATTGG - Intronic
952136007 3:30420576-30420598 CTGGCTCATTTAGGTGGGACAGG + Intergenic
952517741 3:34122606-34122628 CTGGCTCAACTCATTGGGACTGG - Intergenic
952686947 3:36160978-36161000 TTGGCTCATCTCATTGGGACTGG - Intergenic
952814038 3:37431400-37431422 CTGGTTCATCTCATTGGGACTGG - Intronic
952863944 3:37838911-37838933 CTGGTTCATCTCATTGGGAATGG + Intergenic
953102449 3:39842801-39842823 ATGGTTCATCTCATTGGGACTGG - Intronic
953339904 3:42124653-42124675 CTGATTCATCTTGTTGGGAGAGG - Intronic
953522792 3:43659181-43659203 CTGGTTCATCTCACTGGGACTGG + Intronic
953653167 3:44824030-44824052 CTGGTTCATCTCACTGGGACTGG - Intronic
954501044 3:51014183-51014205 CTGATTCATCTCATTGGGACTGG - Intronic
954513909 3:51153524-51153546 CTGGTTCATCTCATTGGGACTGG - Intronic
954524851 3:51261215-51261237 CCGGCTCATCTCATTGGGACTGG + Intronic
954530971 3:51320119-51320141 CCAGCTCATCTCATTGGGACTGG + Intronic
954836551 3:53473960-53473982 CTGGTTCATCTCATTGGGACTGG - Intergenic
955175200 3:56606622-56606644 CTAGTTCATCTCATTGGGACTGG - Intronic
955361712 3:58281612-58281634 CTGGTTCATCTCACTGGGACTGG - Intronic
955539755 3:59961754-59961776 CTGGCTCATCTCACTGGGACTGG - Intronic
956048394 3:65220747-65220769 CTGGTTCATCTCACTGGGACTGG - Intergenic
956300316 3:67764816-67764838 CTGGCTCATCTCATCGGGACTGG - Intergenic
956355626 3:68389661-68389683 CTGGCTGATCTCATTGGGACTGG + Intronic
956373298 3:68587162-68587184 CTGGTTCATCTCATTGGGACTGG - Intergenic
957011363 3:75009236-75009258 CTGGTTCATCTCATTGGGACTGG - Intergenic
957256706 3:77845717-77845739 CAGGCTCATCTGATTGGGACTGG - Intergenic
957776406 3:84760808-84760830 CTGGCTTATGTCATTGGGACAGG + Intergenic
957786075 3:84885074-84885096 TTGGTTCATCTCATTGGGACTGG + Intergenic
957811647 3:85229473-85229495 CTGGTTCATCTCACTGGGACTGG - Intronic
957917916 3:86709384-86709406 CTGGTTCATCTCACTGGGACTGG - Intergenic
958036941 3:88182047-88182069 CTGGTTCATCTCATTGGGACTGG + Intergenic
958081061 3:88747005-88747027 CTGGTTCATCTCACTGGGACTGG + Intergenic
958191795 3:90193642-90193664 CTGGTTCATCTCATTGGGACTGG - Intergenic
958414016 3:93852778-93852800 CTGGTTCATCTCATTGGGACTGG - Intergenic
958434624 3:94081250-94081272 CCGGTTCATCTCATTGGGACTGG - Intronic
958521007 3:95185075-95185097 CGGGCTCATCTCATTGAGACTGG - Intergenic
958553508 3:95645148-95645170 CTGGTTCATCTCACTGGGACTGG + Intergenic
958586146 3:96090974-96090996 CTGGTTCATCTCATTGGGACTGG + Intergenic
958618432 3:96526765-96526787 CTGGTTCATCTCATTGGGACTGG + Intergenic
958742952 3:98096441-98096463 CTGGTTCATCTCATTGGGACTGG - Intergenic
959045247 3:101466809-101466831 CTGGTTCATCTCACTGGGACTGG + Intronic
959059825 3:101605826-101605848 CTGGTTCATCTCATTGGGACTGG - Intergenic
959097463 3:101971441-101971463 CTGGTTCATCTCACTGGGACTGG - Intergenic
959290754 3:104469860-104469882 CTGGTTCATCTCATTGGGACTGG - Intergenic
959291805 3:104484749-104484771 CGGGCTCATCTCATTGGGAGTGG + Intergenic
959308316 3:104696999-104697021 CTGGTTCATCTCATTAGGACTGG - Intergenic
959534519 3:107470157-107470179 CAGGCTCATCTCACTGGGACTGG + Intergenic
959692869 3:109218693-109218715 CTGGTTCATCTCAATGGGACTGG + Intergenic
959736423 3:109664842-109664864 CTGGTTCATCTCACTGGGACTGG + Intergenic
959842774 3:110998399-110998421 CCGGCTCATCTCATTGGGACTGG + Intergenic
959881297 3:111447456-111447478 CTGGCTCATCTCATTGGGGCTGG - Intronic
960065350 3:113366686-113366708 CTGATTCATCTCATTGGGACTGG + Intronic
960177186 3:114531788-114531810 CTGGCTCATCTCATTGGGACTGG + Intronic
960276856 3:115738510-115738532 CTGGTTCATCTCATTGGGACTGG - Intergenic
960378213 3:116928628-116928650 CTGGCTCATCTCACTGGGGCTGG - Intronic
960478751 3:118162701-118162723 CTGGTTCATCTCATTGGGACTGG + Intergenic
960508050 3:118516832-118516854 CTGGTTCATCTAATTGGGACTGG + Intergenic
960653877 3:119981322-119981344 CTGGTTCATCTCATTGGGAATGG + Intronic
960655880 3:120003871-120003893 CTGGTTCATCTCACTGGGACTGG + Intronic
960787741 3:121392421-121392443 CTGGTTCATCTCATTGGGACTGG - Intronic
960836108 3:121908400-121908422 CTGGCTCATTTCATTGGGACTGG - Intronic
960854782 3:122091927-122091949 CTGGCCCATCCCATGGGGATGGG + Intronic
960911200 3:122651058-122651080 CTGGTTCATCTCATTGGAACTGG + Intergenic
961310487 3:125996350-125996372 CTGGTTCATCTCAATGGGACTGG + Intergenic
961977420 3:131041902-131041924 CTGGTTCATCTCATTGGGACTGG + Intronic
961992001 3:131202220-131202242 CTGGTTCATCTCATTGGGACGGG + Intronic
961998333 3:131269570-131269592 CAAGCTCATCTCATTGGGACTGG - Intronic
962137180 3:132747192-132747214 CTGGTTCATCTCATTGGGACTGG - Intergenic
962157443 3:132963030-132963052 CTGTCTTATCTCGTTGTGGTTGG + Intergenic
962191214 3:133312746-133312768 CTGGTTCATCTCACTGGGACTGG - Intronic
962291409 3:134139977-134139999 CTGGTTCATCTCACTGGGACTGG + Intronic
962513439 3:136126116-136126138 TTGGTTCATCTCATTGGGACTGG + Intronic
962602850 3:137007805-137007827 CTGGTTCATCTCATTGGGACTGG - Intronic
962645067 3:137430603-137430625 CTGGTTCATCTCACTGGGACCGG + Intergenic
962655904 3:137543688-137543710 CTGGTTCATCTCATTGAGACTGG + Intergenic
962766922 3:138574067-138574089 CTGGTTCATCTCGTTGGGACTGG + Intronic
962914149 3:139883460-139883482 CTGGTTCATCTCACTGGGACTGG - Intergenic
963014059 3:140803627-140803649 CAGGCTCATCTCATTGGGAGTGG - Intergenic
963048540 3:141122960-141122982 CTGGTTCATCTCATTTGGACTGG - Intronic
963160031 3:142141387-142141409 CTGGTTCATCTCATTGGGACTGG - Intronic
963531479 3:146477210-146477232 CTGGTTCATCTCATTGGGACTGG + Intronic
963984485 3:151575742-151575764 CTGGTTCATCTCATTGGGACTGG - Intergenic
964049565 3:152373652-152373674 CTGGCTCATCTCTTTGGTACAGG - Intronic
964269972 3:154945259-154945281 CTGGTTCATCTCACTGGGACGGG + Intergenic
964371457 3:156004427-156004449 CCAGCTCATCTCATTGGGACTGG - Intergenic
964391335 3:156201156-156201178 TTGGTTCATCTCATTGGGACTGG - Intronic
964701757 3:159575121-159575143 CTGGTTCATCTCATTGGGACTGG - Intronic
964994967 3:162867900-162867922 CTGGTTCATCTCATTGGGACTGG + Intergenic
965001987 3:162966117-162966139 CTGGTTCATCTCATCGGGACTGG + Intergenic
965221348 3:165931198-165931220 CTGGTTCATCTCATTGGGACTGG + Intergenic
965324678 3:167289417-167289439 CTGGTTCATCTCATTGGGACTGG + Intronic
965880354 3:173381950-173381972 CCAGCTCATCTCATTGGGACTGG + Intergenic
966250988 3:177865524-177865546 CCGGCTCATCTCATTGGGACTGG + Intergenic
966254997 3:177907930-177907952 TTGGCTCATCTCATTGGGACTGG + Intergenic
966291099 3:178360910-178360932 CTGGTTCATCTCACTGGGACTGG + Intergenic
966309312 3:178576145-178576167 CCGGCTCATCTCATTGGGACTGG + Intronic
966477528 3:180367452-180367474 CTGGTTCATCTCATTGGGACTGG + Intergenic
966494083 3:180560024-180560046 CTGGTTCATCTCACTGGGACTGG + Intergenic
966583206 3:181591437-181591459 CTGGTTCATCTCACTGGGACTGG - Intergenic
967199350 3:187058313-187058335 CTGGTTCATATCATTGGGACTGG - Intronic
967638517 3:191834273-191834295 CTGGTTCATCTCAATGGGACTGG + Intergenic
967756816 3:193179486-193179508 CTGGCTCATCTCATTGTGACTGG + Intergenic
968155908 3:196380603-196380625 CTGGTTCATCTCACTGGGACTGG + Intronic
968408668 4:365354-365376 CTGGTTCATCTCATTGGGACTGG - Intronic
968829198 4:2923479-2923501 CTGGCTCATCTCCCTGGGACTGG - Intronic
969909274 4:10428414-10428436 CCGGCTCATCTCACTGGGACTGG - Intergenic
970182778 4:13416862-13416884 ATGGTTCATCTCATTGGGACTGG + Intronic
970496216 4:16628728-16628750 CTGGTTCATCTCACTGGGACTGG + Intronic
970655442 4:18225388-18225410 CTGGTTCATCTCAATGGGACTGG - Intergenic
970685155 4:18559213-18559235 CTGGCTCATCTCATTGGGACTGG + Intergenic
970727090 4:19059950-19059972 CTGGCTCATCTCACTGGGACTGG + Intergenic
970792041 4:19868849-19868871 CTGGTTCATCTCACTGGGACTGG - Intergenic
970917422 4:21352251-21352273 CTGGTTCATATCATTGGGACTGG + Intronic
970975777 4:22041206-22041228 CTGGTTCATCTCATTGGGACTGG - Intergenic
971004449 4:22357599-22357621 CGGGCTCATCTCATTGGGACTGG + Intronic
971437193 4:26640531-26640553 CTGGTTCACCTCATTGGGACAGG + Intronic
971467201 4:26976265-26976287 CTGGTTCATCTCATTGGGACTGG - Intronic
971560702 4:28077061-28077083 CTGGTTCATCTCAATGGGACTGG + Intergenic
971666488 4:29493421-29493443 CTGGGTTATCTAGGTGGGATGGG + Intergenic
971697799 4:29929415-29929437 CTGGCTCATCTCACTGGGACTGG + Intergenic
972260935 4:37407832-37407854 CTGGTTGATCTCATTGGGACTGG + Intronic
972685553 4:41349559-41349581 CTGGTTCATCTCACTGGGACTGG + Intergenic
972755467 4:42041858-42041880 CTGGCTCATCTCATTGGGACTGG + Intronic
972962651 4:44473511-44473533 CTGGCTCATCTCATTGGGACTGG + Intergenic
973137659 4:46727745-46727767 CTGGTTCATCTCAATGGGACTGG - Intergenic
973237700 4:47923058-47923080 CTGGTTCATCTCGTTGGGACTGG - Intronic
973341891 4:49013510-49013532 CTGGTTCATCTCATTGGAACTGG - Intronic
973598933 4:52521975-52521997 CTGGTTCATCTCACTGGGACTGG + Intergenic
973660811 4:53104986-53105008 CTGCCTCATGTCATTGGGAGTGG + Intronic
973798298 4:54450998-54451020 CTGGTTCATCTCACTGGGACTGG + Intergenic
973799063 4:54458874-54458896 CTGGCTCATCTCATTGGGACTGG + Intergenic
973835706 4:54807172-54807194 CTGGTTCATCTCATTGGGCCTGG + Intergenic
974044249 4:56884417-56884439 CTGGTTCATCTCATTGGGACTGG + Intergenic
974106335 4:57473233-57473255 CTGGTTCATCTCACTGGGACTGG - Intergenic
974127471 4:57714214-57714236 CTGGTTCATCTCACTGGGACTGG + Intergenic
974176483 4:58332382-58332404 CTGGTTCATCTCATTGGCAATGG + Intergenic
974251869 4:59394844-59394866 ACGGTTCATCTCGTTGGGACTGG - Intergenic
974264069 4:59560946-59560968 CTGGTTCATCTCAGTGGGACTGG - Intergenic
974294887 4:59985236-59985258 CTGGCTCATCTTGCTGGTGTGGG + Intergenic
974307236 4:60157388-60157410 TTGGTTCATCTCATTGGGACTGG + Intergenic
974491727 4:62572257-62572279 CTGGTTCATCTCACTGGGACTGG - Intergenic
974528569 4:63077379-63077401 ATGGTTCATCTCATTGGGACTGG - Intergenic
974719824 4:65724776-65724798 CTGGTTCATCTCAATGGGACAGG + Intergenic
974838052 4:67274221-67274243 CTGGTTCATCTCATTTGGACTGG - Intergenic
974954669 4:68622695-68622717 CTGGTTCATCTCACTGGGACTGG - Intronic
975064358 4:70041926-70041948 CTGGTTCATCTCACTGGGACTGG - Intergenic
975096555 4:70464049-70464071 CTGGCTCATCTCATTGGGACTGG + Intronic
975219498 4:71797688-71797710 CTGGTTCATCTCATTGGGACTGG - Intronic
975247985 4:72142448-72142470 CTGGTTCATCTCACTGGGACTGG - Intronic
975307514 4:72866601-72866623 CTGGTTCATCTCACTGGGACTGG + Intergenic
975425058 4:74215537-74215559 TTGGCTCATCTCATTGGGACTGG - Intronic
975432742 4:74314259-74314281 ATGCCTCATCTCCTTGGGAGAGG - Intronic
975449266 4:74505425-74505447 CTGGTTCATCTCATTGGGACTGG + Intergenic
975484260 4:74916533-74916555 CTGGCTCATCTCATTGGGATTGG - Intergenic
975500607 4:75080273-75080295 CTGGTTCATCTCATTGGGACTGG - Intergenic
975521042 4:75301006-75301028 CTGGTTCATCTCATTGGTACTGG - Intergenic
975528690 4:75378327-75378349 CAGGTTCATCTCATTGGGACTGG + Intergenic
975533151 4:75421274-75421296 CTGGCTCATCTCACTGGGACTGG - Intergenic
975638690 4:76477775-76477797 CCAGCTCATCTCATTGGGACTGG + Intronic
975744690 4:77464620-77464642 CTGGTTCACCTCATTGGGACTGG - Intergenic
975751153 4:77524738-77524760 CTGGTTCATCTCACTGGGACTGG - Intronic
975844076 4:78506768-78506790 CTGGTTCATCTCACTGGGACTGG - Intronic
976006703 4:80439347-80439369 CAAGCTCATCTCATTGGGACTGG + Intronic
976024992 4:80676058-80676080 ATGGTTCATCTCATTGGGACTGG - Intronic
976159524 4:82184214-82184236 CTGGTTCATCTCACTGGGACTGG + Intergenic
976167511 4:82271574-82271596 CTGGTTCATCTCATTGGGACTGG + Intergenic
976362974 4:84202425-84202447 CTGGTTCATCTCACTGGGACTGG + Intergenic
976370717 4:84285733-84285755 CTGGCTCATCTCATTGGGACTGG + Intergenic
976394814 4:84544752-84544774 CTGGCTCATCTCTTTGGGACTGG + Intergenic
976439187 4:85054600-85054622 CTGGCTCATCTCACTGGGACTGG + Intergenic
976446068 4:85130458-85130480 CCAGCTCATCTCATTGGGACTGG - Intergenic
976449184 4:85166851-85166873 CTGGTTCATCTCATTGGGACTGG - Intergenic
976506520 4:85853494-85853516 CTGGTTCATCTCATTGGGACTGG - Intronic
976534421 4:86194088-86194110 CTGGTTCATCTCACTGGGAAAGG - Intronic
976548889 4:86371681-86371703 CGGGCTCATCTCACTGGGATTGG + Intronic
976552629 4:86413935-86413957 CTGGTTCATCTCACTGGGACTGG - Intronic
976760032 4:88539045-88539067 CTGGTTCATCTCATTGGGACTGG + Intronic
976790213 4:88870258-88870280 CTGGTTCATCTCACTGGGACTGG + Intronic
976810025 4:89090371-89090393 CCAGCTCATCTCATTGGGACTGG - Intronic
976903608 4:90208845-90208867 CTGGCTCATCTCAGTGGGACTGG - Intronic
976975926 4:91165949-91165971 CTGGTTCATCTCACTGGGACTGG - Intronic
977046820 4:92078783-92078805 CTGGCTCATCTCATCTGGACTGG + Intergenic
977185730 4:93933101-93933123 CCAGCTCATCTCATTGGGACTGG - Intergenic
977194679 4:94044595-94044617 CTGGTTCATCTCACTGGGACTGG + Intergenic
977219845 4:94325801-94325823 CTGGTTCATCTCACTGGGACAGG - Intronic
977326528 4:95580817-95580839 CTGGTTCATATCATTGGGACTGG - Intergenic
977671313 4:99698848-99698870 CTGATTCATCTCATTGGGACTGG + Intergenic
977829670 4:101576173-101576195 CTGGTTCATCTCACTGGGACTGG + Intronic
977905936 4:102478015-102478037 CTGGTTCATCTCATTGGGACTGG + Intergenic
977946418 4:102919532-102919554 CTGGTTCATCTCATTGGGACTGG + Intronic
977950810 4:102968655-102968677 CTGGTTCATCTCACTGGGACTGG + Intronic
977994366 4:103484534-103484556 CCAGCTCATCTCATTGGGACTGG + Intergenic
978078973 4:104568490-104568512 CTGGTTCATCTCACTGGGACTGG - Intergenic
978090203 4:104706656-104706678 CTGGCTCATCTCATTGGGACTGG + Intergenic
978148675 4:105409026-105409048 GTGGTTCATCTCATTGGGACTGG + Intronic
978150253 4:105426308-105426330 CTGGTTCATCTCATTGGGACTGG + Intronic
978179622 4:105776678-105776700 CTGGCTCATCTCATTGGGACTGG - Intronic
978237015 4:106471921-106471943 CTGGTTCATCTCATTGGGACTGG - Intergenic
978313196 4:107409089-107409111 CAGGCTCATCTCATTGGGACTGG + Intergenic
978464487 4:108994080-108994102 CTGGTTCATCTCACTGGGACTGG + Intronic
978517845 4:109587477-109587499 CTGGCTCATCTCATTGGGACTGG - Intronic
978601512 4:110432506-110432528 CCGGCTCATCTCACTGGGACTGG - Intronic
978699860 4:111628818-111628840 CTGGCTTATCTCATTGGGACTGG - Intergenic
978845661 4:113269616-113269638 CTGGCTCATCTCACTGGGATTGG - Intronic
979043589 4:115834057-115834079 CTGGCTTATCTCATTGGGACTGG + Intergenic
979272921 4:118783122-118783144 CTGGTTCATCTCATTAGGACTGG - Intronic
979315436 4:119255767-119255789 CTGGTTCATCTCATTGGGACTGG - Intronic
979462741 4:121002030-121002052 CTGGTTCATCTCACTGGGACAGG - Intergenic
979487456 4:121284911-121284933 CTGGTTCATCTCATTGGGACTGG + Intergenic
979510743 4:121550697-121550719 CTGGTTCATCTCACTGGGACTGG - Intergenic
979516535 4:121616323-121616345 CTGGCTCATCTCACTGGGACTGG + Intergenic
979581300 4:122364803-122364825 CTGGTTCATCTCATTGGGAATGG + Intergenic
979659520 4:123237801-123237823 CTAGTTCATCTCATTGGGACTGG + Intronic
979730202 4:124014425-124014447 CTGGTTCATCTCATTGAGACTGG - Intergenic
979934005 4:126669844-126669866 CTGGTTCATCTCATTGGGACTGG + Intergenic
979998806 4:127464499-127464521 CTGGTTCATCTCACTGGGACTGG - Intergenic
980157727 4:129126861-129126883 CCGGCTCATCTCATTGGGACTGG - Intergenic
980330468 4:131403890-131403912 CTGATTCATCTCATTGGGACTGG - Intergenic
980558774 4:134443164-134443186 CTGGTTCATCTCACTGGGACTGG - Intergenic
980583730 4:134786947-134786969 CCAGCTCATCTCATTGGGACTGG - Intergenic
980583994 4:134789348-134789370 CTGGTTCATCTCACTGGGACTGG + Intergenic
980594058 4:134929086-134929108 CTGGTTCATCTCATTGAGACTGG - Intergenic
980733324 4:136849299-136849321 TTGGCTCATCTGATTGGGACTGG - Intergenic
980888232 4:138786080-138786102 CTGGCTCATCTCACTGGGACTGG - Intergenic
981296574 4:143140166-143140188 CTGGCTCATCTCACTGGGACTGG + Intergenic
981443384 4:144808679-144808701 CTAGCTCATCTCACTGGGACTGG + Intergenic
981512636 4:145574443-145574465 CTGGTTCATCTCTTTGGGACTGG + Intergenic
981560991 4:146048321-146048343 CTGGTTCATCTCATTGGGACTGG - Intergenic
981655875 4:147112054-147112076 CTGGTTCATCTTATTGGGACTGG + Intergenic
981671446 4:147292270-147292292 CCGGCTCATCTCATTGGAACTGG + Intergenic
981789723 4:148522246-148522268 CTGGCTCATCTCATTGGGACTGG - Intergenic
981795041 4:148585938-148585960 CAGGCTCATCTCATCGGGACTGG - Intergenic
981846422 4:149175658-149175680 CTGGTTCATCTCATTGGGACTGG + Intergenic
981850924 4:149229503-149229525 CTGGTTCATCTCACTGGGACTGG + Intergenic
981859942 4:149341875-149341897 ATGGTTCATCTCATTGGGACTGG - Intergenic
981885242 4:149666226-149666248 CTGGTTCATCTCATTGGGACTGG + Intergenic
981939832 4:150271006-150271028 CTGGTTCATCTCGTTGGGACTGG + Intronic
982060364 4:151598373-151598395 CCGGTTCATCTCATTGGGACTGG - Intronic
982299046 4:153860073-153860095 CTGGCTCATCTCATTGGGACTGG - Intergenic
982625513 4:157760852-157760874 CTGGTTCATCTCATTGGGACTGG - Intergenic
982725693 4:158903318-158903340 CCGGCTCATCTCATTGGGAGTGG - Intronic
982825647 4:160001452-160001474 CCAGCTCATCTCATTGGGACTGG + Intergenic
982853053 4:160342818-160342840 CTGGCTCATCTCATTGGGACTGG - Intergenic
982883231 4:160746464-160746486 CTGGTTCTTCTCATTGGGACTGG + Intergenic
983543197 4:168935075-168935097 CCAGCTCATCTCATTGGGACTGG + Intronic
983594253 4:169448781-169448803 CTGGTTCATCTCAATGGGACTGG + Intronic
983677761 4:170316509-170316531 CTGGTTCATCTCACTGGGACTGG + Intergenic
983787965 4:171758930-171758952 CTGTTTCATCTCATTGGGACTGG + Intergenic
983949550 4:173622900-173622922 CCAGCTCATCTCATTGGGACTGG - Intergenic
983958901 4:173728312-173728334 CTAGCTCATCTCATTGGGACTGG - Intergenic
984269927 4:177537453-177537475 CTGGCTCCTCTCATTGGGACTGG - Intergenic
984354105 4:178636780-178636802 CCGGCTCATCTCATTGGGACTGG + Intergenic
984434079 4:179685694-179685716 CTGGTTCATCTCATTGGGACTGG - Intergenic
984526151 4:180861077-180861099 CTGACTCATCTCACTGGGACTGG - Intergenic
984618543 4:181926811-181926833 CCAGCTCATCTCATTGGGACTGG + Intergenic
984902852 4:184600492-184600514 CCGGCTCATCTCATTGGGACTGG + Intergenic
985194113 4:187408772-187408794 CTGGCTCATCTCACTGAGACTGG - Intergenic
986006113 5:3670252-3670274 ATGGCTCATCTCACTGGGACTGG - Intergenic
986127144 5:4893578-4893600 CTGGTTCATGTCATTGGGACTGG - Intergenic
986323126 5:6649775-6649797 CTGGCTTATCTCACTGGGACTGG - Intronic
986378919 5:7163127-7163149 CCGGTTCATCTCATTGGGACTGG - Intergenic
986656423 5:10017063-10017085 CTGGTTCATCTCATTGGGACTGG - Intergenic
986675101 5:10177500-10177522 CTGGCTCATCTCATTGGAACTGG + Intergenic
986838901 5:11672945-11672967 CTGGTTCATCTCATTGTGACTGG - Intronic
987019118 5:13851874-13851896 CTGGCTCATCTCATTGGGACTGG + Intronic
987179852 5:15356193-15356215 CTGGTTCATCTCACTGGGACTGG + Intergenic
987279783 5:16400966-16400988 CTGGTTCATCTCACTGGGACTGG - Intergenic
987444936 5:18006114-18006136 CTGGTTCATCTCATTGGGACTGG + Intergenic
988023713 5:25655860-25655882 CTGGTTCATCTCATTGGGACTGG - Intergenic
988381324 5:30499862-30499884 CTGGTTCATCTCATTGGGACTGG - Intergenic
988671711 5:33388785-33388807 CTGGTTCATCTCATTGGGACTGG + Intergenic
988687562 5:33539922-33539944 CTGGTTCATCTCACTGGGACTGG + Intronic
988719116 5:33858809-33858831 CCAGCTCATCTCATTGGGACTGG + Intronic
988771187 5:34434800-34434822 CTGGTTCATCTCACTGGGACTGG - Intergenic
988795161 5:34646720-34646742 ATGGTTCATCTCATTGGGACTGG - Intergenic
988867785 5:35354385-35354407 CTGGCTTATCTCATAGGGACTGG - Intergenic
988975133 5:36508118-36508140 CTGGTTCATCTCATTGGAACTGG + Intergenic
989084171 5:37657331-37657353 CTGGCTTATCTCATTGGGACTGG - Intronic
989087221 5:37688808-37688830 CTGGTTCATCTCATTGGGACTGG + Intronic
989320803 5:40131392-40131414 CTGGTTCATCTCATTGGGACTGG - Intergenic
989345340 5:40423230-40423252 CTAGTTCATCTCATTGGGACTGG - Intergenic
989363850 5:40634270-40634292 CTGGATCATCTCACTGGGACTGG + Intergenic
989390479 5:40895474-40895496 CTGGTTCATATCACTGGGATTGG + Intergenic
989451869 5:41596420-41596442 CTGGTTCATCTCATTGGGACTGG + Intergenic
989522512 5:42418441-42418463 CTGGTTCATCTCATTGGGACTGG - Intergenic
989619166 5:43367708-43367730 ATGGCTCACCTCACTGGGATTGG - Intergenic
989670236 5:43908799-43908821 CTGGTTCATCTCATTGGGACTGG + Intergenic
989687717 5:44108894-44108916 CTGGCTCATCTCACTGGGACTGG - Intergenic
990183860 5:53191676-53191698 CCAGCTCATCTCATTGGGACTGG - Intergenic
990224341 5:53632051-53632073 CTGGTTCATCTCACTGGGACTGG - Intronic
990230347 5:53706197-53706219 CTGGTTCATCTCACTGGGACTGG - Intergenic
990234270 5:53750605-53750627 CTGGTTCATCTCATTGGGACTGG + Intergenic
990239144 5:53799473-53799495 CTGGTTCATCTCATTGAGACTGG + Intergenic
990368861 5:55096656-55096678 CTTGTTCATCTCATTGGGACTGG + Intergenic
990673979 5:58162660-58162682 CCAGCTCATCTCATTGGGACTGG - Intergenic
990713054 5:58606024-58606046 CTGGTTCATCTCATTAGGACTGG + Intronic
990721407 5:58699982-58700004 CTGGTTCATCTCATTGGGACTGG - Intronic
990837717 5:60041601-60041623 CCAGCTCATCTCATTGGGACTGG + Intronic
990898873 5:60728945-60728967 CTGGTTTATCTCATTGGGACTGG + Intergenic
991026764 5:62037999-62038021 CAGGTTCATCTCATTGGGACTGG - Intergenic
991105402 5:62837191-62837213 CTGGTTCATCTCAATGGGACTGG + Intergenic
991151412 5:63375790-63375812 CTGATTCATCTCATTGGGACTGG + Intergenic
991161290 5:63507069-63507091 CTGGTTCATCTCATTGGGACAGG + Intergenic
991200057 5:63980921-63980943 CTGGTTCATCTCACTGGGACTGG - Intergenic
991243506 5:64485012-64485034 CTAGTTCATCTCATTGGGACTGG - Intergenic
991283333 5:64940454-64940476 CTGGTTCATCTCATTGGGACTGG - Intronic
991364351 5:65852952-65852974 CTGGTTCATCTCATTGGGACTGG - Intronic
991417286 5:66405698-66405720 CTGGTTCATCTCATTGGGACTGG - Intergenic
991425039 5:66482152-66482174 CTGGTTCATCTCACTGGGACTGG + Intergenic
991450189 5:66743329-66743351 CTGGCTCGTCTCTTGGGGACTGG + Intronic
991575795 5:68102328-68102350 CTGGTTCATCTCATTGGGACTGG + Intergenic
992038972 5:72809370-72809392 TTGGCTCATCTCATTGGGACTGG - Intergenic
992077761 5:73206863-73206885 CTGGCTCATCTCATTGGCACTGG + Intergenic
992287197 5:75247944-75247966 CCGGCTCATCTCATTGTGACTGG + Intergenic
992580984 5:78175237-78175259 CTGGTTCATCTCACTGGGACTGG - Intronic
992604479 5:78441219-78441241 CTGGTTCATCTCACTGGGACTGG - Intronic
992756426 5:79911089-79911111 CTGGTTCATCTCATTGGGACTGG + Intergenic
992976989 5:82130686-82130708 CCGGCTCATCTCACTGGGACTGG - Intronic
993044136 5:82848058-82848080 CTGGTTCATCTCACTGGGACTGG - Intergenic
993255812 5:85588581-85588603 CTGGTTCATCCCATTGGGACTGG - Intergenic
993266392 5:85731963-85731985 CTGGTTCATCTCATTGGGACTGG + Intergenic
993276997 5:85872805-85872827 CTGGTTCATGTTGTTGGTATGGG - Intergenic
993345632 5:86778484-86778506 CTGGTTCATCTCATTGGGACTGG - Intergenic
993358319 5:86941836-86941858 CTGGTTCATCTCATTGGGACTGG - Intergenic
993366765 5:87043039-87043061 CTGGTTCATCTCATTGGGACTGG - Intergenic
993381954 5:87218209-87218231 CCAGCTCATCTCATTGGGACTGG - Intergenic
993455196 5:88120038-88120060 CCGGCTCATCTCACTGGGAATGG + Intergenic
993470819 5:88305850-88305872 CTGGTTCATCTCATTGGGACTGG + Intergenic
993497469 5:88623488-88623510 CTGGTTCATCTCATTGGAACTGG - Intergenic
993541535 5:89158976-89158998 CTGGCTCATCTCATTCGGACTGG + Intergenic
993591451 5:89800539-89800561 CTGGTTCATCTCATTGGGACTGG + Intergenic
993891604 5:93482250-93482272 CTGACTCATCTCATTGGGACAGG + Intergenic
993948064 5:94138466-94138488 CTGTTTCATCTCATTGGGACTGG - Intergenic
993984616 5:94583147-94583169 CTGGTTCATCTCACTGGGACTGG + Intronic
994039624 5:95244304-95244326 CTGGTTCATCTCATTGGGACTGG + Intronic
994160273 5:96549517-96549539 CTGGTTCATCTCATTGGGACTGG + Intronic
994377983 5:99037407-99037429 CTGGTTCAACTCATTGGGACTGG + Intergenic
994545589 5:101162953-101162975 CTGGTTCATCTCATTGGGACTGG + Intergenic
994636523 5:102351416-102351438 CTGGTTCATCTCATTGGGACTGG + Intergenic
995136647 5:108686277-108686299 CTGGTTCATCTCATTAGGACGGG - Intergenic
995459714 5:112390171-112390193 CTGGTTCATCTATTTGGGACTGG + Intronic
995464331 5:112435797-112435819 CTGGGTCATCTCATTGGGACTGG + Intergenic
995480266 5:112586134-112586156 CTGGGTCATCTCACTGGGACTGG + Intergenic
995620521 5:114021048-114021070 CTGGTTCATCTCATTGGGACTGG + Intergenic
995670545 5:114598129-114598151 CTGGTTTATCTCATTGGGACTGG + Intergenic
995790748 5:115883545-115883567 CTGGCTCATCTCATTGGGACTGG - Intronic
995808469 5:116080000-116080022 CCGGTTCATCTCATTGGGACTGG + Intergenic
996129847 5:119769327-119769349 CTGGCTCATCTTACTGGGACTGG + Intergenic
996147356 5:119992176-119992198 CTGGTTCATCTCATTGGGACTGG - Intergenic
996275337 5:121660000-121660022 CTGGTTCATCTCATTGGGACTGG + Intergenic
996781940 5:127197241-127197263 CTGGTTCATCTCACTGGGACTGG + Intergenic
996910973 5:128656314-128656336 CCTGCTCATCTCATTGGGACTGG - Intronic
996987591 5:129585238-129585260 CCGGCTCATCTCACTGGGACTGG - Intronic
997004669 5:129803886-129803908 CTGGTTCATCTCATTGGGACTGG - Intergenic
997004931 5:129805460-129805482 CTGGTTCATCTCATTGGGACTGG - Intergenic
997039376 5:130233633-130233655 CTGGCTTATCTCATTGGGATGGG + Intergenic
997115651 5:131123193-131123215 CTGGTTCATCTCACTGGGACTGG - Intergenic
997216548 5:132116572-132116594 CTGGTTCATCTCACTGGGACTGG + Intergenic
997343944 5:133171244-133171266 CTGGTTCATCTCATTGGGACTGG - Intergenic
997497081 5:134337371-134337393 CTGGTTCATCTCACTGGGACTGG - Intronic
997809618 5:136954385-136954407 CTGGCACATCTCATTGGGACTGG - Intergenic
998763282 5:145455880-145455902 CTGGCTTATCTCACTGGGACTGG - Intergenic
998772756 5:145564994-145565016 CTGGCTCATCTCATTAGGACTGG - Intronic
998801896 5:145877687-145877709 CTGGTTCATCTCATTGAGACTGG + Intergenic
998972883 5:147611526-147611548 CTGGTTCATCTCATTGGGACTGG - Intronic
999453238 5:151694110-151694132 CAGGCTGACCTCTTTGGGATGGG + Intergenic
999488805 5:152027348-152027370 CTGGCTCATCTCATTGGGACTGG - Intergenic
999489927 5:152039648-152039670 CTGGTTCATCTCACTGGGACTGG - Intergenic
999556721 5:152751767-152751789 CTAGTTCATCTCATTGGGATGGG + Intergenic
999671993 5:153966192-153966214 CTGCCTCTTCTTGCTGGGATGGG - Intergenic
999965549 5:156805960-156805982 CTGGTTCATCTCATTGGGACTGG + Intergenic
1000068919 5:157721041-157721063 CTGGTTCATCTCTTTGGGACTGG + Intergenic
1000145223 5:158447225-158447247 CTGGCTCATCTCATTGGGACTGG - Intergenic
1000194868 5:158947533-158947555 CCAGTTCATCTCATTGGGATTGG - Intronic
1000497725 5:162006506-162006528 CTGGCTCACCTCCTTGGCATGGG - Intergenic
1000574799 5:162964707-162964729 CTGGTTCATCTCACTGGGACTGG - Intergenic
1000589955 5:163146522-163146544 CTGGCTTATCTCATTAGGACTGG + Intergenic
1000786449 5:165550092-165550114 CTGGCTCATCTCCTTGGTACTGG - Intergenic
1000798471 5:165693754-165693776 CTGGTTCATCTCATTGGGACTGG - Intergenic
1000860516 5:166450869-166450891 CTGGCTCATCTCACTGGGACTGG - Intergenic
1001347840 5:170922837-170922859 ATGGTTCATCTCATTGGGACTGG - Intronic
1001362765 5:171103944-171103966 CTGGCTCATCTCATTGGGACTGG - Intronic
1001792013 5:174465999-174466021 CTGGTTCATCTCACTGGGACTGG + Intergenic
1002673152 5:180886436-180886458 CTGGCTCATCTCACTGGGACTGG - Intergenic
1002677070 5:180926124-180926146 CTGGCTCATCTCATTGGGACTGG + Intronic
1002734901 5:181377911-181377933 CTGGTTCATCTCACTGGGACTGG - Intergenic
1002749625 6:96211-96233 CTGGTTCATCTCACTGGGACTGG + Intergenic
1002944703 6:1750382-1750404 CTGGCTCATCTCATTGGGACTGG + Intronic
1003228151 6:4225065-4225087 CAGGTTCATCTCATTGGGACTGG + Intergenic
1003228585 6:4228983-4229005 CTGGTTCATCTCATTGGGACTGG + Intergenic
1003316870 6:5020690-5020712 CTGGTTCATCTCAATGGGACTGG - Intergenic
1003412873 6:5880928-5880950 CAGACTCATCTCGGTGGGAGTGG + Intergenic
1003416976 6:5918198-5918220 CTGGCTCATCTCATTGGGACTGG - Intergenic
1003434453 6:6072761-6072783 CTCGTTCATCTCATTGGGACTGG - Intergenic
1003542105 6:7026960-7026982 CTGGTTCATCTCATTGGGACTGG + Intergenic
1003647453 6:7925796-7925818 CTGGTTCATCTCATTGAGACTGG + Intronic
1003713598 6:8620136-8620158 CTGGTTCATCTCACTGGGACTGG - Intergenic
1003763812 6:9213586-9213608 CTGGTTCATCTCATTGGGATTGG + Intergenic
1003946841 6:11083858-11083880 CTAGCTCACCTCGTAGGTATGGG + Intergenic
1004056009 6:12139461-12139483 CTGGTTCATCTCATTGGGACTGG + Intronic
1004397382 6:15257515-15257537 TTGACTCATCTCTTCGGGATGGG + Intronic
1005274089 6:24198302-24198324 CCGGCTCATCTCATTGGGACTGG + Intronic
1005670371 6:28099483-28099505 CTGGTTCATCTCATTGGGTCTGG - Intergenic
1005747082 6:28848544-28848566 CTGGTTCATCTCACTGGGACTGG + Intergenic
1006616566 6:35332052-35332074 CTGGTTCATCTCACTGGGACTGG + Intergenic
1008425307 6:51349649-51349671 CCGGTTCATCTCTTTGGGACTGG - Intergenic
1008436912 6:51486427-51486449 CTGGTTCATCTCACTGGGAATGG - Intergenic
1008633111 6:53382826-53382848 CTGGTTCATCTCACTGGGACTGG + Intergenic
1008782820 6:55127409-55127431 CTGGTTCATCTCATTGGGGCAGG - Intronic
1008896930 6:56566539-56566561 CCAGCTCATCTCATTGGGACTGG - Intronic
1008963185 6:57287899-57287921 GTGGTTCATCTCATTGGGACTGG + Intergenic
1009458659 6:63887456-63887478 CCAGTTCATCTCGTTGGGACTGG + Intronic
1009492622 6:64311674-64311696 CTAGTTCATCTCATTGGGACTGG + Intronic
1009628612 6:66166604-66166626 CTGGTTCATCTCATTGGGACTGG + Intergenic
1009651997 6:66489036-66489058 TTGGTTCATCTCATTGGGACGGG + Intergenic
1009709709 6:67300971-67300993 CTGGTTCATCTCATTGGGACTGG - Intergenic
1009945455 6:70336968-70336990 CTGGCTCATCTCACTGGGACTGG - Intergenic
1009988167 6:70806522-70806544 CTGGTTCATCTCACTGGGACTGG - Intronic
1009998213 6:70920440-70920462 CTGGTTCATCTCATTGGGATTGG - Intronic
1010003826 6:70974269-70974291 CTGGTTCATCTCAATGGGACTGG + Intergenic
1010039244 6:71361673-71361695 CTGGCTCATCTCATTGCGACTGG - Intergenic
1010102543 6:72126006-72126028 CTGGTTCATCTCACTGGGAATGG - Intronic
1010298069 6:74223329-74223351 CTGGTTCATCTCATTGGGACTGG - Intergenic
1010364187 6:75030949-75030971 CTGTTTCATCTCATTGGGACTGG + Intergenic
1010422198 6:75688412-75688434 CTAGTTCATCTCATTGGGACTGG - Intronic
1010615271 6:78005425-78005447 CTGGTTCATCTCACTGGGACTGG + Intergenic
1010670017 6:78676069-78676091 CTGGTTCATCTCATTGGGATTGG + Intergenic
1010747195 6:79577747-79577769 CTGGTTCATCTCACTGGGACTGG + Intergenic
1010755735 6:79664184-79664206 CTGGTTCATCTCATTCGGACTGG - Intronic
1010837844 6:80612222-80612244 CTGGTTCATCTCACTGGGACTGG + Intergenic
1011020792 6:82809833-82809855 CTGGTTCATCTCAATGGGACTGG - Intergenic
1011063047 6:83293162-83293184 CTGGTTCATCTCATTGGGACTGG - Intronic
1011065407 6:83320953-83320975 CCGGTTCATCTCATTGGGATGGG + Intronic
1011139320 6:84134687-84134709 CTGGCTCATCTCATTGGAACTGG - Intronic
1011174008 6:84540605-84540627 CTGGCTCATTTCATTAGGACTGG + Intergenic
1011245216 6:85314943-85314965 CTGGTTCATCTCACTGGGACTGG - Intergenic
1011288557 6:85751756-85751778 CTGGTTCATCTCATTGGGACTGG + Intergenic
1011298327 6:85847474-85847496 CTGGTTCATCTCATTGGAACTGG - Intergenic
1011304257 6:85909047-85909069 CTGGTTCATCTCATTGGGCCTGG - Intergenic
1011333574 6:86236317-86236339 CTGGCTCATCTCAATGGGACTGG + Intergenic
1011351862 6:86432622-86432644 CTGGCTCCTGTCTTTGGGTTAGG - Intergenic
1011387786 6:86815973-86815995 CTGGCTAATCTCACTGGGACAGG - Intergenic
1011417690 6:87139783-87139805 CTGGTTCATCTCATTGGGACTGG + Intergenic
1011578098 6:88827189-88827211 CTGGCTCATCTCGTTGGGATTGG + Intronic
1011766176 6:90622913-90622935 CCAGCTCATCTCATTGGGACTGG + Intergenic
1011884574 6:92078385-92078407 CTGGTTCATCTCACTGGGACTGG + Intergenic
1011909651 6:92420858-92420880 CTGGTTCATCTCATTGGGACTGG + Intergenic
1012083167 6:94785781-94785803 CCTGCTCATCTCATTGGGACTGG - Intergenic
1012207558 6:96479236-96479258 CTGGTTCATCTCATTGGGACTGG - Intergenic
1012209342 6:96500324-96500346 CTGGTTCATCTCACTGGGACTGG - Intergenic
1012484127 6:99702224-99702246 CTGGTTCGTCTCATTGGGACTGG + Intergenic
1012585297 6:100914151-100914173 CTGGTTCTTCTCATTGGGACTGG - Intergenic
1012878377 6:104756669-104756691 CTGGTTCAACTCATTGGGACTGG + Intronic
1013386878 6:109640450-109640472 CTGGTTCATCTCATTGGGACTGG - Intronic
1013436594 6:110116156-110116178 CTGGTTCATCTCATTAGGACTGG + Intronic
1013452894 6:110302962-110302984 CCGGCTCATCTCATTGGGACTGG + Intronic
1013578364 6:111507742-111507764 CTGGTTCATCTCATTGGGACTGG - Intergenic
1013625765 6:111935300-111935322 CTGGTTCATCTCATTGGGACTGG - Intergenic
1013672535 6:112421195-112421217 CTGGTTCATCTCATTGGGACTGG + Intergenic
1013682496 6:112541049-112541071 CTGGCTCATCTCATTGGGACTGG + Intergenic
1013860900 6:114633999-114634021 CTGGTTCATCTCAGTGGGACTGG - Intergenic
1014013250 6:116500964-116500986 CTGGTTCATCTCACTGGGACTGG + Intronic
1014113294 6:117645408-117645430 CTGGCTTATCTCATTGGGACTGG + Intergenic
1014122790 6:117745824-117745846 CTGGCTCATCTCATTTGGACTGG + Intergenic
1014184611 6:118421126-118421148 CTGGTTCATCTCATTGGGACTGG + Intergenic
1014413502 6:121154332-121154354 CTGGTTCATCTCACTGGGACTGG - Intronic
1014461576 6:121703037-121703059 CTGGTTCATCTCACTGGGACTGG + Intergenic
1014466227 6:121760298-121760320 CCGGCTCATCTCACTGGGACTGG + Intergenic
1014527915 6:122522752-122522774 CTGGCTCATCTCACTGGAACTGG - Intronic
1014868222 6:126558804-126558826 CTGGTTAATCTCATTGGGACTGG + Intergenic
1014872716 6:126615423-126615445 CTGGCTCATCTCATTGGGACTGG - Intergenic
1014922337 6:127228286-127228308 CTGGCTCATCTCACTGGGACTGG + Intergenic
1014924522 6:127255161-127255183 CTGGTTCATCTCACTGGGACAGG + Intergenic
1014938746 6:127413617-127413639 CTGGTTCATCTAATTGGGACTGG - Intergenic
1015046334 6:128780263-128780285 CTGGTTCATCTCTTTGGGACTGG - Intergenic
1015132991 6:129835529-129835551 CTGGTTCATCTCATTGGGACTGG + Intronic
1015386885 6:132634926-132634948 CTGGTTCATCTCACTGGGAATGG + Intergenic
1015419168 6:132986488-132986510 CTGGTTCATCTCACTGGGACTGG - Intergenic
1015433314 6:133155435-133155457 CCGGTTCATCTCATTGGGATTGG - Intergenic
1015623492 6:135156673-135156695 CCAGCTCATCTCATTGGGACTGG - Intergenic
1015801986 6:137069932-137069954 ATGGCTCATCTCATTGGGACTGG + Intergenic
1015967758 6:138711938-138711960 ATGGTTCATCTCATTGGGACTGG - Intergenic
1016006057 6:139090447-139090469 CTGGTTCATCTCATTGGGACTGG - Intergenic
1016334828 6:142993844-142993866 CTGGTTCATCTCACTGGGACTGG + Intergenic
1016338618 6:143035546-143035568 CTGGTTCATCTCATTGAGACTGG - Intergenic
1016436930 6:144047215-144047237 CTGGTTCATCTCACTGGGACTGG - Intronic
1016584872 6:145673400-145673422 CTGGTTCATCTCACTGGGACTGG + Intronic
1016638808 6:146324765-146324787 CTGGCTCATCTCACTGGGGCTGG - Intronic
1016655693 6:146515704-146515726 CTGGTTCATCTCATTGGGACTGG - Intergenic
1016717461 6:147251087-147251109 CCAGCTCATCTCATTGGGATTGG + Intronic
1017197514 6:151717198-151717220 CCAGCTCATCTCATTGGGACTGG - Intronic
1017231539 6:152078597-152078619 CTGGTTCATCTCACTGGGACTGG + Intronic
1017279592 6:152609093-152609115 CTGGTTCCTCTCATTGGGACTGG + Intronic
1017302840 6:152882774-152882796 CTGGTTCATCTCATTGGGACTGG + Intergenic
1017411454 6:154172264-154172286 CTGGTTCATCTCATTGGGACTGG + Intronic
1017571317 6:155748383-155748405 CTGGCTCATTTCACTGGGACTGG + Intergenic
1017659883 6:156663607-156663629 CTGGTTCATCTCATTGGGACTGG + Intergenic
1017836577 6:158183920-158183942 CTGGTTCATCTCATTGGGACTGG - Intronic
1018076074 6:160214760-160214782 CTGGTTCACCTCATTGGGACTGG - Intronic
1018114731 6:160572216-160572238 CCGGCTCATCTCATTGGGACTGG - Intronic
1019203763 6:170341820-170341842 CTGGTTCATCTCAATGGGACTGG - Intronic
1019239163 6:170650228-170650250 CTGGTTCATCTCACTGGGACTGG - Intergenic
1020333305 7:7041930-7041952 CCGGTTCATCTCATTGGGATTGG + Intergenic
1020344220 7:7145635-7145657 CTGGTTCATCTCACTGGGACTGG - Intergenic
1020358369 7:7301645-7301667 CTGATTCATCTCATTGGGACTGG - Intergenic
1020367327 7:7394275-7394297 CTGGCTCATCTCACTGGGACTGG - Intronic
1020391511 7:7662656-7662678 CCGGCTCATCTCATTGGGACTGG - Intronic
1020443039 7:8239523-8239545 CTGGTTCATCTCATTGGGACTGG + Intronic
1020609038 7:10372654-10372676 CTGGTTCATCTCATTGGGACTGG + Intergenic
1020629656 7:10625168-10625190 CTGGTTCATCTCACTGGGACTGG + Intergenic
1020635886 7:10695690-10695712 CTGGTTCATCTCTTTGGGACTGG + Intergenic
1020693951 7:11392194-11392216 CTGGCTCATCTCATTGGGACTGG + Intronic
1020774192 7:12432369-12432391 CTGGTTCATCTCACTGGGACTGG - Intergenic
1020834085 7:13126865-13126887 CTGGTTCATCTCATTGGGACAGG - Intergenic
1020874361 7:13674359-13674381 CTGGCTCGTCTCACTGGGATTGG - Intergenic
1020884261 7:13803221-13803243 CTGTCTCATCTCATTGGGACTGG + Intergenic
1021014570 7:15517465-15517487 CTGGCTCATCTCACTGGGACTGG + Intronic
1021071597 7:16248688-16248710 CTAGTTCATCTCATTGGGACTGG + Intronic
1021307131 7:19045838-19045860 CTGGTTCATCTCATTGGGACTGG + Intronic
1021322222 7:19226699-19226721 CCAGCTCATCTCATTGGGACTGG + Intergenic
1021782360 7:24118456-24118478 CCGGTTCATCTCATTGGGACTGG - Intergenic
1021798230 7:24279010-24279032 CTGGTTCATCTCACTGGGACTGG - Intergenic
1021870603 7:25002293-25002315 CTGGTTCATCTCACTGGGACTGG - Intergenic
1022136079 7:27449564-27449586 CTGGTTCATCTCATTGGGACTGG - Intergenic
1022745440 7:33166900-33166922 CTGGTTCATCTCATTGGGACTGG - Intronic
1022866933 7:34431426-34431448 CTGGTTCATCTCACTGGGACTGG + Intergenic
1022869027 7:34457035-34457057 CTGGTTCATCTCACTGGGACTGG + Intergenic
1022901372 7:34814034-34814056 CTGGTTCATCTCACTGGGACTGG + Intronic
1023051850 7:36259185-36259207 CTGGCTCATCTCATTGAGACTGG - Intronic
1023066106 7:36379117-36379139 CTGGTTCATCTCATTGGTACTGG - Intronic
1023146176 7:37153261-37153283 CTGGTTCATCTCACTGGGACTGG + Intronic
1023310930 7:38886127-38886149 CTGGTTCATCTCATTGGGACTGG + Intronic
1023509433 7:40934940-40934962 CTGGTTCATCTCACTGGGACTGG - Intergenic
1023511716 7:40960015-40960037 CTGGCACATCTCAATGGGACTGG - Intergenic
1023568999 7:41553164-41553186 CTGGTTCATCTCATTGTGACTGG - Intergenic
1024106193 7:46088967-46088989 CTGGTTCATCTCATTGGGACTGG - Intergenic
1024495354 7:50040464-50040486 CTGGTTCATCTCATTGGGACTGG + Intronic
1024591230 7:50886952-50886974 CTGGTTCATCTCATTGGGACTGG + Intergenic
1024667099 7:51558175-51558197 CTGGTTCATCTCATTGGGACTGG - Intergenic
1024817544 7:53288351-53288373 CTGGTTCATCTCATTGAGACTGG - Intergenic
1024950597 7:54856367-54856389 CTGGCTCATCTCATTGGGACTGG - Intergenic
1025621489 7:63175338-63175360 CTGGCTCATCTCATCGGGCCTGG - Intergenic
1027446171 7:78275288-78275310 CTGGTTCATCTCACTGGGACTGG - Intronic
1027636992 7:80688841-80688863 CTGGCTAATCTCATTGGGACTGG + Intergenic
1027701739 7:81478565-81478587 CTGGTTCATCTCACTGGGATTGG + Intergenic
1027864665 7:83630127-83630149 CTGGCTCATCTCATTGGGACTGG - Intronic
1028078786 7:86548293-86548315 CTGGTTCATCTCACTGGGACTGG - Intergenic
1028080256 7:86567156-86567178 CTGGTTCATCTCATTGGGACTGG + Intergenic
1028114439 7:86981784-86981806 CTGGTTCATCTCATTGGGACTGG + Intronic
1028144211 7:87304159-87304181 ATGGGTCATCTCATTGGGAATGG + Intergenic
1028236995 7:88373922-88373944 CTGGTTCATCTCACTGGGACTGG - Intergenic
1028326917 7:89539667-89539689 CCAGCTCATCTCATTGGGACTGG - Intergenic
1028340880 7:89718807-89718829 TTGGTTCATCTCATTGGGACTGG + Intergenic
1028413064 7:90551549-90551571 CTGGTTCATCTCACTGGGACTGG - Intronic
1028476426 7:91258218-91258240 CTGGCTCATCTCATTGGGACTGG - Intergenic
1028526274 7:91790573-91790595 CTGGTTCATCTCACTGGGACTGG + Intronic
1028544863 7:91986414-91986436 CTGGTTCATCTCACTGGGACTGG - Intronic
1028578425 7:92379870-92379892 CTGGTTCATCTCATTGGGACTGG + Intronic
1028648112 7:93120668-93120690 CGGGCTCATCTCATTGGGACTGG + Intergenic
1028836084 7:95376872-95376894 CTGGTCCATCTCATTGGGACTGG + Intronic
1029006564 7:97216049-97216071 CTGGTTCATCTCATTGGGACTGG - Intergenic
1029017527 7:97329845-97329867 CTGGTTCATCTCATTGGGACTGG + Intergenic
1029062227 7:97810467-97810489 CTGGTGCATCTCATTGGGACTGG + Intergenic
1029324862 7:99797075-99797097 CTGGTTCATCTCATTGGGACTGG - Intergenic
1029338341 7:99921398-99921420 CTGGTTCACCTTGTTGGGATGGG - Intergenic
1029801635 7:102954055-102954077 CTGGTTCATCTCACTGGGACTGG + Intronic
1029851203 7:103463092-103463114 CTGGCTCATCTCACTGGGACTGG - Intergenic
1029854778 7:103504557-103504579 CCGGTTCATCTCATTGGGACTGG + Intronic
1030141126 7:106304830-106304852 CTGGCTCATCTCATTGGGACTGG - Intergenic
1030159310 7:106491386-106491408 CCGGCTCATCTCACTGGGACTGG + Intergenic
1030166449 7:106560462-106560484 CTGGTTCATCTTGTTGGGACTGG - Intergenic
1030177678 7:106671857-106671879 CTGGTTCATCTCATTGGGACTGG + Intergenic
1030181015 7:106709503-106709525 CTGGTTCATCTCATTGGGACTGG + Intergenic
1030325952 7:108218274-108218296 CTGGTTCATCTCATTGGGACTGG - Intronic
1030331789 7:108278775-108278797 CTGGTTCATCTCACTGGGACTGG - Intronic
1030500906 7:110357124-110357146 CTGGTTCATCTCATTGGGACTGG - Intergenic
1030612729 7:111706535-111706557 CTGGCTTATCTCATTGGGACTGG - Intergenic
1030624472 7:111829457-111829479 CTGGCTCATGGCTGTGGGATGGG + Intronic
1030801252 7:113856068-113856090 CCAGCTCATCTCATTGGGACTGG + Intergenic
1030936697 7:115593916-115593938 CTGGCTTATCTCATTGGGACTGG + Intergenic
1030958767 7:115888967-115888989 CTGGCTCATCTCATTGGGACTGG + Intergenic
1031031745 7:116743034-116743056 ACGGCTCATCTCATTGGGACTGG + Intronic
1031365918 7:120900846-120900868 ATGGTTCATCTCATTGGGACCGG + Intergenic
1031612580 7:123845042-123845064 CTGGTTCATCTCACTGGGACTGG - Intronic
1031613862 7:123857523-123857545 CTGGCTCATCTCATTGGGACTGG - Intronic
1031710912 7:125046111-125046133 CTGGCTCATCTCACTGGGACTGG + Intergenic
1031904998 7:127451064-127451086 CTGGATCATTTCATTGGGACTGG + Intergenic
1032659844 7:133970686-133970708 CCAGCTCATCTCATTGGGACCGG - Intronic
1032966363 7:137103200-137103222 CTGACTCATCTCATTGGGGCTGG + Intergenic
1034097584 7:148424492-148424514 CTGGTTCATCTCATTGGGACTGG + Intergenic
1034370868 7:150595085-150595107 ATGGCTGATCTCATTGGGATTGG - Intergenic
1034394147 7:150807652-150807674 CTGCCTCATGTCATTGGGACTGG + Intergenic
1034715200 7:153235336-153235358 ACGGCTCATCTCATTGGGACTGG - Intergenic
1035508609 8:156380-156402 CTGGTTCATCTCACTGGGACTGG + Intergenic
1035687941 8:1539465-1539487 CTCACTCAACTCGTGGGGATGGG - Intronic
1036035489 8:5013991-5014013 CTGGTTCATCTCATTGGGACTGG - Intergenic
1037258369 8:16980155-16980177 CTGGTTCATCTCACTGGGACTGG - Intergenic
1037285569 8:17294771-17294793 CTGGTTCATCTCACTGGGACTGG - Intronic
1037626067 8:20607978-20608000 CTGGCTCATCTCATTGGGACTGG - Intergenic
1037719554 8:21431152-21431174 CTGGTTCATCTCATTGGGACTGG + Intergenic
1038789373 8:30655037-30655059 CTGGCTAATTTCGTAGAGATAGG - Intronic
1038873350 8:31520140-31520162 CTGGTTCGTCTCATTGGGACTGG - Intergenic
1039145100 8:34438394-34438416 CTGGTTCATCTCACTGGGACTGG + Intergenic
1039284473 8:36026162-36026184 CTGGTTCATCTCACTGGGAATGG + Intergenic
1039343076 8:36672420-36672442 CTGATTTATCTCATTGGGATTGG - Intergenic
1039624393 8:39032688-39032710 CTGGTTCATCTCATTGGGACTGG - Intronic
1039634100 8:39144240-39144262 CTGGTTCATCTCACTGGGACTGG - Intronic
1039676815 8:39676663-39676685 CTGGTTCATCTCACTGGGACTGG - Intronic
1039680906 8:39735455-39735477 CTGGTTCATCTCATTGGGACTGG + Intergenic
1039754919 8:40512774-40512796 CTGGCTTATCTCATTGGGACTGG - Intergenic
1040354918 8:46608248-46608270 CTGGTTCATCTCATTGGGACTGG + Intergenic
1040473003 8:47752086-47752108 GTGGTTCATCTCATTGGGACTGG + Intergenic
1040651769 8:49457084-49457106 CTGACTCATCTCCATGGGAAGGG - Intergenic
1041050699 8:53931700-53931722 CTGGCTAATCTCATTGGGACTGG + Intronic
1041366653 8:57113535-57113557 CTGGCTCAACTGGTTGTGAAAGG + Intergenic
1041423474 8:57694959-57694981 CAGGTTCATCTCATGGGGATAGG + Intergenic
1041459834 8:58098869-58098891 CTAGCTCATCTCATTAGGACTGG - Intronic
1041630667 8:60083276-60083298 CTGGCTCGTCTCATTGGGACTGG - Intergenic
1041634803 8:60130681-60130703 CTGGTTCATCTCATGGGGACTGG - Intergenic
1041665971 8:60444998-60445020 CTGGTTCATCGCATTGGGACTGG - Intergenic
1041815796 8:61969068-61969090 CTGGTTCATCTCACTGGGACTGG - Intergenic
1041838422 8:62242577-62242599 CCGACTCATCTCATTGGGACTGG - Intergenic
1041909804 8:63077285-63077307 CTGGTTCATCTCACTGGGACTGG + Intronic
1042024291 8:64405915-64405937 CTGGTTCCTCTAGTTGGGACTGG - Intergenic
1042308769 8:67358961-67358983 CTGGTTCATCTCACTGGGACTGG - Intergenic
1042327333 8:67541839-67541861 CTGGTTCCTCTCATTGGGACTGG - Intronic
1042541039 8:69907354-69907376 CTGGTTCTTCTCATTGGGACTGG + Intergenic
1042597572 8:70466053-70466075 CTGGTTCATCTTATTGGGACTGG - Intergenic
1042614307 8:70631908-70631930 CTGGTTCATCTCACTGGGACTGG - Intronic
1042627249 8:70771254-70771276 CAGGTTCATCTCATTGGGACTGG - Intronic
1042645336 8:70980279-70980301 CTGGTTCATCTCACTGGGACTGG - Intergenic
1042833370 8:73055608-73055630 CTGGTTCATTTCATTGGGACTGG + Intergenic
1042853577 8:73240971-73240993 CTGGTTCATTTCATTGGGACTGG - Intergenic
1042946100 8:74156304-74156326 CTGGCTGATCTCATTGGGACTGG + Intergenic
1043089234 8:75876342-75876364 CTGATTCATCTCATTGGGACTGG - Intergenic
1043118247 8:76286895-76286917 CTGGCCTATCTCATTGGGACTGG - Intergenic
1043129458 8:76442454-76442476 ATGGTTCATCTCCTTGGGACTGG - Intergenic
1043165894 8:76902113-76902135 CTGGTTCATCTCATTGGGACTGG - Intergenic
1043366409 8:79537781-79537803 CCGGCTCATCTCACTGGGACTGG - Intergenic
1043368352 8:79561017-79561039 CTGGTTCATCTCACTGGGACTGG - Intergenic
1043532329 8:81165449-81165471 CTGGCTCATCTCATTGGGACTGG + Intergenic
1044073707 8:87793239-87793261 CTGGTTCATCTCATTGGGACTGG + Intergenic
1044131003 8:88524986-88525008 CCGGCTCATCTCATTGGGACTGG + Intergenic
1044187268 8:89269051-89269073 TTGGCTTATCTTGTTGGCATGGG - Intergenic
1044405181 8:91818557-91818579 CTGGTTCATCTCACTGGGAATGG + Intergenic
1044441011 8:92223376-92223398 CTGGCTCATCTCATTGGGACTGG - Intergenic
1044503470 8:92990552-92990574 CCGGCTCATCTCATTGGAACTGG + Intronic
1044577021 8:93780387-93780409 CTGGTTCATCTCATTGGGACTGG - Intronic
1044595366 8:93953611-93953633 CTGGCTCATCCCATTGGGACTGG - Intergenic
1044799004 8:95933919-95933941 CTGGTTCATCTCATTGGGACTGG - Intergenic
1044956661 8:97488167-97488189 CTGGTTCATCTCATTGGGACTGG - Intergenic
1045071212 8:98506417-98506439 CTGGTTCATCTCACTGGGACTGG - Intronic
1045123354 8:99063195-99063217 CTGGTTCCTCTCATTGGGACTGG + Intronic
1045949360 8:107834053-107834075 CTGGTTCATCTTATTGGGACTGG + Intergenic
1045973249 8:108103581-108103603 CTGGCTCATCTCACTGGGACTGG + Intergenic
1045975193 8:108123367-108123389 CAGGCTTATCTCATTGGGACTGG - Intergenic
1046068091 8:109219348-109219370 CCGGCTCATCTCATTGGGACTGG - Intergenic
1046115295 8:109776979-109777001 CTTGTTCATCTCATTGGAATTGG - Intergenic
1046531362 8:115450280-115450302 CTGTCTAATCTCATTGGGTTTGG - Intronic
1046607864 8:116390827-116390849 CTGGTTCATCTCATTGGGACTGG + Intergenic
1046879268 8:119290337-119290359 CTGGTTCATCTCATTGGGACTGG - Intergenic
1046880858 8:119306901-119306923 ATGGTTCATCTCATTGGGACTGG + Intergenic
1046947563 8:119988352-119988374 CCGGTTCATCTCATTGGGACTGG - Intronic
1046972639 8:120238948-120238970 CGGGTTCATCTCATTGGGACTGG - Intronic
1047049741 8:121097584-121097606 CTGACTCATCTTGTTGGCATGGG - Intergenic
1047133592 8:122051170-122051192 CTGGCTCATCTCATTGGGACTGG + Intergenic
1047473490 8:125202233-125202255 CTGGTTCATCTCACTGGGACTGG - Intronic
1049484791 8:142850058-142850080 CTGGTTCATCGCATTGGGACTGG + Intronic
1050031670 9:1393204-1393226 CTGGTTCATCTCATTGGTACTGG + Intergenic
1050141637 9:2521848-2521870 CTGGCTCATCTCACTGGGACTGG - Intergenic
1050201427 9:3149325-3149347 CTGTCTCATCTCATTGGGACTGG - Intergenic
1050300598 9:4253948-4253970 CTGGCTCATGTCATTGGGACTGG - Intronic
1050386946 9:5101006-5101028 CTGGTTCATCTCATCGGGACTGG + Intronic
1050404390 9:5292873-5292895 CTGGTTCATCTCACTGGGACTGG + Intergenic
1050450743 9:5779298-5779320 CTGGTTCATCTCACTGGGACTGG + Intronic
1050591125 9:7161348-7161370 CTGGTTCATCTCATTGGGACTGG - Intergenic
1050645264 9:7713026-7713048 CTGGTTCATCTCATTGGGACTGG + Intergenic
1050672063 9:8008390-8008412 CTGGTTTATCTCATTGGGACTGG - Intergenic
1050943256 9:11486195-11486217 CCAGCTCATCTCATTGGGACTGG - Intergenic
1051199347 9:14599246-14599268 CCGGCTCATCTCATTGGGACTGG + Intergenic
1051230369 9:14949524-14949546 CCAGCTCATCTCATTGGGACTGG + Intergenic
1051353819 9:16223181-16223203 CCGGTTCATCTCATTGGGACTGG + Intronic
1051614787 9:18997069-18997091 CTGGTTCATCTCATTGGGAATGG + Intronic
1051863482 9:21652192-21652214 CTGGCTCATCTCACTGGGACTGG - Intergenic
1052052807 9:23866939-23866961 CCGGCTCATCTCATTGGGACTGG - Intergenic
1052061631 9:23966992-23967014 CCGGCTCATCTCATTGGGACTGG - Intergenic
1052063720 9:23991796-23991818 CTAGTTCATCTCATTGGGACTGG + Intergenic
1052133995 9:24888546-24888568 TTGGTTCATCTCATTGGGACTGG + Intergenic
1052266434 9:26579151-26579173 ATGGCTCCTCTCGATGAGATAGG - Intergenic
1052281311 9:26735915-26735937 CTGGCTTATCTCATTGGGACTGG - Intergenic
1052326406 9:27220604-27220626 CCGGCTCATCTCATAGGGACTGG + Intronic
1052366290 9:27615260-27615282 CTGGTTCATCTCACTGGGACTGG - Intergenic
1052668099 9:31519705-31519727 CTGGTTCATCTCACTGGGACTGG - Intergenic
1052746729 9:32448696-32448718 CCGGTTCATCTCATTGGGACTGG - Intronic
1052770452 9:32684236-32684258 CTGGTTCATCTCATTGGGGCTGG + Intergenic
1052799978 9:32957908-32957930 CTGGTTCATCTCATTGGGACTGG + Intergenic
1053151152 9:35744020-35744042 CTGCCTCAGCTAGTTGGGTTGGG + Intronic
1053608254 9:39681731-39681753 CCAGCTCATCTCATTGGGACTGG - Intergenic
1053866094 9:42438091-42438113 CCAGCTCATCTCATTGGGACTGG - Intergenic
1054245277 9:62660678-62660700 CCAGCTCATCTCATTGGGACTGG + Intergenic
1054559405 9:66695209-66695231 CCAGCTCATCTCATTGGGACTGG + Intergenic
1054719978 9:68594495-68594517 CCGGCTCATCTCATTGGGACAGG - Intergenic
1054889035 9:70232309-70232331 CTGAGTCATCTCATTGGGACTGG + Intergenic
1054889943 9:70240407-70240429 CTGGTTCATCTCATTGGGACTGG + Intergenic
1054986072 9:71262854-71262876 CCGGTTCATCTCATTGGGACTGG - Intronic
1055053266 9:72000509-72000531 CTGGTTCATCTCATTGGGACTGG - Intergenic
1055339060 9:75262280-75262302 CCGGTTCATCTCATTGGGACTGG - Intergenic
1055494480 9:76841107-76841129 CTGGCTCATCTCATTGGGACTGG + Intronic
1055537964 9:77268490-77268512 CCGGCTCATCTCAGTGGGACTGG - Intronic
1055571680 9:77623571-77623593 CTGGCTCATCTCATTGGGATTGG + Intronic
1055642870 9:78334436-78334458 TTGGTTCATCTCATTGGGACTGG + Intergenic
1055894748 9:81162386-81162408 CCGGTTCATCTCATTGGGACTGG + Intergenic
1056000893 9:82215694-82215716 ATGGCTCATCTCATTGGGACTGG + Intergenic
1056176884 9:84044408-84044430 CTGGCTTATCTCACTGGGACTGG - Intergenic
1056320820 9:85433192-85433214 CCGGCTCATCTCATTGGAACTGG + Intergenic
1056348512 9:85723702-85723724 CTGGTTCATCTCAATGGGACTGG - Intronic
1056385236 9:86091098-86091120 CTGGCTCATCTCACTGGGACTGG - Intronic
1056668020 9:88597419-88597441 CTGGTTCATCTCATTGGGACTGG + Intergenic
1056997190 9:91473727-91473749 CTGGTTCATCTCACTGGGACTGG - Intergenic
1056997871 9:91479994-91480016 TCGGCTCATCTCTTTGGGACTGG - Intergenic
1057460224 9:95254378-95254400 CCGGCTCATCTCACTGGGACTGG + Intronic
1057769137 9:97951398-97951420 CTGGTTCATCTCACTGGGACTGG - Intergenic
1058011947 9:99988656-99988678 CTGGTTCATCTCACTGGGACTGG + Intronic
1058082008 9:100710459-100710481 CTGGTTCATCTCACTGGGACTGG - Intergenic
1058182429 9:101815319-101815341 CTAGTTCATCTCATTGGGACTGG + Intergenic
1058203044 9:102067199-102067221 CTGGTTCATCTCATTGGGACTGG - Intergenic
1058492253 9:105515482-105515504 CCGGTTCATCTCATTGGGACTGG + Intronic
1058559107 9:106204390-106204412 CTGGTTCATCTCACTGGGACTGG - Intergenic
1058614265 9:106809282-106809304 CTGGTTCATCTCATTAGGACTGG + Intergenic
1058819200 9:108713579-108713601 CTGGCTCATCTCATTGGGACTGG + Intergenic
1059088754 9:111334098-111334120 CCGGCTCATCTCACTGGGACTGG + Intergenic
1060556856 9:124512433-124512455 CTGGACCACCTCGTGGGGATGGG + Intergenic
1061552439 9:131345409-131345431 CAGGTTCATCTCATTGGGACTGG - Intergenic
1062759369 9:138330519-138330541 CTGGTTCATCTCACTGGGACTGG - Intergenic
1203492134 Un_GL000224v1:117009-117031 CTGATTCATCTCATCGGGATTGG - Intergenic
1203504758 Un_KI270741v1:58881-58903 CTGATTCATCTCATCGGGATTGG - Intergenic
1203599818 Un_KI270748v1:1291-1313 CTGGTTCATCTCACTGGGACTGG - Intergenic
1185911051 X:3981801-3981823 CTGGTTCATCTCATTGGGACTGG + Intergenic
1186181410 X:6976542-6976564 CCAGCTCATCTCATTGGGACTGG - Intergenic
1186332823 X:8554246-8554268 CCGGCTCATCTCATTAGGACTGG + Intronic
1186370104 X:8937733-8937755 CCGGCTCATCTCATTGGGACTGG - Intergenic
1186585588 X:10869931-10869953 CTGGTTCATCTCATTGGGACTGG + Intergenic
1186599897 X:11025137-11025159 CCAGCTCATCTCATTGGGAATGG - Intergenic
1186773402 X:12839702-12839724 CCAGCTCATCTCTTTGGGACTGG - Intergenic
1186810253 X:13181432-13181454 CTGGTTCATCTCACTGGGACTGG + Intergenic
1186866381 X:13724725-13724747 CTGGTTCATCTCATTGGGACTGG + Intronic
1186937267 X:14463888-14463910 GTGGTTCATCTCATTGGGACTGG - Intergenic
1186961044 X:14736579-14736601 CCGGCTCATCTCACTGGGACTGG - Intergenic
1187248418 X:17574717-17574739 CTGGTTCATCTCATTGGGACTGG - Intronic
1187612086 X:20954029-20954051 CTGGCTCATGGCGCTGAGATTGG - Intergenic
1187660749 X:21544688-21544710 CTGGCTCATCTCACTGGGACTGG + Intronic
1187705468 X:22005471-22005493 CTGGTTCATCTCACTGGGACTGG - Intergenic
1187829217 X:23363671-23363693 CTGGTTCATCTCACTGGGACTGG - Intronic
1187840028 X:23477246-23477268 CTGGCTCATCTCATTGGGGCTGG - Intergenic
1188119551 X:26287297-26287319 CTGGTTCATTTCATTGGGACTGG - Intergenic
1188201596 X:27299319-27299341 ATGGCTCATCTCATTGGGACTGG + Intergenic
1188561336 X:31471489-31471511 CCGGCTCATCTCACTGGGACTGG - Intronic
1188893390 X:35636704-35636726 CCAGCTCATCTCATTGGGACTGG - Intergenic
1188944287 X:36278609-36278631 CTGGTTCATCTCACTGGGACTGG - Intronic
1189039858 X:37530800-37530822 CTGGTTCATTTCATTGGGACTGG - Intronic
1189210899 X:39281045-39281067 TTGGCTCAGCTCATTGGGATTGG - Intergenic
1189337954 X:40182227-40182249 CTGGCTCACCTCCCTGAGATGGG + Intergenic
1189575198 X:42343712-42343734 GTGGCTCATCTCACTGGGACTGG - Intergenic
1189702666 X:43727835-43727857 CTGGTTCATCTCATTGGGACTGG - Intronic
1189937083 X:46080616-46080638 CTGGCTCATCTCATTGGGACTGG - Intergenic
1190209509 X:48433564-48433586 CGGGTTCATCTCATTGGGAATGG + Intergenic
1190622201 X:52298824-52298846 CTGGTTCATCTCATTGGGACTGG + Intergenic
1190648989 X:52550862-52550884 CTGGTTCATCTCATTGGGACTGG + Intergenic
1190959862 X:55235167-55235189 CCAGCTCATCTCATTGGGACTGG - Intronic
1190970606 X:55343783-55343805 CTGGGTCATCTCACTGGGACTGG + Intergenic
1190979473 X:55443336-55443358 TTGGTTCATCTCATTGGGACTGG + Intergenic
1191004988 X:55702222-55702244 CTGGTTCATCTCATTGGGACTGG + Intergenic
1191012487 X:55774933-55774955 CTGGTTCATCTCATTGGGACCGG - Intergenic
1191014516 X:55794191-55794213 TTGGCTTATCCCGTTAGGATGGG + Intergenic
1191024194 X:55896192-55896214 CTGGCTCATCTTATTGGGACTGG + Intergenic
1191051144 X:56194190-56194212 CTGGTTCATCTCATTGGGACTGG + Intergenic
1191088808 X:56598014-56598036 CTGGGTCATCTCATTGGGACTGG - Intergenic
1191096033 X:56673795-56673817 CTGGTTCATCTCATTGGGACTGG + Intergenic
1191138810 X:57094437-57094459 CTGGTTCATCTAATTGGGACTGG + Intergenic
1191153166 X:57242558-57242580 CTGGCTCATCTCATTGGGACTGG + Intergenic
1191168628 X:57418571-57418593 TCGGCTCATCTCATTGGGACTGG - Intronic
1191194336 X:57705480-57705502 CTGATTCATCTCATTGGGACTGG + Intergenic
1191197845 X:57744096-57744118 ATGGTTCATCTCATTGGGACTGG + Intergenic
1191222257 X:58002511-58002533 CTGGTTCATCTCATTGGGTCTGG + Intergenic
1191601863 X:63017229-63017251 CTGGCTAATCTTGTTGAGACTGG - Intergenic
1191631857 X:63330825-63330847 ATGACTCATCTCATTGGGACTGG + Intergenic
1191645610 X:63478118-63478140 CGGGTTCATCTCATTGGGACTGG + Intergenic
1191733430 X:64363714-64363736 CTGGTTCATCTAATTGGGACTGG + Intronic
1191745105 X:64477969-64477991 CTGGTTCATCTCACTGGGACTGG - Intergenic
1191762708 X:64662483-64662505 CAGGTTCATCTCATTGGGACTGG - Intergenic
1191772322 X:64774720-64774742 CTGGTTCATCTCATTGTGAATGG + Intergenic
1191788858 X:64946438-64946460 CCGGTTCCTCTCGTTGGGACTGG - Intronic
1191793691 X:64999238-64999260 GTGGCTCATCTCACTGGGACAGG + Intronic
1191795564 X:65018329-65018351 CTGGTTCATCTCATTGTGACTGG + Intronic
1191809921 X:65175679-65175701 CTGGGTCATCTCATTGGGACTGG + Intergenic
1191848690 X:65569663-65569685 CTGGTTTATCTCATTGGGACTGG - Intergenic
1191882465 X:65856676-65856698 CTGGTTCATCTCATTGGGACTGG - Intergenic
1191886617 X:65894700-65894722 CTGGTTCATCTCATTGGAACTGG - Intergenic
1192018370 X:67357543-67357565 CTAGTTCATCTCATTGGGACTGG + Intergenic
1192371903 X:70521157-70521179 CTGGTTCATCTCATTGGGACTGG - Intergenic
1192395840 X:70780432-70780454 ATGGTTCATCTCATTGGGACTGG + Intronic
1192406367 X:70890317-70890339 CTGGTTCATCTCATTGGGACTGG + Intronic
1192524458 X:71829764-71829786 CCGACTCATCTCATTGGGACTGG + Intergenic
1192598460 X:72437138-72437160 CTGGCTCATCTCAATGGGACTGG + Intronic
1192612866 X:72585546-72585568 CTGGTTCATCTCATTAGGACTGG + Intronic
1192629084 X:72761018-72761040 CTGGTTCATCTCATTGGGACTGG - Intergenic
1192652626 X:72959796-72959818 CTGGTTCATCTCATTGGGACTGG + Intergenic
1192654690 X:72980810-72980832 CTGGTTCATCTCACTGGGACTGG + Intergenic
1192678786 X:73229938-73229960 CTGGTTTATCTCATTGGGACTGG + Intergenic
1192740936 X:73892330-73892352 CTGGCTCATCTCGTTGGGACTGG + Intergenic
1192825870 X:74695814-74695836 TTGGTTCATCTCATTGGGACTGG + Intergenic
1192857328 X:75025827-75025849 CTGCTTCATCTCATTGGGAAGGG - Intergenic
1192922818 X:75724880-75724902 CTGGTTCATCTCATTGGAAATGG - Intergenic
1192949182 X:75998146-75998168 CTGGTTCATATCATTGGGACTGG - Intergenic
1192966641 X:76183612-76183634 CCAGCTCATCTCATTGGGACTGG - Intergenic
1192977374 X:76300360-76300382 ATGGTTCATCTCATTGGGACTGG - Intergenic
1193034390 X:76934026-76934048 CTGGCTCATCTCATTGGGACTGG + Intergenic
1193043891 X:77032115-77032137 CTGGTTCATCTCACTGGGATTGG - Intergenic
1193075097 X:77347273-77347295 ATGGCTCATCTCATTGGGACTGG + Intergenic
1193079254 X:77390004-77390026 CCAGCTCAGCTCATTGGGATTGG + Intergenic
1193081682 X:77412381-77412403 TTGGCTCATCTCATTGGAACTGG - Intergenic
1193228507 X:79013758-79013780 ATGGCTTATCTCATTGGGACTGG - Intergenic
1193245151 X:79219499-79219521 CTGGCTTATCTCATTGGGACTGG - Intergenic
1193254112 X:79326023-79326045 CTGGCTCATCTAATTGGGACTGG - Intergenic
1193266765 X:79481801-79481823 CAGGCTCATCTCATTGGTACTGG + Intergenic
1193284711 X:79697627-79697649 CTGGCTCATTTCATTGGGACTGG - Intergenic
1193338524 X:80319371-80319393 CTGGTTCATCTCACTGGGACTGG + Intergenic
1193352118 X:80475487-80475509 CCGGCTCATCTCACTGGGACAGG - Intergenic
1193389083 X:80905902-80905924 CTGGCTCATCTCACTGGGACTGG + Intergenic
1193402555 X:81063795-81063817 CTGGTTCATCTCATTGGGACTGG + Intergenic
1193477190 X:81981555-81981577 CTGATTCATCTCATTGGGACTGG + Intergenic
1193510024 X:82388397-82388419 CTGACTCATCTCATTGGGACTGG + Intergenic
1193516894 X:82476742-82476764 CTGGTTCATCTCATTGGGACTGG - Intergenic
1193525374 X:82581676-82581698 ATGGCTTGTCTCATTGGGATTGG - Intergenic
1193542400 X:82788369-82788391 CTGTTTCATCTCATTGGGACTGG + Intergenic
1193562572 X:83037590-83037612 CCAGCTCATCTCATTGGGACTGG + Intergenic
1193616090 X:83689233-83689255 CTGGCTCATTTCATTGGGATTGG - Intergenic
1193685336 X:84571278-84571300 CTGGCTCATCTCACTGGGACTGG + Intergenic
1193705223 X:84812982-84813004 CTGGCTCATCTCACTGGGACAGG - Intergenic
1193733898 X:85133669-85133691 CTGGTTCATCTCATTGGGACTGG - Intergenic
1193806537 X:86002527-86002549 CTGATTCATCTCACTGGGATGGG + Intronic
1193871111 X:86799487-86799509 CTGGCTCATCTCATTCGGACTGG + Intronic
1193878646 X:86895653-86895675 CTGGCTCATCTCATTGGGACTGG + Intergenic
1193897171 X:87128415-87128437 CCAGCTCATCTCATTGGGACTGG + Intergenic
1194021168 X:88694297-88694319 CTGGCTCATCTCATTGGGACTGG + Intergenic
1194098498 X:89673917-89673939 CTGGCTCATCTGATTGGGACTGG + Intergenic
1194203435 X:90983105-90983127 CTGGTTCATCTCACTGGGACTGG + Intergenic
1194208594 X:91040516-91040538 CTGGCTCATCTCATTGGGACTGG - Intergenic
1194242475 X:91469582-91469604 CTGGTTCATCTCATTGAGACTGG + Intergenic
1194261634 X:91702862-91702884 CTGTCTCATCTCATTGGGACTGG + Intergenic
1194355693 X:92881766-92881788 CAGGCTCATCTCATTGGGACTGG + Intergenic
1194391075 X:93319226-93319248 CTGGTTCATCTCATTGGGACTGG + Intergenic
1194576440 X:95619274-95619296 CTGGCTCATCTCATTGGGACTGG - Intergenic
1194583820 X:95708840-95708862 CTGGCTCACCTTTTTGGCATGGG - Intergenic
1194624695 X:96214306-96214328 CTGGCTCATCTCACTGGGACTGG + Intergenic
1194726877 X:97409496-97409518 CTGGTTCATCTCACTGGGACTGG + Intronic
1194783217 X:98049697-98049719 CTGCTTCATCTCATTGGGACTGG - Intergenic
1194798490 X:98241184-98241206 CGGGCTCATCTCATTGGGACTGG - Intergenic
1194837567 X:98699455-98699477 CTGGCTCATCTCATTGGGACTGG - Intergenic
1194961141 X:100236821-100236843 CCGGCTCATCTCATTGGGAGTGG - Intergenic
1195158809 X:102151366-102151388 CTGACTCAACTGGTTGGAATTGG + Intergenic
1195345051 X:103941052-103941074 CAGGTTCATCTCATTGGGACTGG - Intronic
1195508219 X:105684157-105684179 TTGGTTCATCTCATTGGGACTGG + Intronic
1195547307 X:106126863-106126885 CTGGTTCATCTCATTGGGGCTGG - Intergenic
1195621998 X:106966410-106966432 CTGGTTCATCTCATTGGGACTGG + Intronic
1195774885 X:108391851-108391873 CCGGTTCATCTCATTGGGACTGG - Intronic
1195828176 X:109025356-109025378 CTGGTTCATCTCATTGGGACTGG - Intergenic
1195833810 X:109089601-109089623 CTGACTCATCTCACTGGGACTGG - Intergenic
1195845930 X:109228887-109228909 CAGGTTCATCTCATTGGGACTGG + Intergenic
1195947357 X:110229631-110229653 CTGGTTCATCTCATTCGGACTGG + Intronic
1195988309 X:110656998-110657020 CTGGTTTATCTCATTGGGAGTGG + Intergenic
1196094472 X:111784547-111784569 CTGGTTCATCTCATTGGGACTGG + Intronic
1196133305 X:112180979-112181001 CCGGCTCATCTCATTGGGACTGG + Intergenic
1196139648 X:112246737-112246759 CTGGTTCATCTCATTGGGACTGG - Intergenic
1196167520 X:112551778-112551800 CTGGTTCATCTCACTGGGACTGG - Intergenic
1196230246 X:113212553-113212575 CTGGTTCATCTCATTGGGACTGG - Intergenic
1196312291 X:114183282-114183304 ATGGCTCATCTCATTGGGACTGG + Intergenic
1196367899 X:114943511-114943533 CTGGCTCATCTCATTGGGACTGG - Intergenic
1196881789 X:120205559-120205581 CTGGCACACCTCGTTGGTGTGGG + Intergenic
1196946685 X:120833401-120833423 CTGGCTCGTCTCATTGGGACTGG - Intergenic
1196960304 X:120993394-120993416 CCGGCTCATCTCATTGGGACTGG - Intergenic
1197051087 X:122060833-122060855 CTGGTTCATCTCATTGGGACTGG + Intergenic
1197191002 X:123648106-123648128 CCGGCTCATCTCAGTGGGACTGG + Intronic
1197350225 X:125373078-125373100 CCGGTTCATCTCATTGGGACTGG - Intergenic
1197477952 X:126946885-126946907 CAGGTTCATCTCATTGGGACTGG + Intergenic
1197489738 X:127102344-127102366 CTGGTTCATCTCATTGGGACTGG + Intergenic
1197846956 X:130813550-130813572 CTGGCTCATCTCACTGGGACTGG + Intronic
1197880839 X:131164766-131164788 CTGGCTCTTCTCATTGGGACTGG - Intergenic
1197906152 X:131428064-131428086 TCGGCTCATCTCATTGGGACTGG + Intergenic
1197926845 X:131656025-131656047 TAGGCTCATCTCATTGGGACTGG + Intergenic
1197959583 X:131989586-131989608 CTGGTTCATCTCATTGGGACTGG + Intergenic
1198072005 X:133158857-133158879 CCGGTTCATCTCATTGGGACTGG + Intergenic
1198085542 X:133278791-133278813 CTGGCTCATCTCATTGGGACTGG + Intergenic
1198259093 X:134950568-134950590 CTGGTTCATCTCATTGGGACTGG + Intergenic
1198295489 X:135282829-135282851 CCAGCTCATCTCATTGGGACTGG - Intronic
1198338279 X:135689486-135689508 CTGTCTCATCCCTTTTGGATGGG + Intergenic
1198555720 X:137791832-137791854 CCAGCTCATCTCATTGGGACTGG + Intergenic
1198571241 X:137959779-137959801 CTGGTTCATCTCACTGGGACTGG + Intergenic
1198663414 X:138996155-138996177 CTGGCTCATCTCACTGGGACTGG + Intronic
1198944632 X:141996649-141996671 CAGGTTCATCTCATTGGGACTGG - Intergenic
1199094388 X:143723273-143723295 CTGGCTCATCTCACTGAGACTGG + Intergenic
1199180941 X:144853746-144853768 CTGGTTCATCTCACTGGGACTGG + Intergenic
1199292293 X:146118961-146118983 CTGGTTCATCTCACTGGGACTGG + Intergenic
1199302958 X:146233979-146234001 CAGGTTCACCTCATTGGGATTGG - Intergenic
1199344120 X:146719158-146719180 GTGGTTCATCTCATTGGGACTGG + Intergenic
1199383729 X:147200396-147200418 CTGGTTCATCTCATTGGGACTGG + Intergenic
1199436523 X:147819169-147819191 CCGGCTCATCTCACTGGGACTGG + Intergenic
1199796160 X:151199925-151199947 CTGGTTCATCTCATTGGGACTGG + Intergenic
1199939664 X:152612614-152612636 CTGGTTCATCTCACTGGGACTGG - Intergenic
1199968572 X:152841324-152841346 CTGGTTCACCTCGTTGGGACTGG - Intronic
1200298553 X:154948077-154948099 CTGTCTCCTCACATTGGGATTGG - Intronic
1200333129 X:155319357-155319379 CCAGCTCATCTCATTGGGACTGG + Intronic
1200388591 X:155918649-155918671 CCGGCTCATCTCATTGGGACTGG - Intronic
1200405960 Y:2811626-2811648 CTGGTTCATCTCATTGGAACTGG - Intergenic
1200451520 Y:3335292-3335314 CTGGCTCATCTGATTGGGACTGG + Intergenic
1200549267 Y:4558539-4558561 CTGGTTCATCTCACTGGGACTGG + Intergenic
1200664039 Y:5998748-5998770 CAGGCTCATCTCATTGGGACTGG + Intergenic
1200737327 Y:6813955-6813977 CTGGTTCATCTCCTTGGAACTGG + Intergenic
1201182110 Y:11358902-11358924 CTGGTTCATCTCATTGGGACTGG + Intergenic
1201314479 Y:12630117-12630139 CTGGTTCATCTCACTGGGACTGG - Intergenic
1201333529 Y:12853553-12853575 CTGGTTCATCTCACTGGGACTGG - Intronic
1201364231 Y:13186140-13186162 CTGGTTCATCTCACTGGGACTGG + Intergenic
1201459452 Y:14206292-14206314 CTGGTTCATCTCACTGGGACTGG + Intergenic
1201583166 Y:15532275-15532297 CTGGTTCATCTCACTGGGACTGG - Intergenic
1201670676 Y:16516466-16516488 CTGGTTCATCTCACTGGGACTGG - Intergenic
1201705019 Y:16927808-16927830 CTGGTTCATCTCACTGGGACTGG + Intergenic
1201783283 Y:17745840-17745862 CTGGTTCGTCTCTTTGGGACTGG + Intergenic
1201818270 Y:18160147-18160169 CTGGTTCGTCTCTTTGGGACTGG - Intergenic
1201853994 Y:18520817-18520839 CCAGTTCATCTCGTTGGGACTGG + Intergenic
1201879327 Y:18799567-18799589 CCAGTTCATCTCGTTGGGACTGG - Intronic
1202064976 Y:20929575-20929597 CTTGTTCATCTCATTGGGACTGG + Intergenic
1202174643 Y:22086097-22086119 CTGGTTCATCTCATTGGGAATGG + Intronic
1202216719 Y:22500285-22500307 CTGGTTCATCTCATTGGGAATGG - Intronic
1202326468 Y:23695783-23695805 CTGGTTCATCTCATTGGGAATGG + Intergenic
1202343081 Y:23889578-23889600 CTGGTTCTTCTCATTGGGACTGG + Intergenic
1202527687 Y:25780507-25780529 CTGGTTCTTCTCATTGGGACTGG - Intergenic
1202544302 Y:25974270-25974292 CTGGTTCATCTCATTGGGAATGG - Intergenic