ID: 1011579665

View in Genome Browser
Species Human (GRCh38)
Location 6:88846345-88846367
Sequence ACTTAGTTCTTTATGTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011579665_1011579666 3 Left 1011579665 6:88846345-88846367 CCTTATTACATAAAGAACTAAGT 0: 1
1: 0
2: 2
3: 22
4: 267
Right 1011579666 6:88846371-88846393 AATGCCTTATTCAAGTAATCTGG 0: 1
1: 0
2: 0
3: 3
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011579665 Original CRISPR ACTTAGTTCTTTATGTAATA AGG (reversed) Intronic
901950726 1:12743816-12743838 ATTTGGTTCTTTATGTCAAAAGG - Intergenic
903407792 1:23113083-23113105 TTCTAGTTCTTTATGTAATTTGG - Intronic
907376330 1:54045174-54045196 ACTTAAATCTATATGTAATTGGG + Intronic
908056419 1:60292059-60292081 ACTTAGGTCTTTATGTAAAAGGG - Intergenic
908156636 1:61360024-61360046 ACTCAGATTTTTATATAATAAGG + Intronic
908286904 1:62615121-62615143 TATTATTTCTTTATGTAATTTGG + Intronic
908890729 1:68844537-68844559 ATTTACTTCTTTATTTGATATGG + Intergenic
908948684 1:69532414-69532436 ACATAGTTCTCTATTTCATAAGG - Intergenic
909161764 1:72160741-72160763 AATTACTACTTTATGTAACAGGG + Intronic
909224382 1:72998284-72998306 ACTTAGTTCTTGATGTTTTTTGG + Intergenic
909786998 1:79625910-79625932 ATTTAGTTCATTATGTAATGTGG + Intergenic
910588880 1:88907827-88907849 ACTTAATTTATTATGAAATAAGG + Intergenic
911129869 1:94376985-94377007 ACTTATTTTTTTCTGTACTATGG - Intergenic
912651266 1:111441723-111441745 ACGCAGTTCTTTATGTGAGAGGG + Intronic
913957135 1:143317132-143317154 ATTTATTTATTTATTTAATAAGG + Intergenic
914051449 1:144142496-144142518 ATTTATTTATTTATTTAATAAGG + Intergenic
914127748 1:144824045-144824067 ATTTATTTATTTATTTAATAAGG - Intergenic
916858593 1:168778193-168778215 ATTTATTTATTTATGAAATAGGG - Intergenic
916967473 1:169965160-169965182 AATTAGTTCTGTATTTAATGTGG - Intronic
917658789 1:177156561-177156583 ACTTATTTATTTATGTCCTATGG - Intronic
919406815 1:197195546-197195568 ACTTAGTTCTTAATAGAAAAGGG - Intronic
923923073 1:238590931-238590953 ATTTTATTCTTTTTGTAATATGG - Intergenic
1062798146 10:359553-359575 TCTTAGTTCTTAATGAAGTATGG + Intronic
1063526038 10:6786725-6786747 ACTGAATTCTTTATGAAAGAGGG + Intergenic
1063712338 10:8491975-8491997 AATTAGGTCTTTGTGTAACAAGG - Intergenic
1064244029 10:13655357-13655379 CGTTGGTTCTTTATCTAATAGGG + Exonic
1064843410 10:19623275-19623297 AAATAGTTCTTTGTGTATTAGGG - Intronic
1065761410 10:28986596-28986618 TGATAGTTCTTCATGTAATAGGG - Intergenic
1066535398 10:36385558-36385580 AATTAGTTCTTTTTGCACTAGGG - Intergenic
1066643090 10:37576034-37576056 AATTAGTTCTTTTTGTACTGGGG - Intergenic
1067303597 10:45037018-45037040 ACATAGATCTTTCTGTACTAGGG + Intergenic
1068162943 10:53290892-53290914 ACTTATTTTTTTAAGTAACAAGG - Intergenic
1068528110 10:58154133-58154155 ACTTATTTGTTGATATAATATGG + Intergenic
1069267894 10:66486319-66486341 AGTGAGTTCATTATGTAATTTGG - Intronic
1070681522 10:78452368-78452390 ACTAAGAGCTTTATGTTATATGG + Intergenic
1070978512 10:80625368-80625390 CTTAAGTTCTTTATGTAAAATGG + Intronic
1071735954 10:88301178-88301200 ATTTAATAGTTTATGTAATATGG + Intronic
1071758833 10:88577104-88577126 CCTTAGTTCTTTATGCAACCTGG - Intronic
1071833654 10:89397010-89397032 ATTTGGTTCTTTATAAAATAGGG + Intronic
1071886630 10:89958374-89958396 CCTTAGTTAATTATGTAAGAGGG + Intergenic
1072103139 10:92248135-92248157 AGTAAGTTCCTTATGTAAAATGG + Intronic
1072565829 10:96615897-96615919 ACTTGGTTCTTCATGTAATAGGG + Intronic
1074191157 10:111138983-111139005 AGGTAGGTGTTTATGTAATAAGG + Intergenic
1074803006 10:117020642-117020664 AATTAGTTTTTTTTTTAATATGG - Intronic
1075355341 10:121767596-121767618 ACTTAGTTCTCTAAATATTATGG - Intronic
1079711353 11:23686451-23686473 ATTTATTGCTTTATCTAATATGG + Intergenic
1079711356 11:23686538-23686560 ACTTATTGCTTTATCTAATATGG + Intergenic
1080432264 11:32210001-32210023 ACACAGTTCTTTGTGTACTATGG - Intergenic
1082168899 11:48978210-48978232 ACTAAGTTCATTGTGTGATATGG + Intergenic
1082964648 11:58954514-58954536 TCTTAGTTCTGCATGTGATAAGG + Intronic
1084074995 11:66767560-66767582 ACTTAGCTCTTTATACAGTATGG + Intronic
1086930784 11:92690639-92690661 ACTTAGTTGTTTATTTTTTAAGG + Intronic
1086983644 11:93225453-93225475 ACTTAGTTCTTTATTAAAAGAGG + Intergenic
1087968184 11:104445389-104445411 ACTTAGTTCTTTAATCAATGTGG - Intergenic
1088932080 11:114362450-114362472 ACTTAGGTTTTTTTGTAATTTGG - Intergenic
1089279830 11:117366063-117366085 ATTTAGTTCTTTTTGTCACATGG + Intronic
1093625694 12:21344870-21344892 AATTAGTTATTTAAGAAATAGGG - Intronic
1095753539 12:45737225-45737247 ACTTAGATATTCATGGAATATGG - Intronic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1096899839 12:54865653-54865675 ACTTAGTTCTTGATATTTTAGGG + Intergenic
1098453379 12:70645289-70645311 ATTTAGGTATTTATCTAATAAGG + Intronic
1098570362 12:71981333-71981355 ACTTAGTTCTGTAGGCAACAGGG + Intronic
1099210294 12:79778063-79778085 AATTATTTCTATAGGTAATATGG + Intronic
1099682692 12:85847994-85848016 ACATAGTTATTTTTGTCATAAGG + Intergenic
1099711682 12:86234364-86234386 ACTCAGTCCTTTATGTCATGTGG + Intronic
1099852615 12:88121515-88121537 ATTTAGTTCTTTATTTCAAATGG - Intronic
1101866088 12:108520616-108520638 ATGTAGTGCTCTATGTAATATGG + Exonic
1103761673 12:123254627-123254649 ACTTGTTTTTTTATGTAAAAAGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105318956 13:19298481-19298503 AGTTAGTTCCTTTTGAAATAAGG + Intergenic
1106632848 13:31495215-31495237 ATTTAGTTTTATATATAATATGG - Intergenic
1107284169 13:38771426-38771448 TCTTATTTCTTCAGGTAATACGG - Intronic
1107643261 13:42466631-42466653 ATTTATTTATTTATTTAATATGG - Intergenic
1108228129 13:48311287-48311309 ACTTACTTATTTTTGTGATATGG + Intronic
1108812745 13:54249071-54249093 ACTTATTTATTTATTTAAGATGG + Intergenic
1109512861 13:63402555-63402577 AATTAATTTTTTATGAAATATGG - Intergenic
1109957263 13:69584627-69584649 ACTTAGTTCTTTGTCAAATCAGG + Intergenic
1111373089 13:87342870-87342892 TCTTAGTTGTTGATGTAATGTGG - Intergenic
1112823200 13:103359680-103359702 ACTGAGTTCCTTATGTATTTTGG - Intergenic
1113993366 14:16046458-16046480 ACTGAGTTCTTAAAGTATTATGG + Intergenic
1114859201 14:26494261-26494283 CCTTAGCTCTTTATGTCCTATGG + Intronic
1115677071 14:35688679-35688701 AATTCCTTCTTTTTGTAATATGG + Intronic
1115845129 14:37522339-37522361 ACTTAGTATTTTATGTTATATGG - Intronic
1116327965 14:43557761-43557783 ACTTTTTACTTTATCTAATATGG - Intergenic
1116706186 14:48304646-48304668 ATTTGGTTCTTTATGTCAAAAGG + Intergenic
1117407523 14:55418695-55418717 TCTTAGTTCTTTATGCTAGAGGG + Intronic
1118409653 14:65465342-65465364 ACTTACTTATTTATGAAATGGGG + Intronic
1118713917 14:68545870-68545892 ACTTTGTTCTGTAGGTAATGAGG + Intronic
1119903900 14:78284400-78284422 ACTTAGTTTTATATATATTAGGG - Intronic
1121247108 14:92469558-92469580 TCTTAGTTCTGTATTTAAGAGGG + Intronic
1202831485 14_GL000009v2_random:39150-39172 ACTTAGTTCTTAATTTTACATGG + Intergenic
1123394885 15:19923081-19923103 AATTAATTCTTTATGTTAGACGG + Intergenic
1123890906 15:24777655-24777677 TCTTAGTTCTTTATATTGTAAGG + Intergenic
1125323042 15:38509174-38509196 TCTAAGTTCTTTACTTAATAAGG - Intronic
1129066998 15:72913661-72913683 ACTTATTGCTTTGTGTATTAGGG + Intergenic
1129943944 15:79523155-79523177 ACTCAATTCTTAGTGTAATAGGG + Intergenic
1129995514 15:80001744-80001766 AGTCAGCTCTTTATATAATATGG - Intergenic
1131646056 15:94346049-94346071 ACTTATTTCTCTACATAATAAGG + Intronic
1133366903 16:5217338-5217360 TCTTAGTTGTATCTGTAATATGG + Intergenic
1134343828 16:13370911-13370933 TCTTAGTGCTTTAAGTGATAGGG + Intergenic
1136603591 16:31315154-31315176 ATTGAGTTCTTTATGTGTTATGG + Intronic
1136770373 16:32833644-32833666 AATTAGTTCTTTATGTTAGACGG - Intergenic
1137899485 16:52250987-52251009 ACTTAGCTATTTATCTAATTCGG + Intergenic
1138741141 16:59312055-59312077 AATTAGCTCTTTATGCAACAAGG - Intergenic
1139196812 16:64929245-64929267 TCTGAGTTCTTTATGTATTTTGG - Intergenic
1139293919 16:65883264-65883286 ATGTAGTTCTTTATGTATTCTGG - Intergenic
1140578563 16:76201781-76201803 CCTTAGTAATTTATATAATATGG - Intergenic
1203072794 16_KI270728v1_random:1095751-1095773 AATTAGTTCTTTATGTTAGACGG - Intergenic
1143984520 17:10900210-10900232 ACTTACCTTTTCATGTAATAAGG + Intergenic
1144390552 17:14789585-14789607 ACTTAGCACTTTATGTACTATGG + Intergenic
1144503276 17:15807834-15807856 AATTAGATCTGTATGTAAAATGG - Intergenic
1145165456 17:20610541-20610563 AATTAGATCTGTATGTAAAACGG - Intergenic
1146121470 17:30199544-30199566 AGTTTGTTCTTTAAGAAATAGGG + Intronic
1150413253 17:64964721-64964743 ATTTATTTATTTATGAAATAGGG - Intergenic
1151971754 17:77460936-77460958 ACTTCCTTCTTTATTTAAAAGGG + Intronic
1154474938 18:14747097-14747119 ACTTTGTACTTTAAGTAACATGG - Intronic
1156258109 18:35418528-35418550 AATTACTTCTTGAAGTAATAAGG - Intergenic
1159788685 18:72748592-72748614 ACTACTTTCTTTATGTAATTTGG - Intronic
1159790391 18:72772151-72772173 ACGTAGTTCTCTGTATAATATGG + Intronic
1159838326 18:73368213-73368235 AATTTGTTCTTTATGTGAGATGG - Intergenic
1159971219 18:74656810-74656832 ACTTTGATATTTATGTAATCAGG + Intronic
1160130414 18:76220276-76220298 ACTTAATTCATTATGTATTGGGG + Intergenic
1162590161 19:11586240-11586262 ATTTATTTATTTATGAAATAGGG - Intronic
1163045702 19:14640291-14640313 ACTTATTTATTTATTTAAGATGG + Intronic
1163625577 19:18387519-18387541 ACTTATTTATTTATTTATTATGG - Intronic
1166162098 19:40961883-40961905 ACTTATTTATATATGTAAGAAGG + Intergenic
1166599008 19:44077358-44077380 TCTTATTCCTTTATGTATTAAGG + Intronic
1168429497 19:56266787-56266809 ACTTGGTTCTCTATTAAATATGG - Intronic
1202641213 1_KI270706v1_random:88590-88612 ACTTAGTTCTTAATTTTACATGG - Intergenic
1202671138 1_KI270709v1_random:53574-53596 CCTTAGTTCTTTATATTAGACGG + Intergenic
1202681493 1_KI270712v1_random:8335-8357 AATTAGTTTTTTATGTTAGACGG + Intergenic
1202690848 1_KI270712v1_random:94921-94943 ATTTATTTATTTATTTAATAAGG + Intergenic
925320076 2:2958866-2958888 TATGAGTTCTTTATGTATTATGG - Intergenic
926852704 2:17217711-17217733 AATTATTTCTTTATGCAATATGG + Intergenic
927071324 2:19532485-19532507 CCTTAGTTCATTCTGTAAAATGG - Intergenic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
927992952 2:27461124-27461146 ACTTAGTTCTTTGTGTTGTAGGG - Intronic
928869888 2:35963846-35963868 TCTTATTAATTTATGTAATAGGG - Intergenic
929741437 2:44605126-44605148 TCTTAATTATTTGTGTAATAGGG + Intronic
930949705 2:57125667-57125689 ACTTAGGTGTTTAAGTTATATGG - Intergenic
931332052 2:61297689-61297711 ACTTAGTTCTTTTGGTATAATGG + Intronic
931599165 2:63985735-63985757 AGTTGGTTCTCTATGCAATAAGG + Intronic
931915692 2:66952590-66952612 ACTTAGTTCTTTCTGCATTGAGG + Intergenic
934000565 2:87707281-87707303 ACATAGTTCCTTATGTACTGTGG + Intergenic
934068150 2:88359122-88359144 ATTTATTTATTTATGAAATATGG - Intergenic
934239732 2:90255242-90255264 ATTTATTTATTTATTTAATAAGG - Intergenic
934273462 2:91561498-91561520 ATTTATTTATTTATTTAATAAGG + Intergenic
934804917 2:97212226-97212248 AAGTAGTTATTTATGTAATTTGG + Intronic
934940197 2:98495535-98495557 ACTTAGTTTTATATGTTTTAAGG + Intronic
935507094 2:103919149-103919171 ATTTTGTTCTTTATGTAATGGGG - Intergenic
936059987 2:109288332-109288354 CCATAGTTCTTAATGTATTAGGG + Intronic
936363701 2:111831891-111831913 ACATAGTTCCTTATGTACTGTGG - Intronic
937607760 2:123822185-123822207 ACTTAAGACTTAATGTAATATGG + Intergenic
941837717 2:170044572-170044594 ATTTAGTTCTTTATGTACAAGGG + Intronic
944076738 2:195741226-195741248 AAATAGTTCTTAATGTAATAGGG + Intronic
944938868 2:204600606-204600628 GCTTTGTTCTTTTTGTCATAGGG + Intronic
947328657 2:229004962-229004984 AATTTCTTCTTTATATAATAAGG - Intronic
948581491 2:238989953-238989975 ACTTAGTTTTATATGTTTTAGGG + Intergenic
1169364215 20:4978136-4978158 CCTTAGATCTTCATGTAATTAGG - Intronic
1169493626 20:6092222-6092244 TCTTATGTGTTTATGTAATAAGG - Intronic
1169774382 20:9236337-9236359 AAGTAGTTCTTTATGCTATAAGG - Intronic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1170171028 20:13412792-13412814 ACATATTTGTTTATGTAATCTGG + Intronic
1171811657 20:29749401-29749423 ACTGAGTTCTTAAAGTATTATGG - Intergenic
1176610672 21:8883981-8884003 ACTTAGTTCTTAATTTTACATGG + Intergenic
1177049620 21:16216219-16216241 ACTTATCTCTTTTTGTTATATGG + Intergenic
1177633368 21:23754925-23754947 ATTTAGTTCTTGCTGTAAAATGG + Intergenic
1180313902 22:11261055-11261077 ACTGAGTTCTTAAAGTATTATGG - Intergenic
1180360748 22:11893285-11893307 ACTTAGTTCTTAATTTTACATGG + Intergenic
1181354066 22:22288172-22288194 ATTTATTTATTTATTTAATAAGG + Intergenic
949452839 3:4206095-4206117 GCTTGGTGCTTTATTTAATATGG + Intronic
949480373 3:4488539-4488561 TCTTAGTACTCTATGCAATATGG - Intergenic
952044665 3:29304112-29304134 ACTGAGTTCTCTATGTGATATGG - Intronic
952603846 3:35119760-35119782 ACTTGGTTCTTTCTTTATTATGG - Intergenic
953048503 3:39317452-39317474 GCTTAGTTTTATATGTTATAGGG - Intergenic
953542224 3:43831405-43831427 CCTTAGTTCTATATGTAAATGGG + Intergenic
954251738 3:49373020-49373042 ACTTATTTCTTTCTGTCCTAGGG - Intronic
956491728 3:69779604-69779626 ACTTTGTTCTGTATGTGATGGGG + Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
959669867 3:108964370-108964392 ATTTTGATGTTTATGTAATAAGG + Intronic
962481818 3:135804560-135804582 CCTTATTCCTTTATGGAATAAGG - Intergenic
963202925 3:142602669-142602691 AGTAAGTTCTCTATGTAATTAGG - Intronic
963321819 3:143816991-143817013 GATTAGTTCTTAATGTAATCTGG + Intronic
963540240 3:146577772-146577794 ATTTTGTTCTTTCTGTAATCTGG - Intronic
964063151 3:152549934-152549956 TTTTAGTTCTTTATATAAAATGG + Intergenic
964560980 3:157996003-157996025 ACTTTTTTCTTCATGTAATTTGG + Intergenic
965627889 3:170700097-170700119 ACTTAATTCATTATGTAATTAGG - Intronic
1202737355 3_GL000221v1_random:18767-18789 ACTTAGTTCTTAATTTTACATGG + Intergenic
968527207 4:1066667-1066689 TTTTAGTTCTTTATGTATTCTGG + Intronic
969387755 4:6867157-6867179 AGTCAGTTCTTTATGTTTTAGGG + Intronic
970321269 4:14877827-14877849 GCTTAGGTTTTTATGTAACATGG - Intergenic
970848911 4:20578099-20578121 ACATTGTTCTTTATGTGATCTGG + Intronic
973384724 4:49499117-49499139 ACTTAGTTCTTAATTTTACATGG - Intergenic
974879683 4:67739579-67739601 TCTCAGTTATTTATGAAATATGG + Exonic
975360187 4:73460592-73460614 ACGTGGTTATTTATGTATTAAGG + Intergenic
976077420 4:81315463-81315485 ACTTTCTTCTTTATGTGCTAAGG + Intergenic
976771692 4:88660156-88660178 TCTTGGTTCTTTAAGTGATATGG - Intronic
979296013 4:119032943-119032965 ACTTAGTTCCTTAAGTAACTGGG - Intronic
983311312 4:166064923-166064945 AATTACATATTTATGTAATAAGG + Intronic
983614626 4:169688521-169688543 ACTGATCTCTTTATGTAAGAAGG + Intronic
985354614 4:189104709-189104731 ACTTATTTCTTTACCTAAAATGG + Intergenic
1202768578 4_GL000008v2_random:174449-174471 ACTTAGTTCTTAATTTTACATGG - Intergenic
986434664 5:7717142-7717164 ACTTGGTTCTATATGAAAAATGG - Exonic
988053754 5:26064822-26064844 ACATAGTACTTTATGTACTTTGG + Intergenic
988414894 5:30934039-30934061 AGTTATTTATTAATGTAATAAGG - Intergenic
988562990 5:32297743-32297765 ATTTATTTCTTTCTTTAATAGGG - Intronic
990820064 5:59828794-59828816 ACTCAGTGCTTTATCTACTAGGG - Intronic
993010178 5:82472265-82472287 AGTTTTTTCTTAATGTAATATGG + Intergenic
993335070 5:86646783-86646805 ACTTAATCCTCTAAGTAATAGGG + Intergenic
995095263 5:108228484-108228506 ACTTTGTTCATTCTATAATATGG + Intronic
996951420 5:129130705-129130727 ATTGAGTTCTTTATGTATTTTGG + Intergenic
998670816 5:144351256-144351278 ACTTGATTCTGTAGGTAATAAGG + Intronic
1000813753 5:165894047-165894069 ATTTAGTTCTTCATGAAATTGGG - Intergenic
1000859798 5:166443271-166443293 ACTTTTTGCTTTATGTAATCTGG + Intergenic
1001499087 5:172214724-172214746 AATTTGTTTTTTATTTAATATGG + Intronic
1001931343 5:175675346-175675368 ACTTAGTTCTGAAGATAATAAGG - Intronic
1002027901 5:176407898-176407920 ACTTATTTTCTTATGTAAGAGGG - Intronic
1004711325 6:18173387-18173409 TTGTAGTTCTTTATGTAATCTGG + Intronic
1005839171 6:29729767-29729789 TCATAGTTCTTTATGTATTCTGG - Intronic
1007439349 6:41844745-41844767 ACCTATTTCTTTATGAATTATGG + Intronic
1008945531 6:57092184-57092206 ACATACTTCTTTATGAACTATGG + Intronic
1009688636 6:66997126-66997148 ACCTATTTCTCTTTGTAATAAGG - Intergenic
1009702143 6:67198469-67198491 ACTTGGAATTTTATGTAATAAGG + Intergenic
1010247560 6:73675860-73675882 ACTTAGTTTTTTGTGTATGAAGG - Intergenic
1010595789 6:77762269-77762291 ACTTATTTATTTATTTAACATGG + Intronic
1011357075 6:86482275-86482297 CCTTAGTTATTTATTTAACAGGG - Intergenic
1011579665 6:88846345-88846367 ACTTAGTTCTTTATGTAATAAGG - Intronic
1011905719 6:92364774-92364796 TCATAGTTCTTTTTGTGATATGG + Intergenic
1012056936 6:94425107-94425129 ATTTATTTGTTTATGTAATGAGG - Intergenic
1012502685 6:99906765-99906787 ACTTAGATCTTCATGAAATAGGG + Intergenic
1012984688 6:105863226-105863248 ACTTAGTTCTTTCTGTTTTGAGG + Intergenic
1013027103 6:106286491-106286513 ACTTAGAACTTTATGAAGTAAGG - Intronic
1015089944 6:129344070-129344092 ATTTAATTTTCTATGTAATAAGG + Intronic
1015384461 6:132606279-132606301 ACTTATTTATTTATTTAATTTGG - Intergenic
1017698226 6:157040245-157040267 ACCTAGACCTTTATGAAATAAGG - Intronic
1017728688 6:157295283-157295305 AATTAATTCTTTATGGAAGAGGG - Intronic
1021895722 7:25233524-25233546 ACTTAAATCTTTATGTAGAAGGG + Intergenic
1022244290 7:28543128-28543150 ATTTAGTTATTTGTGTTATATGG + Intronic
1022601519 7:31764712-31764734 ATTGAGTTATTTATGGAATAAGG - Intronic
1024423236 7:49194654-49194676 AATTAGTGCTTTGTCTAATAAGG - Intergenic
1025479951 7:60970250-60970272 AATTAGTTCTGTATGTTAGACGG + Intergenic
1025552009 7:62262103-62262125 AATTAGTTCTTTATGTTAGACGG - Intergenic
1025557814 7:62331206-62331228 AATTACTTCTTTATGTTAGAGGG - Intergenic
1028436958 7:90815149-90815171 ACTTAGGGCTTTATGTTCTAAGG + Intronic
1028687446 7:93607283-93607305 ACTCTCTTCTTTATTTAATATGG + Intronic
1032632765 7:133671560-133671582 ACTTATTTATTTATTTAAGATGG - Intronic
1034107474 7:148502540-148502562 CCTGGGTTCCTTATGTAATAAGG - Intergenic
1035006664 7:155668068-155668090 ACTAAGATATTTACGTAATAAGG - Intronic
1035409492 7:158627691-158627713 ATTTATTTCTTTATGCCATATGG - Intergenic
1035755411 8:2027293-2027315 ACTTATTTATTTATGAGATATGG + Intergenic
1038324160 8:26559614-26559636 TCTTAGTTCTTTAAGTAATTTGG + Intronic
1039385238 8:37129819-37129841 ACTCAGTCCATTATCTAATAGGG - Intergenic
1040727696 8:50402621-50402643 AATTAATTCTCTATGTAAAATGG - Intronic
1040824995 8:51611261-51611283 ACTTATTTCTGTTTCTAATAAGG - Intronic
1042488641 8:69374807-69374829 ATTTATTTATTTATGTAATTGGG - Intergenic
1042584229 8:70317515-70317537 ACTTAGTTCTTTAGAAATTAAGG - Intronic
1043125715 8:76391778-76391800 ATTTATTTATTTTTGTAATATGG - Intergenic
1043722722 8:83566134-83566156 ACTTAATTCTTTTTTTAATATGG + Intergenic
1044099101 8:88108507-88108529 TTTTTCTTCTTTATGTAATATGG + Intronic
1045965530 8:108020441-108020463 ACTTTGTTCTTTAGGTAGTAGGG - Intronic
1046069612 8:109234557-109234579 ATTTTGCTCTTTATGTATTAAGG + Intergenic
1046281589 8:112040315-112040337 ACTTAGTTCCTTATTTCCTATGG - Intergenic
1046340610 8:112849390-112849412 GCTTAGTTCTTTACATTATATGG + Intronic
1046414152 8:113889479-113889501 AAGTGTTTCTTTATGTAATAAGG + Intergenic
1046692887 8:117305775-117305797 AGGTAGTTCTTTATGACATAAGG - Intergenic
1048480384 8:134785235-134785257 AAGTAGTCCTTTATGTAATTTGG + Intergenic
1050933864 9:11367437-11367459 ACCTAGTTCTATATATAATTTGG + Intergenic
1050937039 9:11411920-11411942 ACTTAAGTCTTTATTTAATATGG + Intergenic
1051156539 9:14153802-14153824 ACTTCATTATTTATGAAATAGGG - Intronic
1052020146 9:23516478-23516500 ACTTATTTCTCTATATTATAAGG - Intergenic
1052535740 9:29744522-29744544 ATTTAGTTGTTTATAGAATAAGG - Intergenic
1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG + Intronic
1055117819 9:72624517-72624539 ACTTAGTTATTCATTTCATATGG - Intronic
1055882523 9:81018353-81018375 ACTTAAACCTTAATGTAATAGGG - Intergenic
1056164047 9:83924794-83924816 ACATATTTCTTTATTTAATTTGG - Intergenic
1056242114 9:84658095-84658117 AGTTTGGTCTTTATGTAATTGGG + Intergenic
1056898160 9:90570911-90570933 ACTTACTTTTTTATGTATCATGG + Intergenic
1057541363 9:95975012-95975034 ATTTTATTCTTTGTGTAATATGG - Intronic
1058728290 9:107824604-107824626 ATTTATTTTTTTATTTAATAAGG + Intergenic
1061956647 9:133966404-133966426 ACCGAGTTCTTTATGTATTCTGG - Intronic
1203362282 Un_KI270442v1:227268-227290 ACTGAGTTCTTAAAGTATTACGG - Intergenic
1203706078 Un_KI270742v1:49217-49239 ACTTAGTTCTTAATTTTACATGG + Intergenic
1186456944 X:9717158-9717180 AGTAAGTGCTTTATGTAAGAAGG + Exonic
1187491379 X:19754904-19754926 ACTTATTTCTTTATTTAACTGGG + Intronic
1190411010 X:50137132-50137154 ACCTAGTTCTTCTTGCAATAAGG - Intergenic
1193910015 X:87292812-87292834 AATTAGTAGTTTATGTAATGTGG - Intergenic
1195784281 X:108501764-108501786 TCTTAGTGCTTTTTGTAATGTGG + Intronic
1197888404 X:131241577-131241599 ACTTACTTCTTTATGTACCAAGG - Intergenic
1198744962 X:139880506-139880528 AGGTAGTTCTTGATGTAATCAGG + Intronic
1199116853 X:144002551-144002573 AGTTGGTTCTTTATGTCAAAAGG + Intergenic
1199687363 X:150276165-150276187 ACTTAGATCATTATGGAAAAAGG + Intergenic
1201433256 Y:13927816-13927838 ACTTATTTCTATATGAAATATGG - Intergenic