ID: 1011590019

View in Genome Browser
Species Human (GRCh38)
Location 6:88963181-88963203
Sequence GGATGAATGGGAACATGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011590019_1011590029 29 Left 1011590019 6:88963181-88963203 CCCGTTCATGTTCCCATTCATCC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1011590029 6:88963233-88963255 GCTCCTGAAATACCACTAATGGG 0: 1
1: 0
2: 1
3: 13
4: 325
1011590019_1011590028 28 Left 1011590019 6:88963181-88963203 CCCGTTCATGTTCCCATTCATCC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1011590028 6:88963232-88963254 CGCTCCTGAAATACCACTAATGG 0: 1
1: 0
2: 0
3: 2
4: 83
1011590019_1011590023 -4 Left 1011590019 6:88963181-88963203 CCCGTTCATGTTCCCATTCATCC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1011590023 6:88963200-88963222 ATCCACGAAGCGTAATCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011590019 Original CRISPR GGATGAATGGGAACATGAAC GGG (reversed) Intronic
900078239 1:835137-835159 GGATGAATGGGTGGGTGAACAGG - Intergenic
901317966 1:8321877-8321899 GGATGAATGGGTGCATGGATGGG + Intronic
901454842 1:9357231-9357253 GGATGGATGGATAAATGAACAGG + Intronic
901758121 1:11453769-11453791 GGAGAAATTGGAACAGGAACAGG + Intergenic
906791570 1:48662915-48662937 GGATGGATGGATAAATGAACAGG - Intronic
907181392 1:52573325-52573347 GGATGAATGTGAGCAGGCACTGG + Intergenic
907638018 1:56156441-56156463 GGATGATTGGGAAGATGATCTGG + Intergenic
908385988 1:63642391-63642413 GGATAAATGGGGACCAGAACTGG + Intronic
909744846 1:79081874-79081896 GAATGAATTTGAACATGAACAGG + Intergenic
910191228 1:84598015-84598037 GGATGATTGTGAACAAGACCAGG - Intergenic
910206333 1:84752381-84752403 GGATGCATGGGAAAATGGGCAGG - Intergenic
911506627 1:98760902-98760924 AAATGAATGGGAAAATAAACTGG - Intergenic
911758674 1:101590663-101590685 GGATGAATGGAGACATGGTCTGG - Intergenic
912135085 1:106651186-106651208 CCATGAATGGGAACAGGAAATGG - Intergenic
916365699 1:164025093-164025115 GCATGAAAGGGAACCTGAGCAGG + Intergenic
916892487 1:169125653-169125675 GAAAGAATGAGAACATGGACTGG - Intronic
918430577 1:184455745-184455767 TGCTGAATGGGATCATGAATGGG + Intronic
918883933 1:190166409-190166431 AGATGAATGGGGTCATAAACAGG - Intronic
919123164 1:193365958-193365980 GGATGAATGTGAATCTGAAAAGG + Intergenic
919662081 1:200257174-200257196 CGATGAATGGTAACATTCACAGG - Intergenic
920138941 1:203793534-203793556 GAATGAATGAAAATATGAACAGG - Intergenic
920668129 1:207981597-207981619 GGATGAATGGGAATAGAAAAGGG - Intergenic
920699247 1:208205231-208205253 GGAAGAGTGGCAACAGGAACTGG - Intronic
921467299 1:215504140-215504162 GAAAGAATGGCAACATGAAGAGG + Intergenic
921828328 1:219699453-219699475 GAAAGAATGGGCAAATGAACTGG - Intronic
923216555 1:231853624-231853646 GGTGGAATGGGAACAGGTACTGG + Intronic
1062785150 10:258503-258525 GGATGCATGGGAAACTGGACAGG - Intergenic
1064695853 10:17964539-17964561 GTCTGAATGGGAATATGAATGGG + Intronic
1067138528 10:43633771-43633793 GTATGAAAAGGAACATGAAGGGG - Intergenic
1068018995 10:51556847-51556869 AGATTAAAGGGAACATGTACAGG - Intronic
1068742381 10:60488313-60488335 GGAAGAATGGGAAGGTGAACAGG + Intronic
1069015191 10:63421437-63421459 TGATGATTGGGAAGTTGAACTGG + Intronic
1069568605 10:69480259-69480281 GGAGGAATGGGAACAGGATGGGG + Intronic
1071081191 10:81813336-81813358 GGATGAAGGGAAAGATGAATAGG + Intergenic
1072103841 10:92255113-92255135 GGAGGAAAGGGAATATGAAAGGG - Intronic
1073083648 10:100874936-100874958 GGGTGAGTGGGAACATGAGGAGG + Intergenic
1073138374 10:101231891-101231913 ACAGGAAGGGGAACATGAACTGG + Intergenic
1073403765 10:103278732-103278754 GGAAGAATGCGATCCTGAACTGG + Intronic
1075475715 10:122731829-122731851 GGTGGAATGGGATAATGAACAGG - Intergenic
1076867418 10:133174927-133174949 GGGTGGATGGGATTATGAACAGG + Intronic
1076867579 10:133175597-133175619 GGATGGATGGGTGGATGAACAGG + Intronic
1077537755 11:3132609-3132631 GCAGGAATGGGAACATAAAGGGG - Intronic
1077708538 11:4512687-4512709 GGATGGAAGGGAACATACACTGG - Intergenic
1078452830 11:11453080-11453102 GGATGAAAGGGAAAGTGAAGGGG + Intronic
1081733084 11:45385038-45385060 GGCTGAGTGGGAACCTGAAGGGG + Intergenic
1083288754 11:61678276-61678298 GGAGGAATGGGAAGAAGGACTGG + Intergenic
1084713036 11:70856029-70856051 GGATGGATGGATAAATGAACAGG + Intronic
1084781852 11:71415023-71415045 GGATGAATGGATACATGGATGGG + Intergenic
1086698286 11:89869411-89869433 AGATGATGGGGAACAGGAACAGG - Exonic
1086707878 11:89975077-89975099 AGATGATGGGGAACAGGAACAGG + Exonic
1087269671 11:96098636-96098658 GGAAGAATGAGAACAAGGACGGG - Intronic
1089257577 11:117201950-117201972 GGGTGGCTGGGAACAGGAACAGG - Exonic
1093134109 12:15429459-15429481 GGATGAATGGGAATATGCAAAGG + Intronic
1093151902 12:15631570-15631592 GGGGGAAGGGGAACAGGAACAGG + Exonic
1093397527 12:18701662-18701684 GGAGGAATGGGAAGAAGAAGTGG - Intronic
1095491098 12:42734488-42734510 GCATGAACGTGAACATGAAAAGG - Intergenic
1095916606 12:47486453-47486475 GGAGGAAAGGGAACATGAATGGG + Intergenic
1095967390 12:47878260-47878282 GGATGAATTGGGGCAGGAACTGG - Intronic
1096257451 12:50072185-50072207 GGAGGAAGGGGAACATGGCCTGG + Intronic
1096622458 12:52873096-52873118 GGCTGAGTGGGAACCTGAGCAGG + Intergenic
1097985432 12:65778058-65778080 GAAAGAAAGGGAAGATGAACTGG - Intergenic
1098360759 12:69652287-69652309 GGATGAATGGTCACATGGCCTGG - Intronic
1099530989 12:83781179-83781201 GGGTGAGTGTGAACATGGACAGG - Intergenic
1101419333 12:104536829-104536851 GGAGGAATAGAAAGATGAACTGG - Intronic
1102199777 12:111049268-111049290 GGATGAATGGATAGATGAATGGG - Intronic
1102429749 12:112873967-112873989 GAATGAATGGACAAATGAACAGG + Intronic
1102773872 12:115502153-115502175 GGATGAATAGGAAAATGTAAAGG - Intergenic
1102890027 12:116551494-116551516 GGATGAATGGATAGATGAATGGG + Intergenic
1103007177 12:117430586-117430608 GGATGGATGGATACATGAACGGG + Intronic
1103017715 12:117508672-117508694 GGATGAATGGGTAAATGGACAGG + Intronic
1103190348 12:118996009-118996031 GGATGGATGGGTAGATGGACAGG - Intronic
1103573417 12:121859508-121859530 GGAAGAACTGGAACATGAACCGG + Intronic
1105392195 13:19990829-19990851 GGATGAATGGGAAGTTGAAGTGG - Intronic
1106034553 13:26031905-26031927 GGAAGAAATGGAACATGAAAGGG - Intergenic
1109958686 13:69603026-69603048 GGATGGATGGGAAACTGAAAGGG - Intergenic
1110968934 13:81737030-81737052 AGATGAATGAGAAGAGGAACAGG + Intergenic
1111298112 13:86309652-86309674 GGAAGAATGGAAGAATGAACGGG - Intergenic
1111495012 13:89036116-89036138 GGATCAAGGGGTACATGTACAGG + Intergenic
1111504402 13:89167426-89167448 GTATCAAGGTGAACATGAACAGG + Intergenic
1112372596 13:98807245-98807267 GGGTGAATGGACACATGGACAGG - Intronic
1113581705 13:111434696-111434718 GGATGGATGGGCAGATGAATGGG + Intergenic
1117331149 14:54712952-54712974 GGAGGAAAGGGGAGATGAACAGG + Intronic
1117557244 14:56898172-56898194 GCATGAGTGTGAACATTAACAGG - Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1120722536 14:87904419-87904441 GGATGGATGGATAAATGAACAGG + Intronic
1122266035 14:100547314-100547336 GGAGGAAGGGGAACTTGAGCAGG - Intronic
1123469431 15:20539088-20539110 GACCCAATGGGAACATGAACTGG + Intronic
1123648630 15:22461611-22461633 GACCCAATGGGAACATGAACTGG - Intronic
1123729709 15:23134074-23134096 GACCCAATGGGAACATGAACTGG + Intronic
1123747876 15:23331556-23331578 GACCCAATGGGAACATGAACTGG + Intergenic
1124280244 15:28355408-28355430 GACCCAATGGGAACATGAACTGG + Intergenic
1124302455 15:28556204-28556226 GACCCAATGGGAACATGAACTGG - Intergenic
1124563459 15:30795348-30795370 GACCCAATGGGAACATGAACTGG - Intergenic
1125930333 15:43595201-43595223 GGATTACTGGGAAGATGAATTGG - Intronic
1125943501 15:43695033-43695055 GGATTACTGGGAAGATGAATTGG - Intronic
1126243673 15:46476055-46476077 GGATGAATGTGGATATGAAGTGG - Intergenic
1126490682 15:49232363-49232385 GGAAGAATGGTTTCATGAACAGG - Intronic
1128364737 15:66990652-66990674 GGCTGAATGGAAACAAGAACAGG + Intergenic
1128763462 15:70235713-70235735 TGATGAATAGGAACAGAAACAGG - Intergenic
1128771058 15:70282900-70282922 GGATGAATGGGTAAATGGATGGG + Intergenic
1129998943 15:80030865-80030887 GGATGAATGGATGAATGAACTGG - Intergenic
1132413559 15:101604261-101604283 GGATGGGTGGGAAGATGAGCCGG - Intergenic
1132433416 15:101778353-101778375 GACCCAATGGGAACATGAACTGG + Intergenic
1133204743 16:4226561-4226583 GGATGGATGGGCAGATGAATGGG + Intronic
1133749202 16:8711714-8711736 GGATGGATGGGAAGATGGATGGG + Intronic
1134023561 16:10938405-10938427 GGATGAATCTCAAGATGAACAGG - Intronic
1134316057 16:13119977-13119999 GAAAGAATGGGAACATGACAGGG + Intronic
1134630718 16:15753879-15753901 GGATGATTGGGAAGATGATGAGG - Intronic
1134637098 16:15800635-15800657 GGATGGATGGGAATATGAATGGG + Intronic
1135828820 16:25754952-25754974 GGATGAATGGGTACCTGGATGGG - Intronic
1137567763 16:49544067-49544089 GGATGGATGGGTAGATGGACAGG - Intronic
1137686157 16:50388390-50388412 GGATGAAGTGGCACATGAGCTGG + Intergenic
1138009339 16:53362856-53362878 GACCCAATGGGAACATGAACTGG + Intergenic
1138314653 16:56059466-56059488 GGAAATATGGGAACATGAATTGG + Intergenic
1138564392 16:57822292-57822314 AGATGAATGAGATCATGTACAGG + Intronic
1139310517 16:66024567-66024589 GGATGAGTGGGCAGATGGACAGG - Intergenic
1139944725 16:70632492-70632514 GAATGAATGGGAAGAGGAGCTGG + Intronic
1140194415 16:72845008-72845030 GAATGAATGAGAGAATGAACAGG + Intronic
1140753743 16:78048951-78048973 AGATGAACGGGAACATCAGCCGG - Intronic
1141823898 16:86465805-86465827 GAATGAATGGGTAGATGAAACGG + Intergenic
1142104175 16:88293240-88293262 GGATGAATGGGTAGATGGACAGG + Intergenic
1147377653 17:40032505-40032527 TGATCAATGGGAACTTGCACTGG + Intronic
1147765433 17:42832758-42832780 GAATGAATGGGTGCATGAAGAGG + Intronic
1150336525 17:64334418-64334440 AGATGACGGGGAACATGAAGGGG + Intronic
1150352574 17:64457371-64457393 GAATGAAAGTGAACATGAAAAGG - Intronic
1150439156 17:65177443-65177465 GGATGGATGGAAAAATGGACAGG - Intronic
1151808396 17:76421062-76421084 GCATGGATGGGAAAGTGAACAGG + Intronic
1154962849 18:21327512-21327534 GGAAGAGTGGGAACAGGAAGAGG - Intronic
1156155563 18:34297931-34297953 GGATGAAAGAAAACATGAACAGG - Intergenic
1156337300 18:36183227-36183249 GGATGAATGGGACGAAGGACTGG - Intergenic
1157450801 18:47786994-47787016 GAATGAATGCTAACATTAACAGG + Intergenic
1157496415 18:48160748-48160770 GGATGAGTGAGAAGTTGAACTGG + Intronic
1157752441 18:50191792-50191814 GTATGAATGGGATCTAGAACAGG + Intronic
1158337112 18:56424771-56424793 AGATGAATGGATAAATGAACGGG - Intergenic
1159040216 18:63318118-63318140 GGATGACTGAGTACCTGAACCGG - Exonic
1159171388 18:64772889-64772911 TGATGAATGTTAAAATGAACTGG + Intergenic
1159178503 18:64870252-64870274 AGAAGAATGGGAAAATGAGCAGG - Intergenic
1159938462 18:74387249-74387271 GGATGAATGGGAATATGTGGAGG - Intergenic
1160316774 18:77855464-77855486 GCATGAAGAGGAACATGAATAGG - Intergenic
1160970655 19:1766421-1766443 GGATGAAGGGGAGGATGAAGGGG + Intronic
1161658250 19:5529422-5529444 GAATGAATGGACAAATGAACAGG + Intergenic
1162188153 19:8923029-8923051 GGGTGAATGGCACCATGAATGGG + Exonic
1162747505 19:12806935-12806957 GGATGAATGGCAACTTTCACGGG + Intronic
1162872548 19:13597588-13597610 GGATGGATGGGAGAAAGAACAGG + Intronic
1163238436 19:16043434-16043456 GGATGAATGGGTAGATGGATGGG + Intergenic
1163731892 19:18954330-18954352 GGATGGATGGGAAGATGGATAGG - Intergenic
1163731916 19:18954430-18954452 GGATGGATGGGCAGATGAATAGG - Intergenic
1163731929 19:18954486-18954508 GGATGGATGGGAAGATGGATGGG - Intergenic
1163731952 19:18954574-18954596 GGATGGATGGGAAGATGGATAGG - Intergenic
1164587567 19:29485501-29485523 GTGGGAATGGGAGCATGAACCGG - Intergenic
1166935682 19:46330986-46331008 GGATGAATGAGAAGATGGATTGG + Intronic
1167596641 19:50431846-50431868 GGAGGAGGGGGAAGATGAACAGG + Intergenic
925260222 2:2522164-2522186 GAATGAATGGGTAGATGAATGGG - Intergenic
925944239 2:8845917-8845939 CCATGAAAGGGAACAAGAACTGG + Intergenic
926470981 2:13257652-13257674 GGGTGAATGGATAAATGAACAGG - Intergenic
926808975 2:16739642-16739664 GCATGCATGGGAACAGTAACTGG - Intergenic
927512568 2:23653532-23653554 GAATGAATGGGAGGAAGAACAGG + Intronic
928310905 2:30208958-30208980 GGGGGAATGGGAACACAAACTGG - Intergenic
929576248 2:43054683-43054705 ACATGAATGGGAATATGAACGGG + Intergenic
929919545 2:46162473-46162495 GGGAGAGTGGGAACATGCACAGG - Intronic
930844993 2:55893917-55893939 AGATGAATGGATACAAGAACAGG + Intronic
932004860 2:67917872-67917894 GGAAGAATGGGATCATGGACTGG - Intergenic
932591182 2:73068897-73068919 GGAAGAATGGGAACAAGAGTTGG + Intronic
938225404 2:129611586-129611608 GGCTGAATGGAATCATGACCAGG - Intergenic
940284427 2:152019556-152019578 GGATAAGTGGATACATGAACAGG + Intronic
940923606 2:159338633-159338655 GTGTGAATGGGAACATGAAAAGG - Intronic
941513401 2:166441638-166441660 AGATGAATGTGAACAACAACAGG + Exonic
942255936 2:174097893-174097915 GGATAAATGGGATCATGGAATGG - Intronic
943064453 2:183071544-183071566 CGATGAATCGGAACATCAGCTGG - Intergenic
946602694 2:221369556-221369578 GGATGGATGGGAAACTAAACAGG + Intergenic
1172235485 20:33370116-33370138 GGATGGCTGGGAAGATGACCAGG + Intronic
1173312890 20:41916368-41916390 GGCTGATTGGGAGCATGTACAGG + Intergenic
1173426928 20:42951324-42951346 GGATGGATGGGCAGATGAATGGG + Intronic
1174098712 20:48110062-48110084 GGATGAATGGGCAGATGGACGGG - Intergenic
1174729799 20:52904742-52904764 GGAAGAAAGGGAACATGAAGTGG - Intergenic
1175187120 20:57186285-57186307 GGAAGAATGGGGACACCAACAGG + Intronic
1175606219 20:60314475-60314497 GGATGAATGGGAGGATGGATGGG - Intergenic
1175606223 20:60314487-60314509 GGATGCATGGGAGGATGAATGGG - Intergenic
1179715415 21:43284350-43284372 GGATGAATGGATAAATAAACAGG - Intergenic
1181536707 22:23550069-23550091 GGATGAATGGGAGGATGGAAGGG - Intergenic
1181536866 22:23550867-23550889 GGATGGATGGAAAGATGAATAGG - Intergenic
1181536870 22:23550891-23550913 GGATGAATGGGAGGATGGAAGGG - Intergenic
1181536874 22:23550903-23550925 GAATGAATGGGAGGATGAATGGG - Intergenic
1181537162 22:23552411-23552433 GGATGGATGGAAAAATGAATGGG - Intergenic
1181906882 22:26205028-26205050 GGATGAAAGGGAACCAGATCTGG - Intronic
1182047357 22:27285783-27285805 GGATGGATGGGTGGATGAACTGG + Intergenic
1182086706 22:27565803-27565825 GGATGGATGGAAAGATGAATGGG + Intergenic
1185212945 22:49582049-49582071 GGATGAATGGGTAGATGGATGGG - Intronic
1185215823 22:49599484-49599506 AGATGAATGGGCAGATGAACAGG - Intronic
950409872 3:12828927-12828949 GGATGAATGGGTAAACAAACTGG - Intronic
950504456 3:13385788-13385810 GGATGAATGGGTAGATGAATGGG + Intronic
953260048 3:41329240-41329262 GTATGATGGGGAACATCAACTGG + Intronic
954432920 3:50480844-50480866 GGAGGAATGGGTACGGGAACGGG + Intronic
956502187 3:69898825-69898847 GAATGAATGGGAAGAGGAAATGG + Intronic
957966157 3:87324189-87324211 AGATGAATGGGAACATCAACTGG + Intergenic
959900453 3:111655015-111655037 GGCTGAATGGGAAGATGATCAGG + Intronic
960292332 3:115900641-115900663 GGATGGAAGGGTACATGAGCAGG + Intronic
962241680 3:133755661-133755683 AGATGAAAGGGAACATGGGCTGG - Intronic
964872187 3:161325412-161325434 GGATGAATGTGAGCAGGCACCGG - Intergenic
965630631 3:170728861-170728883 GGATGAATGGGCTTTTGAACAGG + Intronic
969446452 4:7247578-7247600 GGAGGATTTGGAACATAAACAGG + Intronic
969502491 4:7561627-7561649 GGATGGATGGGTAGATGAATGGG - Intronic
971805739 4:31355974-31355996 GGGTGGATGGGAACATGAGGTGG - Intergenic
972718946 4:41676426-41676448 GGAAAAATGGCAACAGGAACAGG + Exonic
972955468 4:44384629-44384651 GTGTGAATGGGAATAGGAACTGG + Intronic
973253222 4:48082909-48082931 GGATGGATGGGAAGCTGGACAGG - Intronic
978263918 4:106799239-106799261 GCATGAATGTGAACAAGAGCAGG + Intergenic
980564650 4:134523437-134523459 AGGTGAATGGAAACATAAACTGG + Intergenic
981348950 4:143706685-143706707 GGATTAAAGGGTACATGAGCAGG + Intergenic
983115151 4:163806290-163806312 GGAGGAATGGGAGCATGATTAGG + Intronic
983282043 4:165693443-165693465 ACATGAACAGGAACATGAACAGG + Intergenic
983305463 4:165979496-165979518 GGAAGAATAGAAACATGTACAGG + Intronic
985529623 5:426338-426360 GGATGGATGGGAAGATGGATGGG + Intronic
985529665 5:426557-426579 GGATGAATGGGAAGATGGATGGG + Intronic
986019705 5:3789988-3790010 GGATGTTTGGGAAGATGGACAGG + Intergenic
986184972 5:5426618-5426640 TGATGAAGGGGAACATGGAATGG + Intronic
986434128 5:7711136-7711158 GCATGAATGTGAACGTGATCAGG + Intronic
986929941 5:12805424-12805446 AGATGAATGGGTGCAGGAACGGG - Intergenic
987271587 5:16314742-16314764 GGATGGATGGGGACCTGGACAGG - Intergenic
989438403 5:41441086-41441108 GAATGAATAGGCAAATGAACAGG - Intronic
998494798 5:142578854-142578876 GGAGGAATGTGAATATGAAATGG - Intergenic
999293690 5:150444484-150444506 AGATGGATGTGAACATGAAGTGG + Intronic
1000004720 5:157172764-157172786 GGTTGAAAAGGAAAATGAACTGG + Intronic
1000182800 5:158828800-158828822 GGATGAATGGAAAAACAAACTGG + Intronic
1000302012 5:159965133-159965155 AAATGAATGGCAACTTGAACAGG + Intronic
1000906974 5:166975819-166975841 TGATGAAGGGGAAAATGCACCGG + Intergenic
1003057422 6:2834548-2834570 GGATGAATGGGTAGATGGATGGG - Intronic
1003075978 6:2984034-2984056 GGATGAATGAGAAGACGAACTGG + Intergenic
1003601633 6:7522868-7522890 GAATGAATGAGCTCATGAACGGG - Intergenic
1005002691 6:21258966-21258988 GGATAAAGGGGAACATGGAGGGG + Intergenic
1007049539 6:38812935-38812957 GAATTAATGTGAACATGAACTGG + Intronic
1007831065 6:44638788-44638810 GGAGGAAGGGGAGCATGAGCTGG + Intergenic
1008000677 6:46356595-46356617 GGATGGATGTGAACGTGCACAGG + Intronic
1008987776 6:57565889-57565911 GGAGAAATCGGAACATGATCTGG - Intronic
1009176380 6:60464488-60464510 GGAGAAATCGGAACATGATCTGG - Intergenic
1009548773 6:65058679-65058701 GGATGAATGAAAATATGAATTGG - Intronic
1011590019 6:88963181-88963203 GGATGAATGGGAACATGAACGGG - Intronic
1013309312 6:108879012-108879034 GGGTGAATGGGTAGATGGACAGG - Intronic
1013312974 6:108914853-108914875 GGCTGAATTTGCACATGAACCGG - Intronic
1014314956 6:119852176-119852198 AGATGAATGGGCAAATGAATTGG - Intergenic
1015001549 6:128222482-128222504 GGATCAATGGGAATATTCACAGG - Intronic
1016060806 6:139627844-139627866 GGATGAATGGGTAATTGAAGTGG + Intergenic
1017404747 6:154107173-154107195 GGAAGAATGGGGACAGGAAAGGG + Intronic
1018425423 6:163675790-163675812 GAATGGATGGGAACATGATGAGG + Intergenic
1019229207 6:170543993-170544015 GTATGAAAGGGCACATGAAGTGG + Intronic
1020347014 7:7176218-7176240 GGATGAATAGAAACAAGAAAAGG + Intronic
1021890601 7:25182343-25182365 GGAAGACTGGGGACATGAAATGG - Intergenic
1023502398 7:40864683-40864705 GGAGGAATGGGAACTGGAATAGG + Intergenic
1023557452 7:41437964-41437986 CCATGAATAGGAAGATGAACTGG - Intergenic
1024194632 7:47047101-47047123 GGCTGAGTGGGAACATGGGCAGG + Intergenic
1025487288 7:61066602-61066624 GCTTGAATGGGAACATCAAATGG + Intergenic
1026562082 7:71458672-71458694 GGATGGATGGGAACGTGGAAAGG + Intronic
1026873446 7:73866923-73866945 GGATGAATGGGTAGATGAATGGG - Intergenic
1026873531 7:73867295-73867317 GGATGAATGGGTAGATGAATGGG - Intergenic
1028713593 7:93939049-93939071 GTATGAAAGAGAACATGAAAGGG + Intergenic
1029008284 7:97232519-97232541 GGATGAATGGGGAGCTGGACAGG + Intergenic
1029599813 7:101557147-101557169 GGATGAATGGGTCAATGGACAGG + Intronic
1029695523 7:102210706-102210728 GGCTGACTGGGAACAGCAACAGG - Intronic
1031989074 7:128184388-128184410 GGAGGAATGGGCAGATGACCAGG + Intergenic
1031995315 7:128226688-128226710 GGATGAATGGTAGGATGAATGGG - Intergenic
1032108631 7:129056047-129056069 GGAGGAACTGGAAGATGAACGGG + Intergenic
1033911606 7:146269836-146269858 GGATGAGAGGCAACCTGAACTGG + Intronic
1035058500 7:156052217-156052239 GGATGGATGGGGAGATGAAAGGG - Intergenic
1035527399 8:324606-324628 GGATGAATGGGTGGGTGAACAGG + Intergenic
1035850044 8:2909533-2909555 GGATGAATGGATACTTGAAGAGG + Intergenic
1037680390 8:21092485-21092507 GGATGAAGAGGAAAATGAAGAGG - Intergenic
1038593024 8:28858059-28858081 GGATGAGAGTGAACAGGAACGGG + Intronic
1039003097 8:33003665-33003687 GGATGAATGGTTACACAAACTGG - Intergenic
1039528522 8:38237564-38237586 GGATGAATGGAAAAAGAAACTGG + Exonic
1041319108 8:56595095-56595117 CGATGAAGGGGAAAATGCACAGG + Intergenic
1041352403 8:56961010-56961032 AGATAAAGGAGAACATGAACCGG + Exonic
1044219901 8:89657924-89657946 ATATGAATGAGAACATGAGCAGG - Intergenic
1046841112 8:118858243-118858265 GAATGACTGAGAACATGAGCTGG + Intergenic
1047260425 8:123253781-123253803 GGAAGAATGGAAACTTGAAATGG - Exonic
1048316228 8:133364513-133364535 GGAGGAATGGGTATGTGAACAGG - Intergenic
1048359756 8:133687833-133687855 GGAGGAAAGGGAACAGGAATGGG - Intergenic
1049223547 8:141438855-141438877 GGATGAATGGGTAGATGGATGGG + Intergenic
1049223560 8:141438907-141438929 GGATAGATGGGAAGATGAATGGG + Intergenic
1049287355 8:141783059-141783081 GGATGAGTGGATAGATGAACAGG - Intergenic
1049287362 8:141783095-141783117 GGATGAATGGGTGGTTGAACAGG - Intergenic
1049464123 8:142743433-142743455 GGATGGATGGGTAAATGAATGGG + Intergenic
1050119865 9:2297176-2297198 GCATGAATGGGAGCAGCAACAGG + Intergenic
1053017956 9:34674663-34674685 TTATTATTGGGAACATGAACAGG + Intergenic
1053567688 9:39270230-39270252 GAATGAATGGGAACAGAACCTGG + Intronic
1053833698 9:42111177-42111199 GAATGAATGGGAACAGAACCTGG + Intronic
1054129455 9:61348769-61348791 GAATGAATGGGAACAGAACCTGG - Intergenic
1054596854 9:67076233-67076255 GAATGAATGGGAACAGAACCTGG - Intergenic
1055343265 9:75308427-75308449 GGAGGAATGGGATCAGGATCAGG + Intergenic
1055552467 9:77444465-77444487 GGATGAAGTGGAACCTGCACAGG - Intronic
1056286561 9:85093162-85093184 GACTGAATGGCAACATGAACAGG + Intergenic
1057969651 9:99542216-99542238 GGATGAATGGGAAGGTGAACTGG + Intergenic
1059416553 9:114166162-114166184 GGATAAATGGGCAGGTGAACAGG - Intronic
1059497038 9:114718562-114718584 GGAAGAGTGGGAACAGGAAAGGG - Intergenic
1060111547 9:120910120-120910142 GGCTGACTGGGGACATGAATTGG + Intronic
1061244941 9:129396743-129396765 GGATGAATGGGAGGATGGACAGG + Intergenic
1061244946 9:129396767-129396789 GGATGGATGGAAAAATGAATGGG + Intergenic
1061245004 9:129397104-129397126 GGATGGATGGAAAGATGAATGGG + Intergenic
1062372405 9:136246878-136246900 TGATGGAAGGAAACATGAACAGG - Intergenic
1185624388 X:1472410-1472432 GGATGAATGGGTACATGGGTGGG + Intronic
1185759703 X:2681071-2681093 GGGTGAATGGATGCATGAACGGG - Intergenic
1185762636 X:2700435-2700457 GGATGGATGGGTAAATGAATGGG - Intronic
1185762649 X:2700491-2700513 GGATGGATGGGTAAATGAATGGG - Intronic
1185984661 X:4818496-4818518 TGATGAATGGGCAGATGGACAGG + Intergenic
1187533143 X:20114579-20114601 GGGGTAATGGGAACATGCACAGG + Intronic
1188029310 X:25246925-25246947 GAATGAACGGGAAAATGACCAGG + Intergenic
1189417742 X:40830012-40830034 GGAAGAATGGCAACGTAAACTGG - Intergenic
1190599637 X:52077221-52077243 AAATGAATGGCAACAAGAACGGG + Intergenic
1193200325 X:78682292-78682314 TGATGAATGGGTGCATAAACTGG - Intergenic
1193996383 X:88370044-88370066 GGAGGAAAGGGCACATGCACAGG - Intergenic
1195913314 X:109911492-109911514 GGATGAATAGGAAGGGGAACTGG + Intergenic
1199307604 X:146285511-146285533 TGATGAATCAGAAAATGAACTGG - Intergenic
1202245273 Y:22813614-22813636 GGATGAAGAGGAACATCATCTGG - Intergenic
1202398263 Y:24447360-24447382 GGATGAAGAGGAACATCATCTGG - Intergenic
1202472518 Y:25222726-25222748 GGATGAAGAGGAACATCATCTGG + Intergenic