ID: 1011597731

View in Genome Browser
Species Human (GRCh38)
Location 6:89032243-89032265
Sequence CTTGTTGCCCAGGCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011597723_1011597731 10 Left 1011597723 6:89032210-89032232 CCTTTTTTTTTTTTTTTTAGACG 0: 25
1: 589
2: 2714
3: 7979
4: 20939
Right 1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG No data
1011597719_1011597731 23 Left 1011597719 6:89032197-89032219 CCACCGCACCCGGCCTTTTTTTT 0: 103
1: 966
2: 3707
3: 11829
4: 42135
Right 1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG No data
1011597720_1011597731 20 Left 1011597720 6:89032200-89032222 CCGCACCCGGCCTTTTTTTTTTT 0: 148
1: 1072
2: 3459
3: 9968
4: 30589
Right 1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG No data
1011597722_1011597731 14 Left 1011597722 6:89032206-89032228 CCGGCCTTTTTTTTTTTTTTTTA 0: 96
1: 2664
2: 12164
3: 37698
4: 124465
Right 1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG No data
1011597721_1011597731 15 Left 1011597721 6:89032205-89032227 CCCGGCCTTTTTTTTTTTTTTTT 0: 2045
1: 6261
2: 17702
3: 51841
4: 131265
Right 1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011597731 Original CRISPR CTTGTTGCCCAGGCTGGAGG GGG Intergenic
No off target data available for this crispr