ID: 1011588947

View in Genome Browser
Species Human (GRCh38)
Location 6:88952239-88952261
Sequence CTGTAGCCACTGTAGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 1, 2: 21, 3: 75, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011588947_1011588952 -7 Left 1011588947 6:88952239-88952261 CCCATCCCCTACAGTGGCTACAG 0: 1
1: 1
2: 21
3: 75
4: 415
Right 1011588952 6:88952255-88952277 GCTACAGCAAGCCCCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011588947 Original CRISPR CTGTAGCCACTGTAGGGGAT GGG (reversed) Intronic
900280375 1:1863438-1863460 CTGCTGCCACTGGAGGGGTTTGG + Intronic
900997026 1:6128307-6128329 CTGCAGCCCCTGCTGGGGATGGG - Intronic
905203494 1:36329581-36329603 TTGTGGCCACTGTGGGGGAAGGG - Intergenic
905497418 1:38403590-38403612 CTGCAGCCGCTGTGGGGCATGGG - Intergenic
906569300 1:46822597-46822619 CTGCAGCAGCTGTGGGGGATGGG + Intergenic
906753943 1:48291399-48291421 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
906808229 1:48800986-48801008 CTGTGGCCGCTGTGGGGCATGGG + Intronic
906910527 1:49944019-49944041 CTGTTGCTGCTGTGGGGGATGGG - Intronic
907633348 1:56106869-56106891 ATGTGGCCACTGTGGGGGATGGG - Intergenic
908175118 1:61547673-61547695 CTGTGGCTGCTGTAGGGGATGGG + Intergenic
909576557 1:77183290-77183312 ATGTTGCCACTGCTGGGGATGGG - Intronic
910077599 1:83299008-83299030 CTGTAACTGCTGTGGGGGATGGG - Intergenic
913236199 1:116785365-116785387 CTGTGACTGCTGTAGGGGATGGG - Intergenic
913418234 1:118635894-118635916 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
914239894 1:145846337-145846359 CTGTGTCCACTGGAGGGGAGAGG + Intronic
914455548 1:147833325-147833347 CTGCGGCCGCTGTGGGGGATGGG + Intergenic
915332416 1:155121362-155121384 CTGTTGCTACTGGAGGAGATGGG - Intergenic
915417643 1:155754374-155754396 CTGTAGCCACTGTAGCAGCAAGG - Exonic
915920938 1:159974619-159974641 CTGAAGCCCCTGCTGGGGATCGG - Intergenic
918154992 1:181836055-181836077 CTGCAGCTACTGGTGGGGATAGG - Intergenic
918972123 1:191433188-191433210 CTATGCCCACTGTGGGGGATGGG - Intergenic
919214454 1:194534520-194534542 CTGAAGCTGCTGTGGGGGATTGG + Intergenic
919230355 1:194765138-194765160 ATGTTGCCACTATTGGGGATAGG + Intergenic
919549494 1:198966565-198966587 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
920803601 1:209211657-209211679 ATTTAGCCTCTGTAGGGGATAGG - Intergenic
922396068 1:225202363-225202385 CTGTGGCTGCTGTGGGGGATAGG + Intronic
1063495084 10:6499822-6499844 ATCTAGCCACTGTTAGGGATTGG - Intronic
1064532673 10:16326056-16326078 CTGTAGCCAGTGAAGGTGAGTGG + Intergenic
1064557206 10:16559396-16559418 CTGTGGCTGCCGTAGGGGATGGG + Intergenic
1067397969 10:45941806-45941828 CTGTAGTAACTGAAGGGCATGGG - Intergenic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1067866287 10:49910899-49910921 CTGTAGTAACTGAAGGGCATGGG - Intronic
1068446863 10:57136004-57136026 ATGTTGCCACTATTGGGGATGGG - Intergenic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1068872879 10:61964100-61964122 CATTAGCAACTGTAGGGAATAGG + Intronic
1068936695 10:62642777-62642799 CAGGAGCCACTGAAGTGGATAGG + Intronic
1069325283 10:67225192-67225214 CTGTGGCTGCTGTAGGGGGTGGG - Intronic
1071484728 10:86091454-86091476 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1072769571 10:98126297-98126319 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1072839074 10:98750458-98750480 CTGAAGAGACTGAAGGGGATGGG + Intronic
1072871637 10:99126277-99126299 CTGCGGCCACTGTGGGGGATTGG - Intronic
1074986267 10:118662604-118662626 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1075504627 10:123011015-123011037 CTGAGGCCACTTTAGGGAATTGG + Intronic
1075660626 10:124193254-124193276 CTGTGGCTGCTGTAGGGGATGGG + Intergenic
1075982760 10:126755573-126755595 CTGCAGCTGCTGTAGGGGATGGG + Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078288589 11:9983398-9983420 ATGTAGCTGCTGTGGGGGATGGG - Intronic
1078587971 11:12610479-12610501 CTGCGGCCACTTTGGGGGATGGG - Intergenic
1080153035 11:29076247-29076269 CTGTGGCAACTGTAGGGGATGGG + Intergenic
1080489973 11:32751638-32751660 ATGTGGCCACTGCAGGGGCTGGG + Intronic
1081195262 11:40152759-40152781 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1082013988 11:47470725-47470747 CTGTAGCCACAGCCAGGGATGGG - Exonic
1082140495 11:48603233-48603255 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1082567685 11:54700332-54700354 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1082679729 11:56152851-56152873 CTGCAGCCACTGTAGGTAATGGG - Intergenic
1082778810 11:57270143-57270165 TTGTAGCTACTGTATTGGATAGG - Intergenic
1082916852 11:58446618-58446640 CTGTGGCTTCTGTAGGGGATGGG - Intergenic
1083072846 11:60004007-60004029 CTACAGCTGCTGTAGGGGATGGG - Intergenic
1085654489 11:78300629-78300651 TTATGGCGACTGTAGGGGATGGG + Intronic
1085747818 11:79129703-79129725 CTGTGGCTGCTGTAGGGGATGGG - Intronic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1086300680 11:85423601-85423623 CTGCAGCTGCTGTGGGGGATGGG + Intronic
1086315696 11:85589536-85589558 CTGCAGCCACTGTGGGGGTGTGG + Intronic
1086573367 11:88309918-88309940 CTGTAGAAACTGTAGGGAGTAGG - Intronic
1086869359 11:92018310-92018332 CTGTAGCCACTATGGGGGATGGG + Intergenic
1087206763 11:95404545-95404567 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
1087468846 11:98545982-98546004 CTGTGGCTGCTGTCGGGGATGGG - Intergenic
1087609991 11:100422638-100422660 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
1087630798 11:100648090-100648112 CTGCAGCCCCTGTGGGGGATGGG - Intergenic
1087688940 11:101297465-101297487 CTGTGGCTGCTGTGGGGGATTGG + Intergenic
1087804321 11:102539281-102539303 CTGCAGCTACTGTCAGGGATGGG - Intergenic
1087902016 11:103651517-103651539 CTGCAGCTACTGTGGGGTATGGG - Intergenic
1088179468 11:107092705-107092727 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1088264791 11:107978952-107978974 ATGTTGCCACTGCTGGGGATGGG - Intergenic
1088387490 11:109275655-109275677 CTGTGGTCACTGTCAGGGATGGG + Intergenic
1089086853 11:115826961-115826983 CTGTTGCCACTGAAGGTGAATGG - Intergenic
1089836950 11:121379143-121379165 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1090757311 11:129803817-129803839 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1091043246 11:132301892-132301914 CTGTAGCTACTGGAGAGGAGAGG - Intronic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1091843826 12:3639316-3639338 CTGTAGGCAGTGCAGGGAATCGG + Intronic
1092693612 12:11144261-11144283 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1093172563 12:15876015-15876037 CTATAGCTGCTGTGGGGGATGGG - Intronic
1093594541 12:20945218-20945240 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1094447359 12:30546197-30546219 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1094802152 12:34048969-34048991 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
1095115280 12:38344878-38344900 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
1095205228 12:39431761-39431783 CTGTTGCCTCTGTAGCAGATTGG - Intronic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1097302546 12:58034272-58034294 CTGTGGCCATTGTTGGGGATGGG + Intergenic
1097604000 12:61730583-61730605 CTGCAGCCACTGTGTGGTATGGG + Intronic
1097760542 12:63459497-63459519 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1098563871 12:71908956-71908978 CTGTTACCACTGTAGGGAATAGG + Intronic
1099392443 12:82097851-82097873 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1099473020 12:83074513-83074535 CTGCAGCTGCTCTAGGGGATGGG + Intronic
1099777423 12:87151342-87151364 CTGTGGCTACTGTGGGGGATGGG + Intergenic
1100918552 12:99455737-99455759 CTGTGGCTACTGTTGGGGGTGGG - Intronic
1101290378 12:103361824-103361846 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1102731199 12:115111932-115111954 ATGTTGCCATTGTGGGGGATTGG - Intergenic
1103974312 12:124692361-124692383 CTGTTGCTACTGGAGGGGAAGGG - Intergenic
1104017002 12:124968230-124968252 CCATAGACACTGTAGGGGAACGG - Intronic
1104662831 12:130623895-130623917 CAGTTGCCACTGTGGGTGATGGG - Intronic
1105894876 13:24709297-24709319 CTCTACCCACAGTAGGGGAGGGG - Intronic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1107414542 13:40188537-40188559 CTGAAGCCACAGGAGGGGAAGGG + Intergenic
1107702053 13:43058476-43058498 CTGTGGCCACTGTGGGGTATGGG + Intronic
1108134219 13:47338248-47338270 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1109058311 13:57581169-57581191 CTGCTGCCACTATAGGGGATGGG + Intergenic
1109508413 13:63336924-63336946 CTGTGGCTGCTGTAGGGGATGGG + Intergenic
1109924653 13:69120259-69120281 CTGCAGCCACTGTGGGGCATGGG - Intergenic
1110158055 13:72342351-72342373 CTGCAGCCACTGTGGGGTTTGGG + Intergenic
1111225594 13:85266740-85266762 CTGTGGACACTGTGGAGGATGGG - Intergenic
1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG + Intronic
1113940793 13:114017710-114017732 CTGCAGCCACTGTAGCTGACAGG - Intronic
1114552163 14:23538969-23538991 CTGCTGCCACTGAGGGGGATGGG + Intronic
1115393225 14:32877400-32877422 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1115958521 14:38809071-38809093 CTGTGGCTCCTGTGGGGGATGGG - Intergenic
1115969808 14:38932596-38932618 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1115996915 14:39204174-39204196 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1116346703 14:43803259-43803281 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1117271302 14:54146489-54146511 CTGTGGCCGCTGTGGAGGATAGG - Intergenic
1117768471 14:59107814-59107836 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1118532208 14:66718878-66718900 CTGCAGCTGCTGTGGGGGATGGG + Intronic
1118706221 14:68483002-68483024 CAGTTGCCACAGTAGGGGAAGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121714968 14:96067288-96067310 GTGTGGCCACTGCAGGGGACTGG + Intronic
1124380721 15:29162628-29162650 CTGCAGCTCCTGTGGGGGATGGG - Intronic
1125055938 15:35359055-35359077 CTGTGGCTGCTGTTGGGGATGGG + Intronic
1126190249 15:45871440-45871462 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1126577497 15:50210954-50210976 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1127008220 15:54594499-54594521 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1127194465 15:56568862-56568884 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1127358821 15:58226904-58226926 CTTTAGCCACTGTTGGGGAAGGG + Intronic
1127462518 15:59212312-59212334 CTGTAGCTACTCTAAGGGGTGGG - Intronic
1127574080 15:60273156-60273178 CAGTGGCCACTGTGGGGGATGGG + Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128238726 15:66085145-66085167 CTGCGGCTACTGTGGGGGATGGG - Intronic
1129571022 15:76683734-76683756 CAGAAGACACTGTAGGGGGTGGG + Intronic
1129580127 15:76799982-76800004 CTGTTGCCACTGGAGGAGTTTGG - Intronic
1129631689 15:77267193-77267215 ATGTGGCTGCTGTAGGGGATGGG - Intronic
1131326849 15:91456189-91456211 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1137978169 16:53048288-53048310 CTGCAGCCACTGTAGTAGCTGGG - Intergenic
1138797974 16:59993194-59993216 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1142165443 16:88584712-88584734 CTGTAGCTACTAAAGGTGATCGG - Intronic
1142910868 17:3089711-3089733 CTGTGGCCACTGTGAGGGATGGG + Intergenic
1144139687 17:12336561-12336583 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1145934417 17:28706527-28706549 CTCTGGCATCTGTAGGGGATGGG + Intronic
1146058257 17:29591777-29591799 CTGCAGCCAGTGCAGGGGAGGGG - Intronic
1150538956 17:66076525-66076547 CTGTGGCTGCTGTGGGGGATAGG - Intronic
1151078797 17:71304714-71304736 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1153193705 18:2570641-2570663 CTGTGGCCTATGAAGGGGATGGG - Intronic
1155315549 18:24567379-24567401 CTGTCTCCACTGCAGGGGATGGG - Intergenic
1155886721 18:31217382-31217404 CTGCAGCCACGATGGGGGATGGG - Intergenic
1156011384 18:32501352-32501374 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1156326660 18:36079712-36079734 CTGCAGCCACTGTGGGAGATGGG - Intergenic
1157703297 18:49779252-49779274 CTGCAGCTGCTGTAAGGGATGGG + Intergenic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1158829759 18:61264133-61264155 CTGAAGCTACTGTGGGGGATGGG - Intergenic
1159454038 18:68638580-68638602 CTGTAGCTGCTGTGGGGGATGGG + Intergenic
1160267598 18:77353727-77353749 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1161250991 19:3280204-3280226 CAGTAGCCACTGGTGGGGACTGG - Intronic
1161547502 19:4890681-4890703 CTGTCACAACTGCAGGGGATCGG - Exonic
1161592542 19:5135325-5135347 CTGTAGGGCCTGTAGGGGAGAGG - Exonic
1162116137 19:8430644-8430666 CTTCAGCCACTGCAGGGGAGAGG - Exonic
1165007439 19:32818363-32818385 CTGTGGCCACTGCAAGGAATGGG + Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1166434081 19:42752422-42752444 CAGTAGCCACTGCAGTGGACTGG + Intronic
1166437226 19:42777751-42777773 CGGTAGCCACTGCAGTGGACTGG + Intronic
1166453866 19:42923865-42923887 CAGTAGCCACTGCAGTGGACTGG + Intronic
1166456335 19:42943147-42943169 CAGTAGCCACTGCAGTGGACTGG + Intronic
1166466131 19:43032418-43032440 CAGTAGCCACTGCAGTGGACTGG + Intronic
1166472268 19:43088486-43088508 CGGTAGCCACTGCAGTGGACTGG + Intronic
1166493031 19:43275475-43275497 CGGTAGCCACTGCAGTGGATTGG + Intergenic
1166531299 19:43545106-43545128 CTGATGCCACTTTAGGGGCTTGG + Intronic
1166699929 19:44876422-44876444 CTGTGGCCACTGTCGTGGGTAGG - Intronic
1166899623 19:46049591-46049613 CTGTGGCTGCTATAGGGGATGGG - Intronic
1167276551 19:48543562-48543584 CTGAAGCCACTGCAGGGAAGGGG + Intergenic
1167794781 19:51702348-51702370 CTGTAGGCCCTGATGGGGATGGG - Intergenic
925460376 2:4057876-4057898 ATGTTGCCACTACAGGGGATGGG - Intergenic
925721587 2:6833604-6833626 ATGCAGCCACTCTAGGGGATAGG + Intergenic
926151618 2:10428662-10428684 GTGTCTTCACTGTAGGGGATGGG + Intergenic
928356644 2:30622224-30622246 CTGTGGCTGCTGTGGGGGATGGG - Intronic
929722920 2:44389179-44389201 CTGTAGCTGCTGTGGGGGATGGG + Intronic
929806006 2:45145508-45145530 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
930154667 2:48093869-48093891 CTGTAGTCAATGTAGGGGAGTGG + Intergenic
930422964 2:51176948-51176970 CTGTGGCTACTGTGGGGCATGGG - Intergenic
930574317 2:53127440-53127462 CTGGGGCCACTGTGAGGGATCGG + Intergenic
931547868 2:63408867-63408889 CTGTGGCTGCTGTGGGGGATGGG - Intronic
931834632 2:66085713-66085735 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
933531516 2:83517743-83517765 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
934111416 2:88747122-88747144 CTGTGGCCACTGTGTGGGGTTGG + Intronic
935296757 2:101656485-101656507 CTGTAGACATTGTAGGGTAAGGG - Intergenic
937410432 2:121670124-121670146 CCACAGCCACTGTGGGGGATAGG - Intergenic
937415337 2:121710219-121710241 CTGATGCCACTGTGGGGGTTAGG - Intergenic
937643682 2:124242227-124242249 CTGGAGCCACTGTTGAGCATTGG - Exonic
938564247 2:132503769-132503791 CTGTGGCTGCTGTGGGGGATGGG + Intronic
938854875 2:135299176-135299198 CTGCATCCACTGTGGGGGCTTGG + Intronic
939569665 2:143825617-143825639 CTGTAGCCAACGGAGGGGGTTGG - Intergenic
940034716 2:149301734-149301756 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
940387518 2:153090791-153090813 CTGTGGCTACTGTGGGGAATGGG + Intergenic
940431340 2:153593398-153593420 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
941402202 2:165044873-165044895 CTGTGGCAGCTGTGGGGGATGGG + Intergenic
941627432 2:167845062-167845084 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
941738353 2:169005368-169005390 CTGCAGCTGCTGTGGGGGATGGG + Intronic
944073122 2:195695272-195695294 CTGTGGCCGCTGTGGGGGATGGG + Intronic
944485381 2:200199881-200199903 CTGCAGCTGCTGTAGGGGCTGGG - Intergenic
944528882 2:200648760-200648782 CTGTGGCTGCTGTGGGGGATGGG + Intronic
945362319 2:208906768-208906790 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
945657629 2:212644447-212644469 CTGTGGCTGCTGTAGGGGATGGG + Intergenic
945864534 2:215161704-215161726 CTGCAGCTACTGTGGGGAATGGG - Intergenic
946321498 2:218957313-218957335 ATGTAGCCACTGTTGCTGATGGG + Intergenic
946544777 2:220727378-220727400 CTTCAGCCACTCTAGGGCATTGG - Intergenic
947457080 2:230265138-230265160 CTGCAGCTGCTGTGGGGGATGGG + Intronic
947855400 2:233320516-233320538 CTTTAGCATCTGGAGGGGATAGG - Intronic
948482776 2:238260931-238260953 CTGGAGCCGCTGTGGGGGACGGG + Exonic
1169517466 20:6333195-6333217 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1169965811 20:11215991-11216013 CTGTAGCCTCTGCCTGGGATTGG + Intergenic
1172409962 20:34713750-34713772 AAGTAGCCACTGGAGGGGAAAGG + Intronic
1172758893 20:37308191-37308213 CTGTGGCCAGTGGAGGGGAGGGG + Intronic
1172956979 20:38767873-38767895 CTGTAGACATTGTGGGGCATGGG + Intronic
1174170880 20:48617619-48617641 CTGAAGCCACTGTGGGGCATCGG + Intergenic
1174335183 20:49854602-49854624 CTGTATCTACTGTTGGGGGTAGG + Intronic
1174441687 20:50560585-50560607 CTATTCCCACCGTAGGGGATGGG + Intronic
1175877602 20:62237897-62237919 CTGGAGCCACTGTAGGTCAGTGG + Intronic
1176122761 20:63461591-63461613 CTGGGGCCACTCTTGGGGATGGG - Intronic
1177127728 21:17217084-17217106 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1177195588 21:17900863-17900885 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1177847412 21:26306450-26306472 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1177854681 21:26387466-26387488 CTGTAGCCACTGCAGAGGATGGG + Intergenic
1178059372 21:28834963-28834985 CTGCAGCTACTGTGGGGGATGGG - Intergenic
1178801676 21:35801387-35801409 CTGCAGCTGCTGTAGGGGATGGG - Intronic
1179084201 21:38203153-38203175 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1179467841 21:41589603-41589625 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1179792376 21:43763000-43763022 GAGTAGCCACTGCAGGGGACAGG - Intergenic
1182854504 22:33505269-33505291 CTGTAGCCTCTGCAGAGGCTGGG + Intronic
1183875529 22:40777052-40777074 CTGTACCGTCTGCAGGGGATAGG + Exonic
1184645909 22:45895464-45895486 CTGTGGCCTCTGCAGGGGCTAGG - Intergenic
1185159148 22:49212488-49212510 CTGTGGCAGCTGTAGGGGAGAGG - Intergenic
949146052 3:701254-701276 CTGCAGTCACTGTGGAGGATGGG + Intergenic
949543879 3:5055476-5055498 CTGTAGCCACAGAAGAGGAAGGG - Intergenic
950294567 3:11817679-11817701 CTGTGGCCAATGAAGGAGATAGG + Intronic
950899741 3:16486810-16486832 ATGTAGTCACTTTAGGGGTTAGG - Intronic
951269613 3:20608335-20608357 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
951727291 3:25774462-25774484 TTGTGGCCACTGTGGCGGATGGG + Intronic
952435553 3:33269498-33269520 TTGCAGCCACTGTGGGAGATGGG + Intergenic
952984887 3:38770424-38770446 CTGTGGCCACTGTGGTGGATGGG + Intronic
954099497 3:48358299-48358321 CTGGAAGCCCTGTAGGGGATGGG + Intergenic
955450771 3:59064695-59064717 CTATGGCCACTGTGGGGGATGGG + Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
957427902 3:80063933-80063955 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
958647106 3:96887763-96887785 CTGTGGCTACTGTTGGGGATGGG + Intronic
958770670 3:98421943-98421965 CTGTGGCTGCTGTGGGGGATAGG - Intergenic
958819113 3:98952395-98952417 CTGCAGCCACTGTTGCAGATGGG + Intergenic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
959997268 3:112693444-112693466 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961239435 3:125397585-125397607 GGGTAGCCACTGAAGGGAATCGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962401852 3:135067365-135067387 CTGTGGCTGCTGTGGGGGATGGG + Intronic
962673751 3:137736307-137736329 CTGAGGCCACTGTGGGGGATGGG + Intergenic
963629960 3:147720624-147720646 ATGTTGCCACTGCTGGGGATGGG - Intergenic
964226460 3:154408652-154408674 CTGTAGCTGCTGTGGGGGATGGG - Intronic
964299346 3:155271043-155271065 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
964324991 3:155535600-155535622 CTGTCGCTGCTGTAGGGGCTGGG - Intronic
964457692 3:156886129-156886151 CTGCAACCACTGTGGGGGAGGGG + Intronic
964985485 3:162732783-162732805 CTGTAGCTGCTGTGGGGGATTGG + Intergenic
965101586 3:164305969-164305991 CTGTAGCTGCTGTAGGGGATAGG - Intergenic
965118429 3:164520833-164520855 ATGTTGCCACTGTCGGGGGTGGG + Intergenic
965184560 3:165446529-165446551 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
966533210 3:181003821-181003843 CTGCAGCCTCTGTTGGTGATAGG - Intergenic
967246392 3:187491310-187491332 CTGTGGCCACTGTGGAGCATGGG - Intergenic
967504588 3:190239274-190239296 CTTCAGCCACTGTGGGGCATGGG - Intergenic
968459780 4:718774-718796 TTGTGGCCACGGTAGGGGCTGGG + Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
969901495 4:10354615-10354637 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
970549317 4:17163591-17163613 CTGCAGCTGCTGTAGGGGATGGG + Intergenic
970856147 4:20651261-20651283 CTGCAGCCGCTGTGGGGGTTTGG - Intergenic
971472305 4:27040309-27040331 CTGTGGCCACTATGGGAGATGGG + Intergenic
972410857 4:38793051-38793073 CTCTAGCCAATAAAGGGGATTGG + Intronic
972899784 4:43669103-43669125 CTGCAGCTACTGTGGCGGATGGG + Intergenic
973037515 4:45424302-45424324 CCATGGCCACTGTTGGGGATTGG + Intergenic
973343053 4:49026020-49026042 CTGTAGCTGCTGTGGGAGATGGG + Intronic
973980960 4:56307856-56307878 CTGTAGCCAGTGAAGAGGACAGG + Intronic
975680198 4:76868347-76868369 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
975735544 4:77377388-77377410 CTGTGGCCAATCTAAGGGATGGG + Intronic
975899919 4:79139792-79139814 CTGCAGCTGCTGTTGGGGATGGG + Intergenic
976562789 4:86521472-86521494 TTGTGGCCACTGTCGGGGATGGG + Intronic
976791278 4:88880954-88880976 CTGTGGCTGCTGTCGGGGATAGG - Intronic
976887853 4:90007861-90007883 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
977777531 4:100938941-100938963 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
977976121 4:103268855-103268877 CTGTGGCTGCTGTAAGGGATGGG + Intergenic
978670701 4:111244434-111244456 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
978761839 4:112361537-112361559 CTGCAGCTGCTGTGGGGGATGGG - Intronic
979061445 4:116066960-116066982 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
979356987 4:119715943-119715965 CTGTGGCTGCTGTGGGGGATAGG - Intergenic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
979439481 4:120734214-120734236 GAGGAGCCGCTGTAGGGGATGGG + Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982299515 4:153864975-153864997 CTGTGGCTGCTGTGGGGGATAGG + Intergenic
982312158 4:153997349-153997371 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
982491743 4:156038714-156038736 CTATGGCTGCTGTAGGGGATGGG - Intergenic
982680153 4:158419062-158419084 CTGTGGCTGCTGTGGGGGATGGG + Intronic
982789437 4:159573886-159573908 CTCTAGCCATTGTAGAGGTTTGG + Intergenic
982829735 4:160044523-160044545 TTGTGGCTGCTGTAGGGGATGGG - Intergenic
983251564 4:165351773-165351795 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
983963101 4:173778201-173778223 CTATGGCCACTGTGGTGGATGGG + Intergenic
984323570 4:178224385-178224407 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
985008632 4:185559932-185559954 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
985240810 4:187929412-187929434 CTGTGGCTGCTGTAGGGGATGGG + Intergenic
985561905 5:592242-592264 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
985795974 5:1962446-1962468 CTGCATCAATTGTAGGGGATGGG - Intergenic
986758037 5:10855931-10855953 CTGTACCCACTGGAAGGGAGGGG - Intergenic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987846703 5:23296124-23296146 CTGTGGCTATTGTGGGGGATGGG + Intergenic
988344599 5:30021092-30021114 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
988723558 5:33903338-33903360 CTGTGGCTCCTGTGGGGGATGGG + Intergenic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
989431552 5:41361075-41361097 CTGTGGCTGCTGTGGGGGATGGG + Intronic
990572777 5:57095405-57095427 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
991005039 5:61820511-61820533 CAGTAGCCTCTGTTAGGGATGGG + Intergenic
991945783 5:71897539-71897561 ATGTTGCCACTATTGGGGATGGG - Intergenic
992715871 5:79510870-79510892 CTGAAGCCTCTGTAGGGGCCTGG - Intronic
993743009 5:91563097-91563119 CTGCTGCTTCTGTAGGGGATGGG - Intergenic
993917048 5:93756194-93756216 CTGTAGCTGCTGTGGGGTATGGG - Intronic
994034035 5:95178168-95178190 CTGCAGCTGCTGTGGGGGATGGG - Intronic
994200408 5:96968234-96968256 CTGTAGCCTCTGTAGGATACTGG + Intronic
994568374 5:101482935-101482957 CTGTGGCTGCTGTAGGGGATGGG + Intergenic
995694603 5:114865529-114865551 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
995852761 5:116563073-116563095 TTGTAGACACTGTAGAGAATTGG - Intronic
996010753 5:118479162-118479184 CTGTGGCTGCTGTAGGGGCTGGG - Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996326998 5:122286483-122286505 CTGCAGTCACTGTGGAGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996678435 5:126202896-126202918 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
997231097 5:132243682-132243704 CTGCAGCTGCTGTGGGGGATAGG + Intronic
997765733 5:136501426-136501448 CTGTGGCTCCTGTGGGGGATGGG + Intergenic
998746088 5:145261137-145261159 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
999108616 5:149095418-149095440 CCATGGCCACTGTGGGGGATGGG - Intergenic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999818509 5:155200995-155201017 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000264484 5:159621523-159621545 CTGTGATCACTGTGGGGGATGGG - Intergenic
1000511618 5:162190187-162190209 CTGCAGCTGCTGTGGGGGATAGG + Intergenic
1000876832 5:166649916-166649938 CTGTAAGCACTTTAGGGAATTGG + Intergenic
1001693770 5:173654080-173654102 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1002367864 5:178727320-178727342 GTGCAGCCACTGTAAGAGATGGG + Intronic
1003450876 6:6230411-6230433 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1003581946 6:7347888-7347910 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1003647035 6:7921201-7921223 CAGAAGCCACTGGAGGGGACAGG - Intronic
1004167847 6:13272590-13272612 CTGGGGCCACTGGAGGAGATGGG + Intronic
1004185530 6:13418201-13418223 CCGAAGCCACTGCAGGGGACAGG + Intronic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005647296 6:27853298-27853320 ATGTAGGCAATGTAGGGGAGAGG - Intronic
1006286317 6:33097141-33097163 CGGCAGCCACTGTGAGGGATGGG - Intergenic
1006365006 6:33610151-33610173 CTGGAGCCACAGGAAGGGATTGG - Intergenic
1007686000 6:43667729-43667751 TTGTGGCCCTTGTAGGGGATGGG + Intronic
1007892652 6:45310249-45310271 CTGTGGCTACTGTGGGGGATGGG - Intronic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1010076369 6:71803382-71803404 CTGCAACTACTGTGGGGGATGGG + Intergenic
1010165111 6:72906069-72906091 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1010358581 6:74965641-74965663 CTGTGACCACTATAGGGGATTGG + Intergenic
1010679326 6:78781260-78781282 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1011832222 6:91387655-91387677 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1011965868 6:93156777-93156799 CTGTGGCTGCTGTAGGGGAGGGG + Intergenic
1012155955 6:95819944-95819966 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1012203551 6:96435414-96435436 CTGTAGCCCCTGTTGGGGATGGG + Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1013495568 6:110693718-110693740 CTGTGGCCAGTATGGGGGATGGG - Intronic
1013721042 6:113028374-113028396 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1013852638 6:114534613-114534635 CTGCAGCTGCTTTAGGGGATGGG + Intergenic
1013856681 6:114581283-114581305 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
1013946576 6:115729065-115729087 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1014010627 6:116471454-116471476 CTGTTGCCCCTGTAGGGCTTAGG - Intergenic
1014088149 6:117371885-117371907 GTGTGGCTGCTGTAGGGGATGGG - Intronic
1014278614 6:119416632-119416654 CTGTGGCCACTATTGGTGATGGG + Intergenic
1014420299 6:121235420-121235442 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1014531393 6:122563634-122563656 CTGCGGCTGCTGTAGGGGATAGG + Intronic
1014603897 6:123448554-123448576 CTGTAGCTGCTGTGGGGGATGGG - Intronic
1014625596 6:123721018-123721040 CTGTAGCCACCTTAGGGCTTTGG + Intergenic
1014658063 6:124132232-124132254 TTGTAGCCACTGTGGGGGACAGG - Intronic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1016290021 6:142518600-142518622 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1017971435 6:159315613-159315635 CTGTGGCCGCTTTACGGGATTGG + Intergenic
1018174781 6:161169068-161169090 CTGTGACCACTGAAGGGGAGAGG + Intronic
1020007424 7:4790000-4790022 CCGAAGCCACTGAAGGGGAGGGG - Intronic
1020332369 7:7032668-7032690 TTGTGACCACTGTGGGGGATAGG + Intergenic
1021184878 7:17552648-17552670 CTGTAACTACTGGAGGGTATGGG - Intergenic
1023566718 7:41530573-41530595 CTGGAACCACTGGAGTGGATGGG - Intergenic
1023652688 7:42388277-42388299 CTGTACCTACAGAAGGGGATGGG - Intergenic
1023657606 7:42440935-42440957 CTGTGGCTGCTGTGGGGGATAGG + Intergenic
1023748979 7:43351535-43351557 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1024040228 7:45547285-45547307 ATGTAGCCACTACTGGGGATGGG + Intergenic
1026470370 7:70689832-70689854 CTGTACCCACTTTATGGGACTGG + Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028141393 7:87279378-87279400 ATGTTGCCACTGCTGGGGATGGG - Intergenic
1030360473 7:108590182-108590204 CTGTGGTCAGTGTAGGGTATAGG + Intergenic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1030935992 7:115585367-115585389 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1031090425 7:117347914-117347936 CTGTGGCTGCTATAGGGGATGGG + Intergenic
1031261367 7:119525121-119525143 CTGTGGCTGCTGTGGGGGATTGG - Intergenic
1031788013 7:126059003-126059025 CAGTCCCCACTGTATGGGATTGG - Intergenic
1031827967 7:126589444-126589466 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1032487270 7:132297262-132297284 CTGTGGCCTCTGTGGAGGATGGG - Intronic
1032754074 7:134871645-134871667 CTGCAGACAGTGTGGGGGATGGG + Intronic
1033026830 7:137782417-137782439 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1033462773 7:141562524-141562546 CTGTGACCACAGTAGGGTATGGG + Intronic
1033816728 7:145082799-145082821 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1034247887 7:149662798-149662820 CTGCAGTCACTGTAGGGCATAGG + Intergenic
1035611276 8:965980-966002 CTGGAGCCAGTGTAGAGGACGGG + Intergenic
1038367210 8:26948419-26948441 CTGTAGCTGCTGTGGGGGATGGG + Intergenic
1038867724 8:31457998-31458020 ATGTAGCCACACTAGGGGTTAGG - Intergenic
1038908754 8:31937837-31937859 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1039002561 8:32997457-32997479 CTTTTGTCACTGTAGGGGAATGG - Intergenic
1039083294 8:33755345-33755367 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1039811137 8:41049277-41049299 CTGCAGTCACTGTGGGAGATGGG - Intergenic
1040529369 8:48253958-48253980 CTGCAGTCATTGTGGGGGATGGG + Intergenic
1040989605 8:53335782-53335804 CTGTAGCTACTATAGGTGATGGG + Intergenic
1041293753 8:56333468-56333490 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1041570551 8:59333094-59333116 CTGTAGCTGCTGTGGGGCATGGG + Intergenic
1041637095 8:60156494-60156516 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1041683939 8:60625049-60625071 CTGTAGCTAGTAAAGGGGATGGG + Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1041882183 8:62764358-62764380 CTGTGGCCAGTGTTGGGGAGAGG + Intronic
1041927077 8:63248257-63248279 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1041985846 8:63921880-63921902 ATGTAGCCACTACTGGGGATGGG - Intergenic
1042025836 8:64422832-64422854 AGGTTGCCACTGTAGGCGATGGG + Intergenic
1043048052 8:75352409-75352431 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1043545116 8:81306658-81306680 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1044227609 8:89736989-89737011 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
1046846551 8:118922476-118922498 CTGGAGCCTCTGTAGGGAGTGGG - Intergenic
1047130762 8:122017440-122017462 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1050133602 9:2439208-2439230 CTGTGGCTGCTGTGGGGGATTGG + Intergenic
1050147382 9:2583640-2583662 TTGTAGCTGCTGTGGGGGATGGG - Intergenic
1050447403 9:5739728-5739750 ATGTTGCCACTATTGGGGATGGG + Intronic
1051273195 9:15374858-15374880 CTATGGCCACTGTTGGGGGTAGG - Intergenic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1051885660 9:21890115-21890137 CTGTGGCTGCTGTGGGGGATGGG + Intronic
1052253491 9:26426971-26426993 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1052340744 9:27361980-27362002 CTGTAGCCAGTGTGGAGGGTAGG - Intronic
1054453608 9:65417621-65417643 CTATAGCCACATTAAGGGATAGG - Intergenic
1055346990 9:75350041-75350063 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1055708094 9:79030537-79030559 CTGTAGGAACTGTAGGAGAGAGG + Intergenic
1056322735 9:85452068-85452090 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1056654142 9:88495487-88495509 CTGTGGACACTGCAGGGGACAGG + Intergenic
1056948069 9:91017781-91017803 CTGAGGCTGCTGTAGGGGATGGG - Intergenic
1057314787 9:93961240-93961262 CTATAGCCTGTGTAGGGGGTGGG + Intergenic
1057475711 9:95399448-95399470 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1058342885 9:103920241-103920263 CTGGGGCCACTGTGGGTGATGGG - Intergenic
1058396237 9:104557228-104557250 CTGTGGCTGCTGTAGGGGTTAGG - Intergenic
1058784576 9:108374610-108374632 CTGTGGCTACTGTGGGGAATAGG + Intergenic
1059673783 9:116516937-116516959 CTGTAGCTGCTGTGGGGAATGGG - Intronic
1060032538 9:120227794-120227816 ATGTAGCCAATGAATGGGATAGG - Intergenic
1060169588 9:121450591-121450613 CTGAAGCCATTGTGGGGCATTGG + Intergenic
1062713572 9:137990274-137990296 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1186308378 X:8289924-8289946 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1186963077 X:14758188-14758210 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1187219197 X:17307744-17307766 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1187681415 X:21771027-21771049 CTGTGGCTTCTGTAGGGGATGGG - Intergenic
1188973277 X:36642610-36642632 ATGTGGCCTCTGCAGGGGATGGG + Intergenic
1189567195 X:42255071-42255093 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1189639332 X:43050909-43050931 CTGTGGCCACTGTAGGGGACAGG + Intergenic
1189962161 X:46333923-46333945 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1191026518 X:55919693-55919715 CTGTGGCTGCTGTAGGGGCTGGG - Intergenic
1191067624 X:56367161-56367183 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1191080644 X:56506087-56506109 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1191138618 X:57092848-57092870 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1191820452 X:65300481-65300503 CTTTAGCTGCTGTGGGGGATGGG - Intergenic
1191879314 X:65828628-65828650 CTGCAGCCACTATGGGGGATGGG - Intergenic
1192069073 X:67918085-67918107 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1192674005 X:73175661-73175683 CTGTAGCTGCTGTGGGGGATGGG + Intergenic
1192820216 X:74637119-74637141 CTGCAGCTGCTGTTGGGGATGGG - Intergenic
1192881111 X:75284971-75284993 CTGTGGCTGCCGTAGGGGATGGG + Intronic
1192914525 X:75638253-75638275 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1192929579 X:75791886-75791908 CTGTGGCTGCTGTGGGGGATAGG - Intergenic
1193154595 X:78158881-78158903 CTGCGGCTACTGTGGGGGATGGG - Intergenic
1193196944 X:78643569-78643591 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1193253405 X:79319480-79319502 CTATGGCTGCTGTAGGGGATGGG + Intergenic
1193255372 X:79342519-79342541 TGGCAGCCACTGTGGGGGATGGG - Intergenic
1193556509 X:82960617-82960639 CAGTGGCCACTGTGGGGGATGGG - Intergenic
1193578508 X:83232811-83232833 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1193643890 X:84044021-84044043 CTGCAGCTGCTGTTGGGGATGGG + Intergenic
1193690402 X:84634622-84634644 CTGCAGCCTCTGTTGGGGATAGG - Intergenic
1193771536 X:85593382-85593404 CTGTGGCCGCTGTGGGGGATGGG - Intergenic
1193937119 X:87636795-87636817 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1193954651 X:87844679-87844701 CTGTGGCCACTGTGAGGGATGGG + Intergenic
1194053411 X:89100791-89100813 CTGTGCCCACCGTGGGGGATGGG + Intergenic
1194470246 X:94285298-94285320 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1194510120 X:94783432-94783454 CTGTGGCTGCTGTGGGGGATTGG - Intergenic
1194515970 X:94854650-94854672 CTGCAGCTGCTGTGGGGGATAGG - Intergenic
1194553797 X:95332927-95332949 CTGGAGCCACTGTTGGGGGCTGG - Intergenic
1195075869 X:101326694-101326716 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1195231977 X:102859416-102859438 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1196024016 X:111020976-111020998 CTGTGGCTGCTGTGGGGGATGGG - Intronic
1196235477 X:113274598-113274620 CTGCAGCTACTGTGGGGTATGGG - Intergenic
1196248006 X:113423679-113423701 CTGTTGTAACTGTAGGGGAGGGG - Intergenic
1196619777 X:117808492-117808514 CTGCAGCTGCTGTCGGGGATGGG - Intergenic
1196737484 X:118992489-118992511 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1196948276 X:120850263-120850285 CTGTGGCTGCTGTGGGGGATGGG + Intergenic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1197055490 X:122113773-122113795 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1197184400 X:123570456-123570478 CTGTGGCTGCTGTAGGGGATGGG - Intergenic
1198721881 X:139631114-139631136 ATATAGCCACAGGAGGGGATGGG + Intronic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1199668521 X:150121254-150121276 CTGTGGCTGCTGTGGGGGATGGG - Intergenic
1200332679 X:155314007-155314029 CTGTGGCTGCTGTAGGGGATGGG - Intronic
1200974259 Y:9191583-9191605 CTTTGGCATCTGTAGGGGATTGG + Intergenic
1202136618 Y:21672040-21672062 CTTTGGCATCTGTAGGGGATTGG - Intergenic