ID: 1011598357

View in Genome Browser
Species Human (GRCh38)
Location 6:89037659-89037681
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1251
Summary {0: 2, 1: 24, 2: 192, 3: 368, 4: 665}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011598349_1011598357 12 Left 1011598349 6:89037624-89037646 CCCAGACAACATGTCTAGACACA No data
Right 1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG 0: 2
1: 24
2: 192
3: 368
4: 665
1011598348_1011598357 19 Left 1011598348 6:89037617-89037639 CCTAGTTCCCAGACAACATGTCT No data
Right 1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG 0: 2
1: 24
2: 192
3: 368
4: 665
1011598350_1011598357 11 Left 1011598350 6:89037625-89037647 CCAGACAACATGTCTAGACACAC No data
Right 1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG 0: 2
1: 24
2: 192
3: 368
4: 665
1011598347_1011598357 20 Left 1011598347 6:89037616-89037638 CCCTAGTTCCCAGACAACATGTC No data
Right 1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG 0: 2
1: 24
2: 192
3: 368
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011598357 Original CRISPR AGGGAAACTACTGCCTTGAA GGG Intergenic
900430968 1:2603101-2603123 AGGGCACCTAGTGCCTTGGAAGG - Intronic
902806431 1:18863940-18863962 AGGGAAACTGAGGCCTGGAAAGG + Intronic
903357784 1:22758679-22758701 AGGGAAACTGAGGCCTAGAAAGG - Intronic
903587949 1:24431332-24431354 CGGGAAAAAACTGCCGTGAAAGG + Intronic
904168904 1:28577353-28577375 AGTGAAAGCACTGCCTTGCAGGG - Intronic
904424911 1:30416983-30417005 AAGGAAACTGCTACCTAGAAAGG + Intergenic
904430996 1:30463984-30464006 AGAGAAACCAGTGACTTGAAGGG - Intergenic
905739904 1:40361246-40361268 AGGGAACCCACTGCCTTGAAGGG + Intronic
906915467 1:50004673-50004695 AGGGAACCTGCAGCCCTGAAAGG + Intronic
907023719 1:51094781-51094803 AGGGAACCCACTTCCTGGAAGGG + Intergenic
907387581 1:54136096-54136118 AGGGAATCCTGTGCCTTGAAAGG + Intronic
907550013 1:55297330-55297352 AGGGCACCTCCTGTCTTGAAGGG - Intergenic
908024905 1:59939963-59939985 AGGGAACCCACTGCCCTAAAAGG - Intergenic
908024961 1:59940312-59940334 AGGGAACTTGCTGCCTTGAAAGG - Intergenic
908093114 1:60707199-60707221 AGGGAACCCACTGTCCTGAAGGG + Intergenic
908175623 1:61552595-61552617 AGAGAAACTATTGCCTTTGAAGG - Intergenic
908397614 1:63740681-63740703 AGGGAACCCAGTGCCTTGAAGGG - Intergenic
908745147 1:67369476-67369498 AGGGAACACACTGCCTTGAGAGG - Intronic
908944264 1:69475123-69475145 AGGGAGACTCCTGCCCTGAAGGG + Intergenic
908944310 1:69475481-69475503 AAGGAACCTGCTGCCCTGAAGGG + Intergenic
908958945 1:69671236-69671258 AGGGAACATGCTGCCTTGAGGGG - Intronic
909219117 1:72931841-72931863 AGGGAAAGTTCTGCCTTGAGAGG - Intergenic
909270455 1:73617373-73617395 GGGGAACCCACTGCCCTGAAAGG - Intergenic
909615664 1:77605740-77605762 AAGGAACCCACTGCCTTGAAGGG + Intronic
909848835 1:80434305-80434327 AGGGAACCCACTACATTGAAGGG - Intergenic
909903059 1:81161482-81161504 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
910229848 1:84974540-84974562 AGGGAACCTACTGCCTTGAAGGG + Intronic
910330624 1:86068878-86068900 AGGGAACTTCCTGCTTTGAAGGG + Intronic
910349334 1:86277771-86277793 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
910379196 1:86608369-86608391 AGGGAACTCACTACCTTGAAGGG - Intergenic
910379299 1:86609011-86609033 AGGAAACTTGCTGCCTTGAAGGG - Intergenic
910515362 1:88054316-88054338 AGGGAGCCCACTGCCCTGAAGGG - Intergenic
910547314 1:88432892-88432914 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
910560236 1:88582183-88582205 AGGGAACCCATTGCCTTGAAGGG + Intergenic
910643498 1:89489448-89489470 AGAGAACCTACTGCCTGAAAGGG + Intergenic
910697113 1:90031080-90031102 GCGGAAACTCCTGCCTTGATAGG - Intronic
910978207 1:92930586-92930608 AGGGTAAATAATACCTTGAAGGG - Intronic
911019818 1:93375191-93375213 AAGGAACCCTCTGCCTTGAAGGG + Intergenic
911125156 1:94334530-94334552 AGGGAAACTACCACCTTGGAAGG + Intergenic
911344028 1:96674590-96674612 AGGGAACTCACGGCCTTGAAGGG - Intergenic
911939135 1:104019589-104019611 AGAGAACCTGCTGCCTGGAAGGG - Intergenic
911960910 1:104301453-104301475 AGGGAACCAGCTGCCTTGAAGGG + Intergenic
912015313 1:105027228-105027250 AGGGAACCCACTGCTTCGAAAGG + Intergenic
912116940 1:106418736-106418758 AGGAAACATACTGCCTTGAAGGG + Intergenic
912152728 1:106879996-106880018 AGGGAACCCACAGCCTTGAAGGG + Intergenic
912280557 1:108308519-108308541 AGAGAATCTGTTGCCTTGAAGGG - Intergenic
912287669 1:108385838-108385860 AGAGAATCTGTTGCCTTGAAGGG + Intronic
912316385 1:108670811-108670833 AGGGAACCCACTGCCTTGAAGGG + Intergenic
912598518 1:110903528-110903550 AGGGAATCCATTGCCTTGAAGGG + Intergenic
912598574 1:110903887-110903909 AGGGAGCCCACTGCCCTGAAGGG + Intergenic
912601100 1:110934095-110934117 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
912616811 1:111110199-111110221 AGAGAATCTACTGCCCTGATGGG - Intergenic
912633291 1:111267758-111267780 AGGGAGCCTGCTGACTTGAAGGG - Intergenic
912871494 1:113311033-113311055 AGGAGACCTGCTGCCTTGAAGGG + Intergenic
912873161 1:113328316-113328338 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
913147114 1:116003092-116003114 AGGGAACCTGCTGCCCTGAAAGG - Intronic
913706878 1:121434275-121434297 AGGGAACTCACTGCCTTGAAAGG + Intergenic
915185914 1:154105129-154105151 AGGGAACCTGCTGTCTTGAAAGG + Intronic
915752808 1:158227958-158227980 AGGAGACCTACTGCCTTGAAGGG + Intergenic
915777525 1:158506930-158506952 AGGGAACCTGCTACCCTGAAGGG - Intergenic
915938043 1:160100226-160100248 AGAGAAACTGAGGCCTTGAAGGG + Intergenic
916313607 1:163423613-163423635 AGAGAAAATTCTGCGTTGAAAGG - Intergenic
916321845 1:163513104-163513126 CGGAAGACCACTGCCTTGAAGGG + Intergenic
916341863 1:163745463-163745485 AGGTAAACTGCTGCCTTGAAGGG - Intergenic
916360548 1:163962669-163962691 AGGGAACCCACTGCCTTGAAAGG + Intergenic
916530298 1:165650143-165650165 ATGGAAACTACTCCCTAGCAGGG - Intronic
917246308 1:173004835-173004857 AGGGAGCCCACTGCCCTGAAAGG - Intergenic
917300598 1:173570292-173570314 AGAGAAACTGCTGTCTTGAAGGG - Intronic
917306212 1:173628030-173628052 AGGGAACCAGCTGCCTTGAAGGG + Intronic
917396959 1:174603789-174603811 AGGGAACCTGCTGCCTTGTAGGG - Intronic
917986666 1:180326793-180326815 AGGGAACCCACTGCCTTGAAGGG - Intronic
918018767 1:180664381-180664403 AGGGAACCAGCTGCCTTGAAGGG - Intronic
918476223 1:184928091-184928113 AGGGAACTTGCTACCTTGAAGGG - Intronic
918854169 1:189729541-189729563 AGGGAATCCACTGCCCTGATGGG - Intergenic
918915809 1:190634988-190635010 AGGGACATAACTGCCTTGAAAGG - Intergenic
919169784 1:193939086-193939108 AAGGAACCCAATGCCTTGAAGGG + Intergenic
919272025 1:195360372-195360394 AGGGAACCTGCTGCCATCAAAGG + Intergenic
919455864 1:197818823-197818845 AGGGAAACCTCTGCCTTGAAGGG + Intergenic
920270909 1:204763120-204763142 AGGGAAACTAAAGCCTGGAGAGG + Intergenic
920596745 1:207279667-207279689 AGGGAACCTGCTTCCTTGAAGGG - Intergenic
920678525 1:208055440-208055462 GGGGAAACTCTTGCCTGGAATGG + Intronic
920819304 1:209365491-209365513 AGGGAAACAACTGCATTCAATGG - Intergenic
920845411 1:209589302-209589324 AGGGACACTAGTGCCTGGGATGG - Intronic
920953625 1:210597717-210597739 AGGGAGCCTACTGTCCTGAAAGG - Intronic
920953675 1:210598070-210598092 AGGGAACCCACTGCTTTGAAGGG - Intronic
920975182 1:210779263-210779285 ACCAAAACTACTGCCTTGACAGG - Intronic
921409182 1:214816090-214816112 GGGGAAACTTCAGCCTTTAAAGG - Intergenic
921538974 1:216388910-216388932 ATGGAAACTACTGTATTTAAAGG + Intronic
921634555 1:217477136-217477158 AGGGAACCCACTGCCTTGAAGGG + Intronic
921746172 1:218743003-218743025 AGGAGACCTGCTGCCTTGAAAGG + Intergenic
921769724 1:219022039-219022061 AGGGAGCACACTGCCTTGAAGGG + Intergenic
921929427 1:220743012-220743034 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
922320463 1:224482123-224482145 GGGGAACCCACTGCCCTGAAGGG - Intronic
922358144 1:224795917-224795939 AGGGAATCTACTGCCTTGAAAGG - Intergenic
922377112 1:224979895-224979917 AGGGAACCCACTGCTGTGAAGGG + Intronic
922685298 1:227634130-227634152 GGGAAACCCACTGCCTTGAAGGG + Intronic
922689420 1:227676376-227676398 AGGGAAACAAGAGCCATGAATGG + Intronic
924367255 1:243308215-243308237 ATGGAAAATTCTGCCTTTAAAGG + Intronic
924490790 1:244535645-244535667 GGGGAACCAACTGCCCTGAAAGG - Intronic
924516231 1:244768475-244768497 AGGGAAACTGCTGCCTTGATGGG - Intergenic
924629231 1:245721432-245721454 AGGGAACCCACTGCTTTGAAAGG + Intergenic
924793308 1:247272817-247272839 AGGGAACCCAGTACCTTGAAAGG - Intergenic
1063297295 10:4819780-4819802 AGAGGAACCACTGCTTTGAAGGG + Intronic
1064696826 10:17975411-17975433 AAGGAACCTGCTGCCTTGAAGGG - Intronic
1065381565 10:25096262-25096284 AGAGATCCTGCTGCCTTGAAGGG - Intergenic
1065431479 10:25661508-25661530 AGATAGACTGCTGCCTTGAAGGG - Intergenic
1065487420 10:26248623-26248645 AGGGAAACGAGTTCCTTCAAGGG - Intronic
1066142948 10:32526299-32526321 GGGGAACCCACTGCCCTGAAGGG - Intronic
1066649752 10:37643103-37643125 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1066708206 10:38203753-38203775 AGGGAACTTGCTGCCTTAAAGGG + Intergenic
1067032641 10:42888651-42888673 AAGGAACCCACTGCCTTGAAGGG - Intergenic
1067750185 10:48966561-48966583 AGGGAAGCCTCTGCCTGGAAAGG + Exonic
1068193922 10:53690940-53690962 AAGGAAACTACAGTATTGAAAGG + Intergenic
1068373680 10:56151790-56151812 AGGGAACCCACTGCCTTGAAAGG + Intergenic
1068411412 10:56660471-56660493 AGGGAATCTGCTGCCTTGAAAGG - Intergenic
1068478802 10:57563052-57563074 AGGGAACCTGCTGCTTTAAAGGG - Intergenic
1069193486 10:65519764-65519786 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1069343463 10:67439739-67439761 AGGGAGCCTGCTACCTTGAAGGG + Intronic
1069933619 10:71900302-71900324 AGAGAACCTGTTGCCTTGAAGGG - Intergenic
1070059424 10:72967810-72967832 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1070451732 10:76565589-76565611 AAGAAAACTAAGGCCTTGAAAGG + Intergenic
1070618969 10:77992019-77992041 AGGGAAACTACTGGGTCAAAAGG + Intronic
1071215295 10:83393887-83393909 AGGGAACCCAATGCCTTGAAGGG - Intergenic
1071799472 10:89042804-89042826 AGGGAAGCCAGTGACTTGAAAGG - Intergenic
1071935552 10:90526500-90526522 AGGGAACCTCCTGCCTTGAAGGG - Intergenic
1072058808 10:91788284-91788306 AGGGAACCCACTTCCCTGAAGGG + Intergenic
1072862719 10:99023106-99023128 GGAGAAACTAATGCCCTGAAGGG + Intronic
1073708227 10:106010936-106010958 AGGAAACCCACTACCTTGAAGGG - Intergenic
1073823372 10:107291305-107291327 GGGGAGACCACTGCCCTGAAAGG - Intergenic
1073823425 10:107291649-107291671 AGGGAAACCACTTCATTGAAGGG - Intergenic
1073875569 10:107918078-107918100 TGGGAAACTGCTGCTTTAAAGGG - Intergenic
1074302202 10:112242724-112242746 AGGGACTCCATTGCCTTGAAGGG - Intergenic
1075830559 10:125407496-125407518 AGGGAACTTGCTTCCTTGAAGGG - Intergenic
1076094577 10:127720765-127720787 AGGGAACCTGCTGCCTTGAAAGG + Intergenic
1076376792 10:129993721-129993743 AGGGAACTCACTGCCTTGAAGGG + Intergenic
1076701556 10:132275779-132275801 AGAGAAACTACAGCCTTCAGCGG + Intronic
1077427414 11:2489777-2489799 AGGGAATCCACTGCCTTGGAGGG + Intronic
1077530828 11:3093997-3094019 AGGGACACTACATCCTTGAGCGG - Intronic
1077740381 11:4839593-4839615 AGGGAACCTGCTGCCTTGAAGGG + Intronic
1078244626 11:9563077-9563099 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1078690853 11:13579272-13579294 AGGAAACCTGCTGCCTTAAAGGG + Intergenic
1078843106 11:15097165-15097187 AGGGAATCTGTTGTCTTGAAGGG - Intergenic
1079258303 11:18852331-18852353 AGGAAACCCATTGCCTTGAAGGG + Intergenic
1079565587 11:21878309-21878331 AGAGAACCCACTTCCTTGAAGGG + Intergenic
1080351086 11:31386504-31386526 GGGGAACCTTCTGCCTTGAAGGG + Intronic
1080489871 11:32751054-32751076 AGGAAACCTGCTGCCTTGAAGGG - Intronic
1081245726 11:40764217-40764239 AGGAAACCTGTTGCCTTGAAGGG + Intronic
1082114764 11:48315924-48315946 AGAAAACCTGCTGCCTTGAAAGG - Intergenic
1082970233 11:59012706-59012728 AGGGAGCCCACTGCCCTGAAGGG + Intronic
1083071915 11:59993500-59993522 AGGGAACCCACTGCTTTGAAGGG - Intergenic
1083528854 11:63398127-63398149 AGGAAACGTACTGCCTTGAAGGG - Intronic
1084218328 11:67663538-67663560 AGGGAAACTGAGGCCTTGAGAGG + Intronic
1084370920 11:68742547-68742569 AAGTAAAATACTGACTTGAAAGG - Intronic
1084763820 11:71294558-71294580 GGGGAGCCCACTGCCTTGAAGGG - Intergenic
1085223431 11:74895927-74895949 AGGGAACCTGCTGCTTTGAAGGG + Intronic
1085406508 11:76266261-76266283 AGGGAAACTGAGGCCTAGAAAGG - Intergenic
1085572150 11:77568969-77568991 AGGGAACCAACTGCCTTAAAGGG - Intronic
1085980500 11:81718436-81718458 AAGGAACCCATTGCCTTGAAAGG + Intergenic
1086033061 11:82383752-82383774 AGAGAACCTGCAGCCTTGAAGGG + Intergenic
1086261545 11:84946454-84946476 AAGGAACCTGCTGCCTTGAAGGG - Intronic
1086524575 11:87710754-87710776 AGGGAACCTGCTGCCTTGAATGG + Intergenic
1086524643 11:87711214-87711236 TGGGAGCCTACTGCCCTGAAGGG + Intergenic
1086897819 11:92334069-92334091 AGGGAGACTAATGACTTAAAGGG + Intergenic
1087032054 11:93715725-93715747 AGAGAACCTGCTGCCTTCAAGGG - Intronic
1087299277 11:96413525-96413547 AGGGAACCCACTACCTTGAAGGG + Intronic
1087313413 11:96577393-96577415 AAGGAACCCACTTCCTTGAAGGG - Intergenic
1087359197 11:97136606-97136628 AGGGAAAATGTTGCCCTGAAGGG - Intergenic
1087417170 11:97871808-97871830 AGGGAACCCACTGCCCTGAAGGG - Intergenic
1087473014 11:98601092-98601114 AGGGAAGCCACTGCCTTGAAGGG - Intergenic
1087498198 11:98917403-98917425 AGAGAACCCACTGTCTTGAAGGG - Intergenic
1087598400 11:100283169-100283191 AAGGAACCCACTACCTTGAAGGG - Intronic
1087721007 11:101665348-101665370 AGAGAACCCACTACCTTGAAGGG - Intronic
1087876916 11:103369718-103369740 AAGCAACCTGCTGCCTTGAAGGG + Intronic
1087887546 11:103497716-103497738 AGGAAACCTACTTACTTGAAGGG + Intergenic
1088046412 11:105457585-105457607 ATGGAACATGCTGCCTTGAATGG + Intergenic
1088154882 11:106790726-106790748 GGGGAACCTACTGTATTGAAGGG - Intronic
1088362052 11:109001459-109001481 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1088938242 11:114426184-114426206 AGGGAATCTACTACATTGACAGG - Intronic
1089762232 11:120736177-120736199 AGGGAACCTGCTACCTTGAAGGG - Intronic
1089946546 11:122479928-122479950 AGGCAACCCACTGCCCTGAAGGG + Intergenic
1090676818 11:129006805-129006827 GGGGAACTCACTGCCTTGAAAGG - Intronic
1090676937 11:129007460-129007482 AGGGAACCCACTGCCTTCAAGGG - Intronic
1090986849 11:131774934-131774956 AGGGAAACCACTGCAGGGAACGG - Intronic
1091520915 12:1241509-1241531 AGTGAAAAAATTGCCTTGAAAGG - Intronic
1092497607 12:9012380-9012402 AAGGAATGTGCTGCCTTGAAAGG + Intergenic
1092670839 12:10858894-10858916 AGGAAACCTACTGCATTGAAAGG + Intronic
1093321301 12:17718532-17718554 AGAGAACCTACTGCCCTGAAGGG - Intergenic
1093403534 12:18777173-18777195 AGAGAACGTACTTCCTTGAAGGG + Intergenic
1093420057 12:18964848-18964870 AGGGAACCTGTTGCCTTAAAGGG - Intergenic
1093538167 12:20247830-20247852 AGGGAATCCTCTGCCTTGAAGGG + Intergenic
1093538219 12:20248177-20248199 AAGGAGCCTACTGCCCTGAAGGG + Intergenic
1093588643 12:20872678-20872700 AAGGAATCCACTGCCTTGAAGGG - Intronic
1093991074 12:25590828-25590850 AGGGAATCTGCTGTATTGAAGGG + Intronic
1094011808 12:25817581-25817603 AGGAAAAGTATTGCCTAGAAAGG + Intergenic
1094258533 12:28464596-28464618 AGGGAACCTGCTGCCTTGAAAGG + Intronic
1094258651 12:28465280-28465302 AGGGAACTCACTGCCCTGAAGGG + Intronic
1094419754 12:30258041-30258063 AAGGAAACCAGTGCCTTGAATGG + Intergenic
1094675644 12:32617647-32617669 AGGGAATCTCCTACCCTGAAAGG + Intronic
1095163294 12:38941587-38941609 AGGGAACCTACTGCTTTGAAGGG + Intergenic
1095169673 12:39019631-39019653 AGGGAATCCATTGCCTTGAAGGG + Intergenic
1095573588 12:43709853-43709875 AGGGAGCCCACTGTCTTGAAGGG - Intergenic
1095573646 12:43710217-43710239 AGGGAACCTGCTGCTTTGAAGGG - Intergenic
1095625071 12:44304715-44304737 AGGGAACCCACTGACTTGAAGGG + Intronic
1095808116 12:46343376-46343398 GGGGAGACTACTGCCCTGAAGGG - Intergenic
1095808162 12:46343734-46343756 AGAGAGCCTGCTGCCTTGAAGGG - Intergenic
1096954822 12:55515797-55515819 AGTGAAACTGCTGCCTTTAAAGG + Intergenic
1097397941 12:59098857-59098879 GGGGAAACTACTGAGTTGAAAGG - Intergenic
1097466260 12:59928491-59928513 AAGGAACATATTGCCTTGAAGGG + Intergenic
1097508595 12:60507480-60507502 AGTGAACCCACTGCCTTGAAGGG + Intergenic
1097552350 12:61090561-61090583 AGGGAACCCACTGCATTAAAGGG - Intergenic
1097563612 12:61239638-61239660 GGGGAGCCCACTGCCTTGAAAGG - Intergenic
1097569016 12:61308152-61308174 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1098046677 12:66408102-66408124 AGGGAACCTGCTGCCTTGAAGGG + Intronic
1098089344 12:66884492-66884514 AGGAAAGCAACTTCCTTGAATGG + Intergenic
1098395276 12:70010751-70010773 AGGGAATCTATTGCCTTGAAGGG + Intergenic
1098612198 12:72472595-72472617 TGGGAAAATACTTCCTTGAAAGG - Intronic
1098667355 12:73180591-73180613 AGGGAACCTGCTGTCTTGAAGGG - Intergenic
1098736512 12:74112285-74112307 AGGGAACTTACTGCCATGAAGGG - Intergenic
1098736656 12:74113269-74113291 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1098959106 12:76719691-76719713 AGGGAACCTGCTGCTCTGAAAGG + Intergenic
1098975341 12:76896306-76896328 AGGGAATCCACTGCCCTGATGGG + Intergenic
1099100926 12:78439558-78439580 AGGGAACCCACTGCCCTGAAGGG - Intergenic
1099243993 12:80172775-80172797 AGCGATACTCCTGCCATGAATGG + Intergenic
1099491355 12:83292436-83292458 AGGGAACCTACTACCTCGAAGGG + Intergenic
1099495276 12:83339428-83339450 AGGGAACCCAATGCCTTGAAAGG + Intergenic
1099564953 12:84230891-84230913 AGGGAACCTGCTGCTTCGAAGGG - Intergenic
1099764137 12:86960713-86960735 AAGGAGCCTACTGCCATGAAGGG - Intergenic
1099764183 12:86961067-86961089 AAGGGAACCACTGCCTTGAAGGG - Intergenic
1099781696 12:87203149-87203171 AGGAAGCCCACTGCCTTGAAGGG + Intergenic
1099807910 12:87543359-87543381 AGGGAGCACACTGCCTTGAAGGG + Intergenic
1099907964 12:88794130-88794152 AGGGAATGTACTGCCCAGAATGG + Intergenic
1100270734 12:93022102-93022124 ACGGACACTACTCCCTTGCAAGG - Intergenic
1100909205 12:99338766-99338788 AGGGAACCCACTATCTTGAAGGG - Intronic
1100996012 12:100302001-100302023 AGGGGACCCGCTGCCTTGAAGGG - Intronic
1101339496 12:103829974-103829996 AGGTGATCTACTGTCTTGAATGG + Intronic
1102266644 12:111491651-111491673 AGGGAACCCATTGCCTTGAAGGG + Intronic
1102317912 12:111904883-111904905 AGAGAACCTGCTGCCTTGAAGGG + Intergenic
1102541393 12:113621922-113621944 GGGGAAACAACTGCTTTGGATGG + Intergenic
1102842392 12:116139407-116139429 AGAGAAAATACTGCCTTTCAGGG + Intronic
1103461465 12:121108157-121108179 AGGGAACTCACTGCCCTGAAGGG + Intergenic
1106074740 13:26448467-26448489 AGAGAACCTGCTGGCTTGAAGGG + Intergenic
1106855367 13:33846347-33846369 AGGGAACCCGCTGCCTTGAAGGG - Intronic
1107319568 13:39171035-39171057 TAGTAAACTACTTCCTTGAAAGG + Intergenic
1107524227 13:41214167-41214189 AGGGAACCCTCTGCCTTGAAGGG - Intergenic
1107582219 13:41802745-41802767 AGGGAACCCACTGCCCTGAAGGG + Intronic
1107774452 13:43823182-43823204 ATGAAACCTGCTGCCTTGAAGGG - Intergenic
1107807906 13:44172158-44172180 AGGGAACTTGCTGCCTTGAAGGG - Intergenic
1108137974 13:47385894-47385916 AGGGAAACTGCAGTCTTGAAGGG + Intergenic
1108615678 13:52129344-52129366 TGGGAGACTACTGCCTTGACGGG - Intergenic
1108858010 13:54819820-54819842 AGGGAAGTCACTGCCTTGAAGGG + Intergenic
1108973005 13:56401180-56401202 TGGGAATCTGTTGCCTTGAAGGG + Intergenic
1108989829 13:56640777-56640799 AGGGAACTCATTGCCTTGAAGGG + Intergenic
1109031725 13:57199344-57199366 AGGGAACCTGCTACCTTGAAGGG - Intergenic
1109402748 13:61856991-61857013 AGGGAATCTTCTGCCATGTAGGG - Intergenic
1109402762 13:61857137-61857159 AGGGAATCTTCTGCCATGCAGGG - Intergenic
1109402806 13:61857469-61857491 AGGGAACCTGCTCCCATGAAGGG - Intergenic
1109402856 13:61857773-61857795 AGGGAAACTGCTATCCTGAAGGG - Intergenic
1109583625 13:64371260-64371282 AGGGAATTTGCTGTCTTGAAAGG - Intergenic
1109747623 13:66647451-66647473 AGGAAAACTGCTGTCTTGAAGGG + Intronic
1109824291 13:67697473-67697495 AGGGAATCCGCTGCCTTGATGGG + Intergenic
1110078970 13:71286916-71286938 AGGGAGCCTGCTACCTTGAAGGG - Intergenic
1110376708 13:74802561-74802583 AGGGAACCCACTTCCTTGAAGGG + Intergenic
1110448803 13:75618100-75618122 AAGGATACTGTTGCCTTGAAGGG - Intergenic
1110501269 13:76231247-76231269 AGGGAACCTACTGTCTTGAAGGG + Intergenic
1110901477 13:80830917-80830939 AGGAAATCTGCTGCCTTGAAGGG + Intergenic
1110916772 13:81030767-81030789 AGGGAACCCACTGCCCTGATGGG - Intergenic
1111085841 13:83374110-83374132 AGGGAGCCCATTGCCTTGAAAGG - Intergenic
1111300392 13:86342029-86342051 AAGGAACCCACTGCCTTGAAAGG - Intergenic
1111390816 13:87592210-87592232 AAGGAATCCACTGCCTTGAAGGG + Intergenic
1111449098 13:88390842-88390864 AGAGAACCTATTTCCTTGAAGGG + Intergenic
1111542676 13:89689366-89689388 AGGGAACCTGCTGCCATGAAGGG + Intergenic
1111639282 13:90947194-90947216 AGGGAAACTGGTGCCTTAAAGGG + Intergenic
1112618910 13:101034926-101034948 AGGGAACCTGCTGTCTTGAAGGG - Intergenic
1113217589 13:108060734-108060756 AGGAAACCTATTACCTTGAATGG + Intergenic
1113244317 13:108377540-108377562 AGTGAACCTGCTGCCTTGAAGGG - Intergenic
1113490123 13:110684770-110684792 AGAGAAACCACTCCCTTAAATGG + Intronic
1113558622 13:111258487-111258509 AGGGAACCCACTGCTTGGAAGGG + Intronic
1114245081 14:20905418-20905440 GGGGAGCCTACTGCCCTGAAGGG + Intergenic
1114985172 14:28217640-28217662 ACAGAACCCACTGCCTTGAAGGG - Intergenic
1115381656 14:32746411-32746433 AGGAAACCCACTACCTTGAAAGG - Intronic
1115620335 14:35134530-35134552 AGGGAACTCACTGCCTTGAAGGG - Intronic
1115660976 14:35494165-35494187 AGGGAAATTGCTGCCTTGAAGGG + Intergenic
1115918325 14:38342566-38342588 AGGGAATCTGCTGACTTGAAGGG + Intergenic
1115948622 14:38694453-38694475 AGGAAATCTGCTGCCTTAAAGGG + Intergenic
1116021657 14:39469059-39469081 AGGAAACTTGCTGCCTTGAAGGG - Intergenic
1116045697 14:39740261-39740283 AGGAAACCCACTGCCTTGAAGGG + Intergenic
1116087072 14:40254045-40254067 AGGAAATCTGCTGCCTTGAAAGG - Intergenic
1116275628 14:42827772-42827794 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1116413169 14:44649518-44649540 AGGGAGCCTGCTGCCTTGAAGGG + Intergenic
1116504816 14:45665269-45665291 AGGGAGCCCACTGCCCTGAAGGG - Intergenic
1116541886 14:46109877-46109899 AGGGAATCTGCTGCCTTAAAGGG + Intergenic
1116583683 14:46674841-46674863 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1116677743 14:47927060-47927082 AGGGAACCTGCTGCCTTGAGGGG - Intergenic
1116765919 14:49070486-49070508 AGGGAACCTACTGCCTTGAAGGG + Intergenic
1116790707 14:49336978-49337000 AAGAAAGCTACTTCCTTGAAAGG - Intergenic
1116889039 14:50249557-50249579 AGGGAACCTACTGCCTTGGAGGG + Intronic
1116930715 14:50688229-50688251 AGGGAGCCCACTGCCTTGACGGG - Intergenic
1117034340 14:51712254-51712276 AGGGAAAAGATTGCCTTAAAAGG + Intronic
1117208490 14:53470270-53470292 AGGGAACCCACTGACTTGAAAGG - Intergenic
1117384293 14:55195258-55195280 AGGGAACCTACTGCCTTGAAAGG - Intergenic
1117418324 14:55518837-55518859 AGGGAACTCGCTGCCTTGAAGGG + Intergenic
1117483159 14:56168917-56168939 AGGGAACCCACTGCCTTGAAGGG - Intronic
1117606961 14:57440052-57440074 AGGGAGCCCACTGCCCTGAAGGG - Intergenic
1117629163 14:57671487-57671509 AGGGAACCCACTGACTTGAAGGG + Intronic
1117634674 14:57729480-57729502 TGGCAACCCACTGCCTTGAAGGG - Intronic
1117679054 14:58184651-58184673 ATGGAAATTACTTCCTTGGAGGG + Intronic
1117795455 14:59388806-59388828 AGGGAACCTGCTACCTTGAAGGG - Intergenic
1117843051 14:59880953-59880975 AGGGAACTTACTGCCTTGAAGGG - Intergenic
1117893238 14:60449932-60449954 AGGGAATCCACTGCCTTGAAGGG + Intronic
1118034201 14:61849053-61849075 AGGGAGCCTGCTGCCTTGAAGGG - Intergenic
1118096894 14:62546952-62546974 AGGGAACCTGCTGCCTTTAAAGG + Intergenic
1118241188 14:64060389-64060411 AGGGAACCCACTTCCTCGAAGGG - Intronic
1118455044 14:65937786-65937808 ATGGAAATGACTGCCATGAAGGG - Intergenic
1118539080 14:66802697-66802719 AGGGAACCCACAGCCTTGTAGGG - Intronic
1118543523 14:66858422-66858444 AGGGAACCTGTTGCCTTGAAGGG + Intronic
1120100088 14:80435008-80435030 AGAGAACCAACTGCCCTGAAGGG + Intergenic
1120275686 14:82370176-82370198 AAGGAACCTGCTGCCTTGAAGGG + Intergenic
1120439698 14:84520664-84520686 AAGGAGCCCACTGCCTTGAAGGG - Intergenic
1120697405 14:87659608-87659630 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1120697469 14:87659939-87659961 AGGGAGCCCACTGCCTTGAAGGG + Intergenic
1120808109 14:88775016-88775038 AGGGAAACTGCTGCCTTGAAGGG + Intronic
1121375918 14:93410711-93410733 AGGGAACCTGCTTCCTTGAAGGG + Intronic
1121494654 14:94383817-94383839 AGGGAAACTGCTGCACAGAAGGG + Intronic
1122063207 14:99150951-99150973 AAGGAAGGTACTGCCTTAAAAGG - Intergenic
1124081405 15:26501549-26501571 GGGAAAACTGCTTCCTTGAAGGG - Intergenic
1124844303 15:33275568-33275590 AGGGAACCTGCTCCCTTGAAGGG - Intergenic
1125827122 15:42685894-42685916 AGGGATACATCTGCCCTGAAAGG - Exonic
1126015647 15:44347961-44347983 AGGGAACCTCCTGCCTTGAAGGG + Intronic
1126053359 15:44707471-44707493 AGGGAACCTGCTGCCTTGAAGGG - Intronic
1126183749 15:45810895-45810917 ATGGAACCTACTGCCTTGATGGG + Intergenic
1126183803 15:45811222-45811244 AGGGAGCCCACTGCCTTGAAAGG + Intergenic
1126250816 15:46565896-46565918 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1126294949 15:47129598-47129620 GGGGAACCCACTGCCCTGAAGGG - Intergenic
1126440512 15:48683405-48683427 AGGGAACCCACCACCTTGAAAGG + Intergenic
1126979866 15:54228597-54228619 AGGGAACCTGCTGCCTTGAAGGG - Intronic
1127178053 15:56382604-56382626 AGGGAATCTGCTGCCTTGAAGGG - Intronic
1127586578 15:60383531-60383553 AGGGAAGTTAATACCTTGAAAGG - Intronic
1127971564 15:63966171-63966193 AGGGAATCCACTGCCTTGAAGGG - Intronic
1128364512 15:66988267-66988289 GGGGAGCCCACTGCCTTGAAGGG + Intergenic
1128901087 15:71423436-71423458 AGGGAACCTGCTGCCTTGAAGGG - Intronic
1129501032 15:76038013-76038035 AGGGAAACTGATTCCTTGAAGGG + Intronic
1129561783 15:76577962-76577984 AGGGAAGCCACTGTCCTGAATGG + Intronic
1129642366 15:77393531-77393553 AGAGAACCCACTGCCTTGAAGGG + Intronic
1130400262 15:83546108-83546130 AGGAAATCCACTGCCCTGAAGGG - Intronic
1130400311 15:83546415-83546437 AGGGAACCCACTGCATTGAAAGG - Intronic
1130961704 15:88663776-88663798 AGGGAAACTGCCGTTTTGAAGGG + Intergenic
1131315145 15:91329203-91329225 ATGGAACCTGCTGCCTTGAAGGG - Intergenic
1131950206 15:97673489-97673511 GGAGAACCCACTGCCTTGAAGGG - Intergenic
1131959455 15:97773395-97773417 AGGGAACCTACTTCCTTAAAGGG - Intergenic
1132230672 15:100181557-100181579 AGGAAACCCATTGCCTTGAAGGG - Intronic
1132335775 15:101047506-101047528 AGGGAAGCTGCTGCCCGGAAGGG - Intronic
1132439148 15:101841570-101841592 AAGGAACCCACTGCCTTGAAGGG - Intergenic
1133601467 16:7343828-7343850 AGGGTGACTACTGCCCAGAAGGG - Intronic
1133834217 16:9351786-9351808 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1135879521 16:26240575-26240597 AGAAAACCCACTGCCTTGAAGGG + Intergenic
1135879574 16:26240934-26240956 AGAGAGCCCACTGCCTTGAAAGG + Intergenic
1138638324 16:58362016-58362038 AGGGAACCCACTGTCTTGAAGGG - Intronic
1138806851 16:60100341-60100363 AGGGAATCTATTGCCATGAAGGG - Intergenic
1139103847 16:63802193-63802215 AGGGAACACACTGCTTTGAAGGG - Intergenic
1139122948 16:64042800-64042822 AGGGAACCTACTGCCTTGAAGGG + Intergenic
1140152585 16:72385460-72385482 AGGGAGACTATTGCCTGAAAAGG - Intergenic
1141015009 16:80440980-80441002 AGGGAAAATAGTGACTTGACTGG + Intergenic
1141037429 16:80640334-80640356 AGGGAACCTGCTGCCTTCAAGGG + Intronic
1141077263 16:81018639-81018661 TGGGCCTCTACTGCCTTGAATGG - Intronic
1141864555 16:86741187-86741209 AGGGTAAGTTCTGCCTTGTAGGG + Intergenic
1142919226 17:3169879-3169901 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143413668 17:6728984-6729006 AGAGAACCCACTGCCTCGAAGGG + Intergenic
1143804611 17:9416032-9416054 AGGGAAATGACTGCCTGGAGTGG - Intronic
1146615119 17:34350406-34350428 AAGGAATCCACTACCTTGAAGGG + Intergenic
1146749892 17:35368899-35368921 AGAGAAACTGCTGCCTTAAAGGG + Intronic
1148917898 17:50998812-50998834 AGAGAAACTATTGCTTAGAATGG + Intronic
1149075646 17:52594416-52594438 AGGGAACCCAGTGCCCTGAAGGG - Intergenic
1149092844 17:52804644-52804666 AGGGAACCTGCTGCACTGAATGG - Intergenic
1149153193 17:53594372-53594394 AGGGAACCCATTGCCTTGAAGGG - Intergenic
1149180618 17:53932079-53932101 GGGGAGCCTACTGCCCTGAAGGG - Intergenic
1149231258 17:54536964-54536986 AGAGAACCCACTGCCTTGAAGGG + Intergenic
1149234922 17:54578427-54578449 AGGGAGCCCACTGCCTTGAAGGG + Intergenic
1149234975 17:54578737-54578759 GGGGAACCTGCTGCCATGAAGGG + Intergenic
1149249262 17:54749467-54749489 AAGGAACCTGCTGCCTTGAAGGG - Intergenic
1149553570 17:57557546-57557568 AGGGAGAACCCTGCCTTGAAGGG + Intronic
1150192617 17:63259067-63259089 AGGGAACCTGCTACCTTGAAAGG - Intronic
1153075346 18:1156242-1156264 AAGGAACCTGCCGCCTTGAAGGG - Intergenic
1153088694 18:1318876-1318898 AGGGAAGTCACTGCCCTGAAGGG + Intergenic
1153129211 18:1835061-1835083 AGAGAACCCACTGCCTTGCAAGG + Intergenic
1153356636 18:4143860-4143882 AAGGAACCCACTGCCTTGAAGGG - Intronic
1153363281 18:4224092-4224114 AGGGAACCTGTTGCCTTGAGTGG + Intronic
1153389236 18:4535131-4535153 AGGGGACCTGATGCCTTGAAGGG - Intergenic
1153429428 18:4999685-4999707 AAGGGAACTGCTTCCTTGAAGGG + Intergenic
1154386550 18:13897777-13897799 AGGGAACTTGCTGCCTTGAAGGG + Intronic
1155531133 18:26767815-26767837 AGAGATACTACTAACTTGAAAGG + Intergenic
1155533761 18:26794736-26794758 AAGGAACCTGCTTCCTTGAAGGG + Intergenic
1156021587 18:32605976-32605998 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1156912353 18:42425894-42425916 GGGGATCCTACTGCCCTGAAAGG - Intergenic
1156912412 18:42426287-42426309 AGAGAACCCGCTGCCTTGAAGGG - Intergenic
1157022674 18:43805534-43805556 AGGGAACCCACTACCTTGAAGGG - Intergenic
1157862756 18:51155862-51155884 AGGGAAACAATTCCTTTGAAAGG - Intergenic
1157879282 18:51304716-51304738 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1158116832 18:54005265-54005287 ATGGAACCTGCTACCTTGAAGGG + Intergenic
1158431246 18:57389479-57389501 AGGAAATCCGCTGCCTTGAAGGG + Intergenic
1158468466 18:57712895-57712917 AGGGAGCCTGCTGCCTTGCAGGG + Intronic
1158481322 18:57824165-57824187 AGGGAATCCGCTGCCTTGAAGGG - Intergenic
1158768499 18:60485641-60485663 AGTGGAACTACTGGGTTGAATGG - Intergenic
1158926374 18:62267175-62267197 AGAGAAACTACAGACTTGAATGG + Intronic
1159080599 18:63731338-63731360 AGGAAACCTGCTACCTTGAAGGG + Intergenic
1159284957 18:66336922-66336944 AGGGAACCCATTGCCTTGAAGGG - Intergenic
1159564930 18:70037517-70037539 AGGGAACCCACTGCCTTGAAGGG + Intronic
1159637944 18:70828146-70828168 TGTGAAACAACTGCCTTGAAGGG + Intergenic
1159896520 18:74001876-74001898 AAGGAACCTGCTGCCTTGAAGGG - Intergenic
1160138436 18:76296038-76296060 AGAGAACCCACTGCCTTGAAGGG - Intergenic
1161315397 19:3615073-3615095 AGGGAAACTAAGGCCCAGAAAGG - Intronic
1162666802 19:12220420-12220442 AGGGAACCTACCGCCTTGAAGGG - Intergenic
1163185465 19:15636028-15636050 AGGAAACATGCTGCCTTGAAGGG - Intronic
1164408532 19:27976773-27976795 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1164793601 19:31008378-31008400 AGGGAACTTACTGCCTAGATGGG + Intergenic
1165645374 19:37431446-37431468 AGGGAACCTGTTGCCTTGAGAGG + Intronic
1166734952 19:45078761-45078783 GGGGAAACTGAGGCCTTGAATGG - Intergenic
1166757576 19:45202890-45202912 AGGGAAGCCGCTGCCTTGAAAGG - Intronic
1168122512 19:54259889-54259911 AGGGAAATTGCTGCCTTGTGGGG - Intronic
1168615464 19:57833775-57833797 ACAGAACCTGCTGCCTTGAAGGG - Intronic
1168621321 19:57881672-57881694 ACAGAACCTGCTGCCTTGAAGGG + Intronic
925249710 2:2421908-2421930 AGGAAACCAATTGCCTTGAAAGG - Intergenic
925588511 2:5487211-5487233 AGAGAACCTGGTGCCTTGAAGGG + Intergenic
925698974 2:6613805-6613827 AGGGAATCTGCTACCTGGAAAGG - Intergenic
926478325 2:13356658-13356680 AGGGAGCCTTCTGCCTTGAAGGG + Intergenic
926518852 2:13884074-13884096 AGAGAAACTACTGCCCTGAAGGG + Intergenic
926600883 2:14844308-14844330 AGGGAACTCACTGCCTTGAAGGG + Intergenic
926792015 2:16583558-16583580 ACTGAAACTACTTCATTGAAAGG + Intronic
926834184 2:16999275-16999297 AGCAAACCTGCTGCCTTGAAGGG - Intergenic
927424990 2:22971390-22971412 AGGGAACCCGCTGCCTTGAAGGG + Intergenic
927570307 2:24153434-24153456 AGGGAATCTGCTGCCTTGAAGGG - Intronic
928142804 2:28745201-28745223 AGGGAAACTACTTACTTCACAGG + Intergenic
928293531 2:30061172-30061194 AGGGAATCCACTGCCTTGAAGGG + Intergenic
928293629 2:30061696-30061718 GGGGAAATCACTGCCTTGAAGGG + Intergenic
928472177 2:31585558-31585580 AGGGAACCCACTGCTTTGAAGGG + Intergenic
928864002 2:35895762-35895784 AGGGGATCCTCTGCCTTGAAGGG - Intergenic
928932301 2:36637050-36637072 AGAGAACCTGCTACCTTGAAAGG + Intronic
929099964 2:38302090-38302112 AGGGAACCCACTGTCTTGAGGGG + Intronic
929215101 2:39403982-39404004 AAGGAACCAGCTGCCTTGAAGGG + Intronic
929388630 2:41442245-41442267 GGAGAAACCACTGCCCTGAAGGG - Intergenic
929430471 2:41882071-41882093 AGGGAAACTCATGCCTGGAATGG + Intergenic
930499692 2:52197603-52197625 AGCGAAACTGCTGACTTGTATGG - Intergenic
930527022 2:52542890-52542912 ATGGAACCTACTGCCTTGAAAGG + Intergenic
930778235 2:55196595-55196617 AGGGAAGCCACTGTCTTGAAAGG + Intronic
930947500 2:57092837-57092859 GGGGAACCTGCTGCTTTGAAGGG - Intergenic
931161972 2:59702593-59702615 AGGGAACCCACAACCTTGAAGGG - Intergenic
931572233 2:63680946-63680968 AGGGAACCTGCTGCCTTGAAAGG + Intronic
931600887 2:64001609-64001631 AGGGAACCTGTTGCCTTGAAGGG - Intronic
931668154 2:64624844-64624866 AGGGAAACTAAGGCCCTGAAAGG - Intergenic
933002706 2:76946098-76946120 AGGGAAAATACTGACTTTTAAGG - Intronic
933162840 2:79044931-79044953 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
933227461 2:79767676-79767698 AGGAAACTTGCTGCCTTGAAGGG - Intronic
933348937 2:81128002-81128024 AGGGAGCCTACAGCCCTGAAGGG - Intergenic
933348985 2:81128317-81128339 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
935078592 2:99770369-99770391 GGGGAGTCTACTGCCCTGAAGGG - Intronic
935576605 2:104717654-104717676 AAAGATCCTACTGCCTTGAAGGG - Intergenic
935750928 2:106233115-106233137 AGGAAACCTACTTCCTTGAAGGG + Intergenic
935928266 2:108093761-108093783 AGAGATCCTGCTGCCTTGAAGGG - Intergenic
935989395 2:108705644-108705666 AGGGAACCCACTGCCTTGAAGGG + Intergenic
936511319 2:113149841-113149863 AGAGAAATCACTGCCTTGAAGGG - Intergenic
936901368 2:117485223-117485245 AGGGAATCTGCTGCCTTGAAGGG - Intergenic
936925314 2:117730854-117730876 AGGGAACCTGCTGTCTTGAAGGG + Intergenic
937512481 2:122611659-122611681 AGGGAAACTGCTACCTTAAAGGG + Intergenic
937590955 2:123612739-123612761 AGAGAACCCACTGCCTTGAAGGG + Intergenic
937591195 2:123615050-123615072 AGAGAACCCATTGCCTTGAAGGG + Intergenic
937613595 2:123893373-123893395 AAGGAACCCACTGCCTTGAAGGG - Intergenic
937739455 2:125333189-125333211 AGGGAAACCACTGACTTGAAGGG + Intergenic
938216961 2:129526276-129526298 AGGGAACCCACTGCCTTGAAGGG + Intergenic
939144499 2:138396258-138396280 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
939244841 2:139610088-139610110 AGGAAAACTACTACCTTGAAGGG - Intergenic
939273564 2:139970885-139970907 AGGCAACCTGCTACCTTGAAGGG + Intergenic
939443231 2:142276143-142276165 AAGGAACTCACTGCCTTGAAGGG - Intergenic
939483482 2:142778946-142778968 AGAGAACTTGCTGCCTTGAACGG - Intergenic
939570574 2:143835906-143835928 AGGAAAACAACTGCCTTGGAAGG - Intergenic
939707946 2:145478624-145478646 AGAGAACCCACTGCCTTAAAGGG - Intergenic
939930798 2:148230790-148230812 AGGCAACCTGCTGCCTTGAACGG - Intronic
940315199 2:152320746-152320768 AAGGAACCTACTGCCTTGAAGGG - Intergenic
940443973 2:153754428-153754450 AGGGAACCCAGTGTCTTGAAGGG - Intergenic
940503825 2:154527662-154527684 AGGGAAACCACTGCCTAGAAGGG - Intergenic
940546887 2:155100307-155100329 AGGGAACCTGCTTCCTTGAAGGG + Intergenic
940947705 2:159636948-159636970 AGGGAATCCACTACCTTCAAGGG + Intergenic
941357470 2:164511511-164511533 AGGGAACCCACTGCCTTGAAGGG + Intronic
941745996 2:169087731-169087753 AGGAAACCCACTGCCTTGAAGGG - Intronic
941851842 2:170191084-170191106 AGGAAACCTGCTGCCTTAAAGGG - Intronic
942001503 2:171652703-171652725 AGGGAACCTCCTGCCTTTAAGGG - Intergenic
942294890 2:174507708-174507730 AAGGAACCTACTGCCTAGAAAGG + Intergenic
942389258 2:175475353-175475375 AGTGCAATTACTTCCTTGAATGG + Intergenic
942617715 2:177811636-177811658 AGGGAAAGGACTGCCTTGCATGG + Intronic
942734749 2:179097041-179097063 AAGGGAACCACTGCCTTGAAGGG - Intergenic
942881877 2:180871222-180871244 ACAGAACCCACTGCCTTGAAGGG + Intergenic
942975779 2:182015652-182015674 AAGGAACCCACTGCCTTGAAGGG - Intronic
943067655 2:183105684-183105706 AGGAAACCAACTTCCTTGAAAGG - Intergenic
943099556 2:183471667-183471689 AGGAAACCCACTGCCTTAAAGGG - Intergenic
943208235 2:184928221-184928243 AGGAAACTTACTGTCTTGAAGGG - Intronic
943226805 2:185188271-185188293 AGGGAACATGCTGTCTTGAAGGG - Intergenic
943484736 2:188465252-188465274 AAGGAACCTACTGCCTTGAAGGG - Intronic
943831733 2:192472447-192472469 TAGGAAACCACTGCCTTGAACGG + Intergenic
943845078 2:192635034-192635056 AGGGAAACCTGTGTCTTGAAGGG + Intergenic
944046136 2:195413969-195413991 AGGGAACCTGCTGCATTGAAGGG + Intergenic
944133290 2:196370264-196370286 AGGGAACTCACTTCCTTGAAGGG - Intronic
944138510 2:196428791-196428813 AGGGTAACAACTGCTTTTAAAGG - Intronic
944550368 2:200839636-200839658 AGGGAACCTATTGCCTTGAAAGG + Intergenic
944616444 2:201465338-201465360 AGGGAAACTGCTCCCATGAAGGG - Intronic
944751969 2:202718169-202718191 GGGGAAACCACTGCCCTGAAGGG - Intronic
944955044 2:204798790-204798812 AGGGAACCCGATGCCTTGAAGGG + Intronic
944963288 2:204901177-204901199 GGGGAAATCACTGCCCTGAAGGG - Intronic
945210206 2:207374994-207375016 AGGGAAACTGCTGCCTTGAAGGG + Intergenic
945713672 2:213331288-213331310 AGGGACCCCACTGCCTTGAAGGG + Intronic
945754486 2:213829744-213829766 AGGGAACCTGCTGCCTTGAAGGG - Intronic
945771245 2:214045295-214045317 AGGGAACCTGTTGCCCTGAAGGG + Intronic
945897762 2:215503879-215503901 GGGGAAACACCTTCCTTGAAAGG + Intergenic
946042123 2:216791630-216791652 AGGGAAACTGAGGCCTAGAAAGG + Intergenic
946509113 2:220335184-220335206 AGGGAACCCATTGCCTTGAAGGG - Intergenic
946697293 2:222372464-222372486 AGGGAACCCACTGATTTGAAGGG + Intergenic
946771133 2:223090065-223090087 ATGGAAAATATTGCCTTGAGGGG + Intronic
946918148 2:224548136-224548158 GGGGAAATTGCAGCCTTGAAGGG - Intronic
946984672 2:225258142-225258164 AGGGAACCAGCTGCCTTGAGGGG + Intergenic
947009106 2:225546573-225546595 AGGGAGCCCACTGCCCTGAAGGG - Intronic
947312377 2:228818423-228818445 AGGGAAACCACTGCCTTGAAGGG - Intergenic
947505305 2:230704024-230704046 GGGGAGTCTACTGCCCTGAAAGG - Intergenic
947603173 2:231467266-231467288 AGGGATACCACTGCCTTGAGTGG + Intronic
947687157 2:232097994-232098016 AGAGAACCTGTTGCCTTGAAGGG - Intronic
947893051 2:233643436-233643458 GGGGAGCCCACTGCCTTGAAGGG - Intronic
948249393 2:236513425-236513447 GGAGAAGCTACTTCCTTGAAGGG + Intergenic
948475527 2:238216569-238216591 AGGGAACTCACTGCCTTGAAGGG - Intergenic
948774637 2:240277621-240277643 AGGGAACCCGCTACCTTGAAGGG + Intergenic
1168742100 20:200635-200657 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1168951059 20:1802672-1802694 GGCGAACCTACTGCCTGGAATGG - Intergenic
1169582732 20:7042814-7042836 ATGGATACTACTGTCTTGAATGG - Intergenic
1169587001 20:7096488-7096510 AAGAAACCTGCTGCCTTGAAAGG + Intergenic
1169622234 20:7520271-7520293 AGGGACATTACAGCCTTGAGTGG + Intergenic
1169623939 20:7541031-7541053 AGGGAACCTGCTGCAATGAAGGG + Intergenic
1169628592 20:7600147-7600169 AGGGAATCTGCTGCCTTGAAGGG + Intergenic
1169903393 20:10575438-10575460 AAGGAAAGTACAGCCTTGTAGGG - Intronic
1169988698 20:11474785-11474807 AAGGAACCCCCTGCCTTGAATGG + Intergenic
1170311501 20:14997311-14997333 AGGGAACCCACTGCCTTGAAGGG + Intronic
1170668351 20:18406453-18406475 AGGGAACTCACTGTCTTGAAGGG + Intronic
1171942872 20:31348474-31348496 AGAGAATCCACTGCCTTAAAGGG + Intergenic
1172203618 20:33146101-33146123 AGGGAACTTACTACTTTGAAGGG - Intergenic
1172418908 20:34797375-34797397 AGGGAACCCACTGCCTTGAAAGG + Intronic
1173004200 20:39127155-39127177 TGGGAACCCACTGCCTTGAAGGG - Intergenic
1173098896 20:40065260-40065282 AGGCAACCCACTACCTTGAAAGG + Intergenic
1173204249 20:40980190-40980212 AGGGAGCCTACTGCTTTGAAGGG - Intergenic
1173468767 20:43305972-43305994 AGGGAAAGTTCTGCCTTGCTGGG - Intergenic
1174938509 20:54898261-54898283 AGGGAACCTGTTGTCTTGAAGGG + Intergenic
1176939967 21:14912087-14912109 AGGGAACCCATTGCCTTGACAGG - Intergenic
1176994982 21:15544505-15544527 AGGGAATCTACTGCCTTGCAGGG + Intergenic
1177023775 21:15896184-15896206 AGGGAGTCTGTTGCCTTGAAGGG + Intergenic
1177105151 21:16946043-16946065 AGGTAAACCACTGCCTTGAAGGG + Intergenic
1177137299 21:17318809-17318831 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1177222259 21:18209767-18209789 AGGGAACCTACTGCCTTGAAGGG - Intronic
1177275995 21:18913632-18913654 AGGGAAACCACTGCCTTGAAGGG - Intergenic
1177539818 21:22477676-22477698 GGGGAAATGACTGCCTTGAGGGG + Intergenic
1177577976 21:22983017-22983039 AGGGCACCCACTGCCCTGAAGGG + Intergenic
1177740650 21:25148924-25148946 AGGGAACCTGCTGACTTGAAGGG - Intergenic
1177761497 21:25407106-25407128 AGGGAAGCTGCTGCCTTGAAAGG - Intergenic
1178880003 21:36441918-36441940 AGGGAAACAGGTGCCATGAAGGG - Intergenic
1179002060 21:37470544-37470566 AGGGAATCTAAGGCTTTGAATGG + Intronic
1179652472 21:42820605-42820627 CAGAAACCTACTGCCTTGAAGGG + Intergenic
1181763802 22:25076919-25076941 AGGGAAACTGAGGCCTTGAAAGG + Intronic
1182014694 22:27029998-27030020 AGTGAAACAACTGCCCTGGATGG - Intergenic
1182578051 22:31286934-31286956 AGGGAAAGTATTGACTTGAGAGG - Intronic
1183354662 22:37351676-37351698 AGGTAAACTGAGGCCTTGAAAGG - Intergenic
1183497296 22:38154168-38154190 GGGGAACTTGCTGCCTTGAAGGG + Intronic
949155851 3:826787-826809 AGGGAACCCACTGCCATGAAAGG + Intergenic
949235731 3:1806316-1806338 AGAGAACCTGCTGCCTTGAAGGG - Intergenic
949829292 3:8197064-8197086 AGATAACCTGCTGCCTTGAAGGG - Intergenic
950429773 3:12944084-12944106 AGGGAAACTGGGACCTTGAAGGG - Intronic
950695676 3:14699495-14699517 AGGGAACCCACTGCCTTGAAGGG - Intronic
950927807 3:16760131-16760153 AGGCTATCCACTGCCTTGAATGG - Intergenic
951029322 3:17863567-17863589 AGGGAACCTGCTGCTTTGAAGGG - Intronic
951172173 3:19554971-19554993 ACAGAACCCACTGCCTTGAAGGG - Intergenic
951177827 3:19622685-19622707 AGTGAACCCACTGCCTTGAAGGG - Intergenic
951181891 3:19668786-19668808 AAGCAACCTGCTGCCTTGAAGGG + Intergenic
951437017 3:22676637-22676659 AGGGAACCCACAGCCTTGAAGGG - Intergenic
952066466 3:29577147-29577169 AGGCAACCTGCTGCATTGAAGGG - Intronic
952132837 3:30384654-30384676 AGGGAACCTTCTGCCTTGAAGGG - Intergenic
952566639 3:34667086-34667108 AGGGAAGCTGCTGCCTTGAAAGG - Intergenic
952639755 3:35579489-35579511 AGGGAACCCACTGCCTTGGAAGG + Intergenic
952672997 3:35993741-35993763 AGGGAACCTACTGCCTTGAAGGG + Intergenic
952811858 3:37411400-37411422 GGGGAGACCACTGCCCTGAAGGG - Intronic
952811921 3:37411761-37411783 AGGAAACCCACTGCCTTGAAGGG - Intronic
954488076 3:50873278-50873300 AGGGAACCTGCTGCCTTGAAGGG - Intronic
955274407 3:57533592-57533614 AGGGAACCTGCTGCCTTGAAGGG - Intronic
955488110 3:59455252-59455274 AGGGAAACTGCTGCATAAAAGGG - Intergenic
955585162 3:60470289-60470311 AGAGAACTTACTGCCCTGAAGGG - Intronic
955759071 3:62258822-62258844 TGGGAAACTACTCCCTGGGAAGG - Intronic
956549466 3:70441921-70441943 AGGATACCTGCTGCCTTGAAGGG + Intergenic
957434394 3:80154837-80154859 AGAAAACCCACTGCCTTGAAGGG - Intergenic
957537928 3:81530898-81530920 AGGGAACATACTGCCCTAAAGGG - Intronic
957537984 3:81531211-81531233 AGAGAACCCACTGCCCTGAAAGG - Intronic
957810496 3:85215202-85215224 AGAGAGCCCACTGCCTTGAAGGG - Intronic
957900352 3:86481349-86481371 AGGGAACCTGCTGCATTGAAAGG - Intergenic
957976148 3:87447649-87447671 AGGGATCCCACTGCCCTGAAGGG - Intergenic
958083382 3:88775040-88775062 AGGGAAACTGCTGTCCTGAAAGG + Intergenic
958141160 3:89564345-89564367 AGGGAGCCCACTGCCCTGAAGGG + Intergenic
958173842 3:89970309-89970331 GGGGAAACAGCTGCCTTGTATGG + Intergenic
958682792 3:97353049-97353071 AGGAATCCCACTGCCTTGAAGGG + Intronic
958757872 3:98271873-98271895 AGAGAATCCACTGCCATGAAAGG - Intergenic
958760140 3:98296793-98296815 AAGGAACCTGCTGCCTTGAAGGG + Intergenic
958765353 3:98360943-98360965 AGGGAATCCACTACCTTTAAAGG - Intergenic
958839953 3:99191655-99191677 AGGGGACCCACTGCCTTGAAGGG + Intergenic
958876650 3:99624574-99624596 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
959127489 3:102307823-102307845 AGGGAACCGATTGCCTTGAAGGG + Intronic
959189845 3:103097358-103097380 GGGGAACCCACTGCCCTGAAGGG - Intergenic
959273332 3:104242363-104242385 AGGGTATCTACTGCCTTGGCAGG - Intergenic
959285031 3:104397748-104397770 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
959409086 3:105997882-105997904 AGGGAACCCATTGCCTTGAAGGG - Intergenic
959413993 3:106061701-106061723 AGGGCACCCACTACCTTGAAGGG + Intergenic
959474323 3:106790740-106790762 AGGGAACCTGCTACCTTGAAGGG + Intergenic
960153557 3:114275237-114275259 AGAGAACCAGCTGCCTTGAAGGG - Intergenic
960353984 3:116628693-116628715 AGGGAATCTACTGCCCTGAAGGG - Intronic
960490721 3:118313947-118313969 AGGGAACCTATTGCCTTGAAGGG + Intergenic
960541371 3:118865784-118865806 AGGGAACCCACTGTCTTGAAAGG - Intergenic
960657866 3:120025894-120025916 AGGGAAACTAAGGCCTAAAAAGG - Intronic
960869983 3:122238831-122238853 AGGGAACTCACTGCCTTGAAAGG + Intronic
961610438 3:128133000-128133022 GGGGAGCCTACTGCCCTGAAGGG + Intronic
961952269 3:130762375-130762397 AGGGAACCCACTGCCTTGAAGGG + Intergenic
961964460 3:130888074-130888096 AGGTAAACCGCTGCCTCGAAGGG - Intronic
962015128 3:131431497-131431519 AGGGAACCCACTGCCTTGAAGGG + Intergenic
962038805 3:131683366-131683388 AGGAAGCCTACTGCCTTGAAGGG - Intronic
962078700 3:132114409-132114431 GGGGAGACTACTACCCTGAAGGG - Intronic
962465546 3:135654825-135654847 GGGGAGTCTACTGCCCTGAAGGG + Intergenic
962638780 3:137361375-137361397 AGGGAACCCACTTCCCTGAAGGG - Intergenic
962638831 3:137361732-137361754 AAGGAACCTGCTGCCCTGAAAGG - Intergenic
962688394 3:137869051-137869073 AGGGAGCCCACTGCCCTGAAGGG + Intergenic
962759154 3:138492922-138492944 AGGGAAGCCACTGCCTTGAAGGG - Intergenic
962862656 3:139419004-139419026 AAGGAATCTGCTGCCTTGAAGGG - Intergenic
962870826 3:139491575-139491597 AGGGAACCCACTGCCCTGAAGGG - Intergenic
962998435 3:140653506-140653528 AGGGAAACTTATGTCTTGAAGGG + Intergenic
963020502 3:140868905-140868927 ATGGAACCTACTGTCTTAAAGGG - Intergenic
963154096 3:142077581-142077603 AGGGAACCTACTGCCTTGAAGGG + Intronic
963179402 3:142338361-142338383 AGGGAACCTACAGTCCTGAAGGG + Intronic
963310058 3:143700090-143700112 AGGGAACCCACTGCCTTAAAGGG + Intronic
963330512 3:143910037-143910059 AGGGAACCTGCTGTTTTGAAGGG + Intergenic
963676219 3:148315137-148315159 AGAGAACCCACTGACTTGAAGGG + Intergenic
963802307 3:149688198-149688220 AGGGAACCCACTGCCCTGAAGGG + Intronic
963995937 3:151708912-151708934 AGGGAACCCACTGCCTTGAAGGG + Intergenic
964140746 3:153396542-153396564 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
964179368 3:153865270-153865292 AGAGACCCCACTGCCTTGAAGGG + Intergenic
964244265 3:154632978-154633000 AAGGAAGCCACTACCTTGAAGGG - Intergenic
964339007 3:155688653-155688675 AGGGAGTCCACTGCCTTGAAGGG + Intronic
964582927 3:158260302-158260324 AGAGAATGTGCTGCCTTGAAGGG - Intronic
964871664 3:161319557-161319579 AGGGAATCCACTGCCTTGAAGGG + Intergenic
964871771 3:161320230-161320252 CGGGAACTTACTGCCCTGAAGGG + Intergenic
964999901 3:162940303-162940325 AGGGAGTCTGCTGCCCTGAATGG + Intergenic
965014596 3:163140565-163140587 AGGGAATCCATTGCCTTGAAGGG - Intergenic
965047530 3:163598185-163598207 AGGGAACCTATTGCCTAGCAGGG + Intergenic
965059978 3:163773068-163773090 GGGGAGCCTACTGCCCTGAAGGG - Intergenic
965060031 3:163773426-163773448 AGGAAACCTACTTCCTTGAAGGG - Intergenic
965181076 3:165404434-165404456 AGGAAAACTACTGCCCTGAAAGG + Intergenic
965209629 3:165768276-165768298 AGAGAACCTGCTGCCTTGAAGGG - Intergenic
965231629 3:166061202-166061224 AGGGAACCTGCTGCCCTAAAGGG + Intergenic
965322301 3:167265323-167265345 AGTGAATCTGCTGCCTTGAAGGG - Intronic
965349892 3:167599162-167599184 AGGGAACTAACTGCCCTGAAGGG - Intronic
965415213 3:168384573-168384595 AGGGAACCCACTGCCTTGAAGGG - Intergenic
965742416 3:171889948-171889970 AGGGAACTCACCGCCTTGAAGGG - Intronic
965818345 3:172659725-172659747 AGGGAAACTAAGGCCCAGAAAGG + Intronic
965844483 3:172946111-172946133 AGGGAACCTGCTGCCTTGAAGGG + Intronic
966151074 3:176868402-176868424 TGGGAAACAGCTGCCTTGAAGGG + Intergenic
966151642 3:176873386-176873408 AGAAAACCTGCTGCCTTGAAGGG + Intergenic
966328997 3:178790163-178790185 AGGGAACCTACTGCCTTGAAGGG + Intronic
966400902 3:179546220-179546242 AGGGAACCCACAGTCTTGAAGGG + Intergenic
966650504 3:182295453-182295475 ATGGAAACTGAGGCCTTGAAAGG - Intergenic
967608919 3:191481611-191481633 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
967677448 3:192316995-192317017 AAGGAACCCAATGCCTTGAAGGG + Intronic
967677562 3:192317652-192317674 AGGGAACTCGCTGCCTTGAAGGG + Intronic
967696994 3:192543754-192543776 AGGGAATCCACTGCCTTGAAGGG - Intronic
968005031 3:195236838-195236860 AGGGAGCCTACTGCCCTGAAGGG - Intronic
968018048 3:195357085-195357107 AGGGAACTCACTGCCCTGAAGGG + Intronic
968334390 3:197900845-197900867 AGGGAACCCACTGCCTTGTAGGG + Intronic
968666555 4:1825500-1825522 AGGGAAACATCAGCCTCGAAAGG - Intronic
970098001 4:12486921-12486943 AAGGAACCCACTTCCTTGAAGGG - Intergenic
970338129 4:15074401-15074423 AGGGAAAATAATGTCTAGAAAGG + Intergenic
970441836 4:16086643-16086665 AGGGAAACTGCTGCCTTGAAGGG + Intergenic
970442437 4:16093358-16093380 AGGGAACATGCTGCCTTGAGGGG + Intergenic
970892827 4:21067155-21067177 AGATAACCTGCTGCCTTGAAGGG + Intronic
970963322 4:21898542-21898564 AGGGAACCCACTGCCTTGAATGG + Intronic
971567854 4:28168269-28168291 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
972207764 4:36798596-36798618 AAGCAACCTGCTGCCTTGAAGGG + Intergenic
972271111 4:37511443-37511465 AAGGAACCTACTACCTTGAAGGG - Intronic
972468810 4:39384317-39384339 AGAGAACCCACTGCCTTGAGGGG - Intergenic
972579161 4:40379721-40379743 AGGGAACCCACTACCTTGAATGG + Intergenic
972712622 4:41612896-41612918 AGGGAAATTCCTGCTCTGAAAGG - Intronic
972904459 4:43728119-43728141 AGGAAACCCACTGCCTTGAAAGG + Intergenic
973169392 4:47120718-47120740 AGGGAACCTGCTGCCTTGAGAGG - Intronic
973180299 4:47259035-47259057 AAGTAAACTGCAGCCTTGAATGG + Intronic
974285678 4:59864445-59864467 AGGGAACTCACTGCCCTGAAGGG - Intergenic
974298901 4:60040131-60040153 GGGGAAATTTCTGCCCTGAAGGG - Intergenic
974299006 4:60040795-60040817 AGGTTACCTACTGCCTTGAAGGG - Intergenic
974301004 4:60067262-60067284 AGGAAACCCACTTCCTTGAATGG + Intergenic
974867979 4:67603621-67603643 AGGGAATCTACTGCTTTGAAGGG - Intronic
975035043 4:69669357-69669379 AAGGAACCTGTTGCCTTGAAGGG + Intergenic
975295285 4:72727118-72727140 AGGGAACCCACTTCCCTGAAGGG + Intergenic
975369525 4:73568482-73568504 AGTGAACCCACTGCCTAGAAGGG - Intergenic
975592817 4:76017316-76017338 AGGGAACCTGCTGCCTTGAAGGG - Intronic
975629654 4:76387330-76387352 AGGGAACCCATTGCCTTGAAGGG + Intronic
975629802 4:76388348-76388370 AGGGAACCTAGTGCCCTAAAGGG + Intronic
976041119 4:80885963-80885985 GGGGAGCCCACTGCCTTGAAGGG + Intronic
976082858 4:81375525-81375547 ACAGAACCTGCTGCCTTGAAAGG - Intergenic
976444076 4:85110312-85110334 AGTGAACCTGCTGCCTTGAAGGG + Intergenic
976453897 4:85223493-85223515 AGGGAACCCACTGTCTTGAAGGG - Intergenic
976722027 4:88178316-88178338 AGGGAAATTGCTGCCTTGAAGGG + Intronic
976728530 4:88240129-88240151 AGGGAATCCACTGCCTTGAAAGG - Intergenic
976943781 4:90739209-90739231 AGGGAACCCACTGCCCTAAAGGG - Intronic
976982142 4:91244332-91244354 GGGGAACTTACTACCTTGAAGGG + Intronic
977307431 4:95342415-95342437 AGCAAAACTACTACCTTGAAGGG + Intronic
977397094 4:96484516-96484538 AGGGAGCCCACTGTCTTGAAAGG - Intergenic
978008686 4:103651832-103651854 AGGGAACCCACTGCCTTGAAGGG - Intronic
978116096 4:105022151-105022173 GGGGAGCCCACTGCCTTGAAGGG + Intergenic
978116506 4:105025407-105025429 AGGGAGACCACTGCCCTGAAGGG + Intergenic
978212689 4:106157087-106157109 AGGGAACCTGCTGCCTTGAAGGG - Intronic
978258259 4:106718713-106718735 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
978258322 4:106719072-106719094 GGGGAGCCTACTGCCCTGAAGGG + Intergenic
978261702 4:106768057-106768079 AGGGATCCCACTGCCTTGAAGGG + Intergenic
978287782 4:107098882-107098904 AGAGAACCCACTGCCTTGGATGG + Intronic
978922453 4:114200874-114200896 AGGGAACCTACTGCCTTGGAGGG - Intergenic
978934641 4:114359731-114359753 AGGGAACCTACTGACTTGAAGGG - Intergenic
979184610 4:117772620-117772642 AGGGAACCGGCTGCCTTGAAGGG + Intergenic
979504482 4:121479997-121480019 AAGGAAACAGCTACCTTGAAGGG - Intergenic
979851318 4:125574008-125574030 ATGGAACCTGCTGCCTTGAAGGG - Intergenic
980531417 4:134060602-134060624 AGGGAACTTGCTGTCTTGAAGGG + Intergenic
980596906 4:134966478-134966500 AGGGAACCTGGTGTCTTGAAGGG + Intergenic
980646662 4:135651883-135651905 AGGAAACCCACTGCCTTGAAAGG + Intergenic
980682875 4:136187093-136187115 AGGGATAAAACTGCCTGGAAGGG + Intergenic
980693083 4:136320864-136320886 AGGGAATTTGCTGCCCTGAAGGG + Intergenic
981140208 4:141259241-141259263 AGGGAAGTTGCTACCTTGAAGGG + Intergenic
981298154 4:143156512-143156534 AGGAAACCCATTGCCTTGAAAGG - Intergenic
981558643 4:146023293-146023315 AGAGAACCTGCTGCCTTGAAGGG - Intergenic
981836823 4:149064548-149064570 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
981871116 4:149487172-149487194 AGGGAATCTGCTGCCTTGAAGGG - Intergenic
981895727 4:149796479-149796501 GGGGAACCTGCTGCCCTGAAGGG + Intergenic
981996131 4:150977402-150977424 AGGGAACCCGCTGCCTTGAAGGG + Intronic
982339877 4:154285491-154285513 GGGGAGCCTACTGCCTTGAAGGG + Intronic
982719719 4:158847498-158847520 AAGGAACCCGCTGCCTTGAAGGG + Intronic
982899554 4:160981037-160981059 AGAGATCCTGCTGCCTTGAAGGG - Intergenic
982911535 4:161148622-161148644 AAGGAAGCCACTGCCTTGAAGGG + Intergenic
982932663 4:161428626-161428648 AGGGAAACCACTGCTTTAAATGG + Intronic
983165938 4:164477449-164477471 AGGGAGCCCACTGCCATGAAGGG - Intergenic
983165997 4:164477807-164477829 AAAGAACCTGCTGCCTTGAAGGG - Intergenic
983994303 4:174162600-174162622 ATGGAAACTTCTTCCTTCAATGG - Intergenic
985384767 4:189434101-189434123 AGGGAACCCACTACTTTGAAGGG - Intergenic
985529797 5:427172-427194 AGGGGTACTCCTGCCTTGTATGG - Intronic
986085127 5:4437381-4437403 AGGGAACCTACTACCCTGAAAGG - Intergenic
986155825 5:5175248-5175270 AGGGAACCAGCTGCATTGAAGGG - Intronic
986512458 5:8522772-8522794 AGGGAAACTACTGCATTTGCTGG - Intergenic
986548319 5:8924172-8924194 AGGTAACCCACTGCCTTGAAGGG + Intergenic
986631197 5:9775680-9775702 AGGGAACCCACTGCCTTGAAGGG - Intergenic
987163947 5:15174207-15174229 AGGGAACCCATGGCCTTGAAGGG + Intergenic
987496555 5:18652700-18652722 AGAGAACTTACTGCCCTGAAGGG - Intergenic
987564258 5:19564470-19564492 AGGGAACCTGCTGCCTTGAAGGG + Intronic
987645849 5:20671790-20671812 ATGGAATCCACTGGCTTGAAAGG + Intergenic
987772936 5:22330259-22330281 AGGGACCCCACTACCTTGAAAGG + Intronic
987823078 5:22991265-22991287 AGGAAACCCACTGCCTTGAAGGG + Intergenic
987966472 5:24882694-24882716 AGGAAAACTACTGCCTCCATTGG - Intergenic
988001712 5:25358291-25358313 AGGGAACCTGCTGCTTTGAAAGG + Intergenic
988082709 5:26433602-26433624 AGGGAATCCACTTCCTTGAAAGG + Intergenic
988265343 5:28942103-28942125 AGAGAACCTACTGTCTTGAAAGG - Intergenic
988299380 5:29403396-29403418 AGGGAACCCACTGCCTTGAAGGG + Intergenic
988376195 5:30439160-30439182 AGGAAACCCACTGCCTTGAATGG + Intergenic
988608547 5:32703596-32703618 AGGGAACCTGCTGCCTTGAAGGG - Intronic
988931666 5:36041052-36041074 AGAGAACCTGCTGCCCTGAAGGG + Intronic
988950672 5:36256367-36256389 AGGGAAATTTCTGCCTTGTTGGG + Intronic
988956357 5:36324101-36324123 AGGGAACCTGCTGCCTTTAAGGG - Intergenic
989215363 5:38899648-38899670 AGAGAACCTGTTGCCTTGAAGGG - Intronic
989427834 5:41316616-41316638 AGGGAGCCCACTGCCCTGAAGGG + Intronic
989489435 5:42032976-42032998 AGGGAACTGGCTGCCTTGAAGGG - Intergenic
989657746 5:43762314-43762336 AGGTAACCTGCTGCCTTGAAGGG - Intergenic
989808817 5:45647461-45647483 AGGGGAACAACAGCCTTGAAGGG - Intronic
990202775 5:53397036-53397058 AGGGAGCCCACTGCCCTGAAGGG - Intergenic
990579073 5:57150943-57150965 AGGGAAACCACTGCCCTGAAGGG - Intergenic
990827905 5:59922607-59922629 AGGGAACCTGCTGCCTTGAAGGG + Intronic
990907887 5:60823208-60823230 AGGGAGAATGCTGCCTTGCAGGG - Intronic
991018642 5:61957980-61958002 AGGGGACCCACTGCCCTGAAGGG - Intergenic
991072051 5:62494626-62494648 AGCAAACCTACTGCTTTGAAGGG - Intronic
991107492 5:62861177-62861199 AGGGAACCTGCTACCTTGAAAGG - Intergenic
991209168 5:64084654-64084676 AGGGAACCTGTTGCCTTGAAGGG - Intergenic
991237838 5:64419458-64419480 AGGGAACTCACTGCCCTGAAGGG + Intergenic
991297156 5:65093493-65093515 AGGGAAACTGTTGCCTTGAAGGG + Intergenic
991395274 5:66198420-66198442 AGGGGAGCCACTGCCCTGAAGGG - Intergenic
991395321 5:66198757-66198779 AGGGAACCCACTGTCTTGAAGGG - Intergenic
992291333 5:75283182-75283204 AGGGAACCCTCTGCCTTGAAGGG + Intergenic
992657214 5:78922452-78922474 AGGGAGCCCACTACCTTGAAGGG + Intronic
992692700 5:79256318-79256340 GGAGAAGCTACTGCCCTGAAGGG - Intronic
992934503 5:81687756-81687778 AGGGAACCCACTGTCTTGAAGGG + Intronic
993040943 5:82814131-82814153 TGAGAAACAACTGCCTTGAAAGG + Intergenic
993138376 5:83998697-83998719 AGGCAACCTGCTGCCATGAAGGG + Intronic
993257052 5:85605015-85605037 AAGGAAACCACTGCCTTGAAGGG + Intergenic
993279344 5:85905313-85905335 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
993287388 5:86016575-86016597 AGAGAACCTATTGCCTTGAAGGG - Intergenic
993981341 5:94546285-94546307 GGGGAACTTACTGCCCTGAAGGG + Intronic
994028544 5:95114042-95114064 AGAGAACCTACAGGCTTGAAGGG + Intronic
994217892 5:97159371-97159393 AGGGAACCCACTGCCTTAAAAGG - Intronic
994226140 5:97253735-97253757 AGGGAATATTCTGCCATGAAGGG + Intergenic
994264604 5:97700063-97700085 AAGGGAACTGCTGCCTTGAAAGG + Intergenic
994292919 5:98051085-98051107 AGGGAACCCACTGCCTTGGAGGG + Intergenic
994310108 5:98259556-98259578 AGGGAACCAACTGCGTTGAGGGG - Intergenic
994659979 5:102641761-102641783 AGAGAAACTATTGCCTTGAAGGG + Intergenic
995049666 5:107688062-107688084 AGGGAATCCACTGCCTTGAAAGG + Intergenic
995265270 5:110152390-110152412 AGGAAACTCACTGCCTTGAAGGG + Intergenic
995310770 5:110707916-110707938 AGGAAACCTGCTGCCTTGAAGGG + Intronic
995573134 5:113502750-113502772 AGGGAAGCCACTTCCCTGAAGGG - Intergenic
995573191 5:113503085-113503107 AAGGGACCTGCTGCCTTGAAGGG - Intergenic
995697830 5:114899825-114899847 AGGTAACCCATTGCCTTGAAGGG - Intergenic
995770583 5:115665119-115665141 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
995904223 5:117104180-117104202 AGAGAAACTCCTTCCTTGAAGGG + Intergenic
996459507 5:123725273-123725295 AGGGAACCTGTTGCCTTGCAGGG + Intergenic
996593123 5:125170684-125170706 AAGGAAACCACTGCCTAGACAGG + Intergenic
996931664 5:128896403-128896425 ATGGAACCTGCTGCCTTGAAGGG - Intronic
996944997 5:129055980-129056002 AGGAAACTTGCTGCCTTGAAGGG + Intergenic
996956367 5:129187787-129187809 AGAGAACCTGCTGCCTTAAAAGG + Intergenic
996968261 5:129331358-129331380 AGGGAACTTACTTTCTTGAAGGG + Intergenic
996968310 5:129331715-129331737 AGGGAACCCGCTGCCCTGAAGGG + Intergenic
997071925 5:130632895-130632917 GGGGAACTTGCTGCCTTGAAGGG - Intergenic
997073310 5:130642644-130642666 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
997104593 5:131004405-131004427 AGGGAATCCACTGCCTTGAAGGG + Intergenic
997186200 5:131884436-131884458 AGGGAACCCACTGCCTTGAAGGG + Intronic
998058122 5:139096710-139096732 AGGGAACTTGCTGCCTTAAAGGG + Intronic
998213443 5:140219060-140219082 AGGGAAACAACTCCCTTCCATGG - Intronic
998476722 5:142428246-142428268 CAGGAAACCACTCCCTTGAATGG - Intergenic
998689363 5:144570454-144570476 AGGGAACCTGCTGCTCTGAATGG - Intergenic
998689414 5:144570822-144570844 AGGGAAACCATCTCCTTGAAAGG - Intergenic
999559522 5:152785664-152785686 AAGAAACCCACTGCCTTGAAGGG + Intergenic
1000478672 5:161744413-161744435 AGGGACCCCACTGCCTTGACAGG - Intergenic
1000498821 5:162021648-162021670 AGGGAACTCTCTGCCTTGAAGGG + Intergenic
1000539348 5:162520647-162520669 AGGAAGCCTGCTGCCTTGAAGGG - Intergenic
1000806825 5:165805724-165805746 AGGGAACCCATTGCCTTGAGGGG - Intergenic
1003127771 6:3369332-3369354 GTGGATACTACTACCTTGAAGGG - Intronic
1003952399 6:11128262-11128284 TAGGAACCTGCTGCCTTGAATGG - Intronic
1005157096 6:22819472-22819494 AGGGAACCTGCTGTCTTGAAGGG - Intergenic
1005801708 6:29432098-29432120 AGGGAAAGGACTGCGATGAAAGG - Intronic
1006463009 6:34174768-34174790 AGGGAATCTGCTGCGTTGAAGGG - Intergenic
1006554284 6:34852368-34852390 ATGGAACCCACTGCCTTGAAGGG - Intronic
1006777819 6:36609866-36609888 AGGGGGACTACTGAGTTGAATGG + Intergenic
1006964606 6:37969828-37969850 AGGGAAACTGCTTCTTTGATGGG + Intronic
1007001622 6:38319145-38319167 GGGGAACCTACTGCCATTAAGGG - Intronic
1007001676 6:38319531-38319553 AGGGAACCTGCTGCCCTGACGGG - Intronic
1007022287 6:38532687-38532709 AGGCAACCTGCTGCCTTGAAGGG + Intronic
1007232454 6:40357771-40357793 AGCTCAACTAATGCCTTGAAGGG - Intergenic
1007340080 6:41185882-41185904 AAGGAAAATACGGACTTGAAGGG - Intergenic
1008101054 6:47391931-47391953 AGGGAACCCATTGCCCTGAAGGG - Intergenic
1008179380 6:48309401-48309423 AAGGAAACTTCTGGCTTGAAAGG - Intergenic
1008192338 6:48475386-48475408 AGGGAACCTACTGCCCTGAAGGG + Intergenic
1008227323 6:48936565-48936587 AGGGAAACTGCTGCTTTGAGGGG - Intergenic
1008250367 6:49232216-49232238 AGGAAATCTGCTGCTTTGAAGGG - Intergenic
1008314682 6:50025717-50025739 AGTGAACCCACTGCCTTGAATGG + Intergenic
1008642056 6:53474278-53474300 AGGGATCCTATTGCCTTGAAGGG - Intergenic
1008707590 6:54181754-54181776 AGAGAACCCGCTGCCTTGAAGGG - Intronic
1008752809 6:54757564-54757586 AGGGAGTCCACTGCCCTGAAGGG - Intergenic
1008940483 6:57040731-57040753 AGGGAACCCACTGCCTTGAAAGG + Intergenic
1009039325 6:58158197-58158219 AGGGAGCCCACTGCCATGAAGGG - Intergenic
1009215224 6:60913040-60913062 AGGGAGCCCACTGCCATGAAGGG - Intergenic
1009308974 6:62125746-62125768 AGGGAACCTGCTACCTTGAGAGG + Intronic
1009309031 6:62126103-62126125 AGGGCACCTACTGCCCTGAAAGG + Intronic
1009748282 6:67848270-67848292 AGGGAAACTGCTTCCTTGAAGGG + Intergenic
1009893761 6:69721487-69721509 AGTGGATCTGCTGCCTTGAAGGG + Intronic
1009978651 6:70700875-70700897 AGGGAACCCACTGCCTTGAAGGG - Intronic
1010475800 6:76286119-76286141 AGGGAATCTACTGCCCTGGTAGG - Intergenic
1010596499 6:77769752-77769774 AGGGAACCCATTGCCTTGAAGGG + Intronic
1010625391 6:78131911-78131933 AGGGACCTTACTGTCTTGAAGGG + Intergenic
1010676634 6:78753463-78753485 AAGGAAACTTCTGCATTGAAGGG + Intergenic
1010958050 6:82113926-82113948 AAGGAAACTACTGATTTGTAAGG - Intergenic
1011018934 6:82789163-82789185 AAGTAACCTGCTGCCTTGAAGGG + Intergenic
1011271055 6:85580245-85580267 AGGAAACCCACTGCCTTTAAAGG + Intronic
1011291194 6:85779150-85779172 AGGGAACTCACTGCCTTGAAGGG - Intergenic
1011333259 6:86233799-86233821 AGGTAACCTGCTACCTTGAAGGG - Intergenic
1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG + Intergenic
1011914636 6:92488476-92488498 AAGAAACCCACTGCCTTGAAAGG - Intergenic
1011997058 6:93604310-93604332 AATGAAGATACTGCCTTGAAGGG + Intergenic
1012059679 6:94462868-94462890 AGGGAACCTACTGCTTTGAAAGG - Intergenic
1012190754 6:96276948-96276970 AGGTAACCCACTTCCTTGAAGGG + Intergenic
1012483170 6:99690273-99690295 AGGGAACTCACTGCCCTGAATGG + Intergenic
1012620653 6:101339953-101339975 AAGGAACCCGCTGCCTTGAAGGG - Intergenic
1012807125 6:103908600-103908622 AGGAAACCTACTGCCTTGAGTGG - Intergenic
1012827307 6:104162732-104162754 GGGGAACCTGCTCCCTTGAAAGG + Intergenic
1014234590 6:118940158-118940180 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1014542349 6:122692269-122692291 AGGGAATTCACTGCCCTGAAGGG - Intronic
1014840822 6:126218464-126218486 AGTGAAACCACTGCATTGAAGGG - Intergenic
1015907259 6:138129827-138129849 CTGGAACCTACTGCCTTGAATGG + Intergenic
1015942388 6:138465282-138465304 AAGGAAATTAATGCCTTAAAGGG + Intronic
1016061618 6:139636661-139636683 AGGAAATCCACTACCTTGAAGGG - Intergenic
1016153965 6:140780720-140780742 AGGGAGCCCACTGCCTTCAAGGG + Intergenic
1016194590 6:141318068-141318090 AAGGAACCTGCTGTCTTGAAGGG + Intergenic
1016229774 6:141788827-141788849 AGGGAACACATTGCCTTGAAGGG + Intergenic
1016259274 6:142147989-142148011 AGTGAAAATACTGCTTTCAAAGG - Intronic
1016457391 6:144245221-144245243 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1016760882 6:147735686-147735708 AGTGAAACTCCCTCCTTGAATGG - Intronic
1017243474 6:152196523-152196545 AGAGAACCTGCTGCATTGAAGGG - Intronic
1017318714 6:153062895-153062917 AGGGAACATGCTGCCTTGAAGGG + Intronic
1017398206 6:154028222-154028244 AGGGAACCTGCTGTCTTCAAGGG - Intronic
1020485416 7:8714683-8714705 AAGGAACCTGCTGCCTTGAAGGG - Intronic
1020514966 7:9106763-9106785 AAGGAAACTGCTGCCTTGAAGGG + Intergenic
1020572974 7:9889999-9890021 AGAGAACCTGCTGCCTTGAAGGG + Intergenic
1020574854 7:9913424-9913446 AGGGAATCTGCTGCATTAAAGGG - Intergenic
1020577171 7:9947662-9947684 AGGGAATCCACTGCCCTGACGGG + Intergenic
1020624245 7:10558276-10558298 AGGGAGCCCACTGCCCTGAAGGG + Intergenic
1020865148 7:13551009-13551031 AGGGAAACAACAGCATTGACAGG - Intergenic
1021034769 7:15784696-15784718 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1021046109 7:15924991-15925013 AGGAAACCCACTGCCTTAAAGGG + Intergenic
1021153388 7:17179450-17179472 AGGGAAACTGAGGCCTGGAATGG + Intergenic
1021214637 7:17901059-17901081 AGGGAACCTACTGCTTTGAAGGG - Intronic
1021894161 7:25218590-25218612 AGGTAAACTTCTGCCTGGATGGG - Intergenic
1022223620 7:28340383-28340405 AGGGAACCCACTGCCTTGAATGG - Intronic
1022262092 7:28715883-28715905 AGGGAACCTAGTACCCTGAAAGG + Intronic
1022348205 7:29538960-29538982 AGGGAACATGCTGCCTTGAAAGG + Intergenic
1022542000 7:31146267-31146289 AGGGAATCCGTTGCCTTGAAGGG - Intergenic
1022741161 7:33122981-33123003 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1022749903 7:33213722-33213744 AGGCAACCTACTGCCTTGAAAGG - Intronic
1022898413 7:34776805-34776827 AGGGAAACTACTGCCTTGAAGGG - Intronic
1023240949 7:38146745-38146767 AGGGAACCCACTGCCCTGAATGG + Intergenic
1023646240 7:42318818-42318840 AGAGGACCTACTGCCTTGAAGGG + Intergenic
1024369085 7:48559408-48559430 AGGGAGCCCACTGCCTTGAAGGG - Intronic
1024369136 7:48559775-48559797 AGGGAACCCGCTGCCTTGAAAGG - Intronic
1024415008 7:49096341-49096363 AGAGAATCCACTGCCTTGAAGGG + Intergenic
1024662452 7:51511274-51511296 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1025160460 7:56654860-56654882 AGAGAACACACTGCCTTGAAGGG + Intergenic
1025726266 7:64064335-64064357 AGAGAACACACTGCCTTGAAGGG - Intronic
1025755083 7:64330790-64330812 AGAGAACACACTGCCTTGAAGGG - Intronic
1027674675 7:81143080-81143102 AAGGAAACTGCTGCCTTGAAGGG + Intergenic
1028022389 7:85792637-85792659 AGGGAACCCAGTGTCTTGAAGGG + Intergenic
1028160897 7:87483683-87483705 AGGGAATCTACTGCTTTGAAGGG + Intergenic
1028181459 7:87729983-87730005 AGGGTACCCATTGCCTTGAAAGG + Intronic
1028266604 7:88733745-88733767 AGGGAACCCTCTGCCTTGAAGGG - Intergenic
1028307943 7:89290117-89290139 AGGAAATCTGCTGCCTTGAAAGG + Intronic
1028900689 7:96097369-96097391 AGGGAAACATCTGCTTTGGAGGG + Intronic
1028950624 7:96630876-96630898 AGAGAACCCACTGCCTCGAAAGG - Intronic
1030045143 7:105488485-105488507 AGTGAAATTACTGACTTAAAGGG - Intronic
1030222419 7:107110671-107110693 AGGGAACCTACTGCCTTGAAGGG + Intronic
1030431642 7:109455791-109455813 AGGGAATCCACTTCCTTGAAGGG - Intergenic
1030476676 7:110043270-110043292 AGGGTACCTGTTGCCTTGAAAGG - Intergenic
1030629414 7:111879227-111879249 AGGGAGCCAACTTCCTTGAAGGG + Intronic
1031098456 7:117448751-117448773 AAGGGAATTGCTGCCTTGAAGGG + Intergenic
1031260048 7:119507029-119507051 AGGGTACCTATTGCCTTGAAGGG + Intergenic
1031306230 7:120130883-120130905 AAAGAAACCACTACCTTGAATGG + Intergenic
1031546258 7:123054095-123054117 AGGGAACCTGCTGCTTTGAAGGG - Intergenic
1031565951 7:123297019-123297041 AGGGAACCTACTCCCCTGAAGGG + Intergenic
1031657810 7:124379985-124380007 AGGGCACCCACTGTCTTGAAAGG + Intergenic
1031721888 7:125187189-125187211 AGGTAATCTGCTACCTTGAAGGG + Intergenic
1031862274 7:126994242-126994264 AGAGAAACATCTTCCTTGAAGGG + Intronic
1031905723 7:127458038-127458060 AGGCAACCCACTCCCTTGAAGGG + Intergenic
1032481909 7:132254078-132254100 ATGGAATCTTCTGGCTTGAAAGG - Intronic
1032939107 7:136768133-136768155 GGGGAACCTGCTACCTTGAAGGG + Intergenic
1033542009 7:142365886-142365908 AGGGAACCTGCTGCCTTGTGGGG - Intergenic
1034581823 7:152050354-152050376 AGGGAACCTGCTACCTTGAACGG - Intronic
1035084554 7:156247153-156247175 GGGGAACCTGCTGCCTTGAAGGG - Intergenic
1035609829 8:953780-953802 AAGGAAACGACTGTCTTAAACGG - Intergenic
1036120256 8:6009111-6009133 AGGGAACCTAGTGCCTGGATGGG - Intergenic
1036936198 8:13004570-13004592 AGGCAACCTGCTGTCTTGAAGGG + Intronic
1037354177 8:17999403-17999425 AGGAAACCCACTGCCTTAAAGGG - Intronic
1039640816 8:39219005-39219027 AGGGAACCTGCTGCCTTGAATGG - Intronic
1039663668 8:39495762-39495784 AAGGAACCCACTGCCTTGAAGGG + Intergenic
1040485705 8:47869426-47869448 AGGGAACCTGCTGCCTTGAAGGG + Intronic
1040511534 8:48100374-48100396 AGGAAACCTGCTGCCTTGAAGGG - Intergenic
1040743163 8:50604987-50605009 AGGAAACCCACTGCCTTGAAGGG - Intronic
1041616005 8:59907418-59907440 AGGGAACCCACTGACTTGAAGGG + Intergenic
1041887311 8:62825490-62825512 AGATAAACTACTGGCTTGAATGG + Intronic
1042082571 8:65071323-65071345 AGGGAACCCATTGCCTTGAAGGG - Intergenic
1042162645 8:65912641-65912663 AGGGAGCCCACTGCCTTGTAGGG + Intergenic
1042297904 8:67242457-67242479 AGGGAACCCACTGCCTTGAAGGG + Intronic
1042980230 8:74518589-74518611 AGGGAACTTACTGCCTTGAAGGG + Intergenic
1043080060 8:75755386-75755408 AGAAAACCTGCTGCCTTGAAGGG + Intergenic
1043340291 8:79229738-79229760 GGGGAACCAGCTGCCTTGAAAGG - Intergenic
1043567294 8:81562181-81562203 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1043760614 8:84063337-84063359 AAGGAACCTAATGCCTTGAAAGG - Intergenic
1044241442 8:89893020-89893042 AGGGAACCTGCTGCCTTGAGGGG + Intergenic
1044635465 8:94319660-94319682 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1045041344 8:98227496-98227518 AAGGAAGCCACTGCCTTGAAGGG - Intronic
1045577553 8:103441694-103441716 ACATAAACTACTCCCTTGAATGG - Intronic
1045621192 8:103980334-103980356 AAGGAAGTTGCTGCCTTGAAGGG + Intronic
1045733461 8:105267732-105267754 AAAGAACCTGCTGCCTTGAAGGG - Intronic
1045800620 8:106096944-106096966 AGGGAACCCGCTGCCTTGAAGGG + Intergenic
1045994885 8:108351471-108351493 AGGTTACCTGCTGCCTTGAAAGG + Intronic
1046114177 8:109765462-109765484 AGTAGAACTGCTGCCTTGAAGGG - Intergenic
1046143164 8:110121221-110121243 AGGGAAGCCACTTCCTTGAAGGG + Intergenic
1046463329 8:114570668-114570690 AAGGAATGCACTGCCTTGAAGGG - Intergenic
1046557271 8:115790497-115790519 AGGGAACCCACTGCCTTAAATGG + Intronic
1046681105 8:117171213-117171235 AGGGAAATTACTGACTTTACAGG - Intronic
1046821083 8:118635142-118635164 ATGAAATCTACTGCCTTCAAAGG - Intergenic
1047342809 8:123999306-123999328 AGGGAACCCTCTGCCTTGAAAGG - Intronic
1047841156 8:128754705-128754727 AAGGAACCCACAGCCTTGAAGGG + Intergenic
1047901072 8:129422956-129422978 AGGGAATCCTCTGCCTTGAAGGG + Intergenic
1047910095 8:129518456-129518478 AAGGAACCCACTGCCTTGAAGGG + Intergenic
1047933604 8:129753401-129753423 AGGGAACCTACTGCCTTGAAGGG + Intronic
1047938001 8:129800612-129800634 AGGGAAACTGCTGCCTTGAAAGG - Intergenic
1048172145 8:132117468-132117490 TGGGAAAGATCTGCCTTGAAAGG - Intergenic
1048646637 8:136428186-136428208 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1049490110 8:142893788-142893810 AGAGAACCTGCTGCCTTGAAGGG - Intronic
1050248154 9:3713602-3713624 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1050315929 9:4400820-4400842 AGGGTATCTACTGCATTGAAGGG + Intergenic
1050355725 9:4781120-4781142 AGAGAACCTACTGCCTTGAAGGG + Intergenic
1050644327 9:7702741-7702763 AGAGAACCCACTGCCTTGAAGGG - Intergenic
1050906938 9:11016356-11016378 AGAGAACCTGCTGCCTTGAAGGG - Intergenic
1051039138 9:12785102-12785124 AGGGAACCCGCTGCCCTGAAGGG - Intronic
1051565117 9:18488725-18488747 AGGGAAATTTCAGCCTTGCAGGG - Intronic
1051992059 9:23163251-23163273 AGGGAACATACTACCTTGACAGG + Intergenic
1052473604 9:28930592-28930614 AAAGATACTTCTGCCTTGAAAGG - Intergenic
1053040016 9:34862549-34862571 AAGGAACCTGCTACCTTGAAGGG + Intergenic
1053040085 9:34862904-34862926 AGGGAGCCTACTGCCCTGAAGGG + Intergenic
1053110179 9:35453168-35453190 AGGAAACCTGCTGCCTTCAAAGG + Intergenic
1053204402 9:36173961-36173983 AGGGAACCTGCTGCCTTGAAAGG + Intergenic
1055243788 9:74217144-74217166 AAGGAACCTACTGCCTTGAAGGG - Intergenic
1055302016 9:74891938-74891960 AAGGAACCCACTCCCTTGAAGGG + Intergenic
1055579997 9:77698515-77698537 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1055692342 9:78846167-78846189 GGGGAAACTGCTGCCTTGAAGGG - Intergenic
1055886504 9:81069656-81069678 AGGGAACCTACTGCCTTGAAGGG - Intergenic
1056338792 9:85603416-85603438 AGAGAACCCACTGCCTTAAAGGG + Intronic
1057644411 9:96859522-96859544 AGGGAACCTGCTTCCTTGAAGGG + Intronic
1058820915 9:108728596-108728618 GGGGATCCTACTGCCCTGAAAGG + Intergenic
1059900648 9:118921543-118921565 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1060084157 9:120681271-120681293 AGGGAATCTGCCGCCTTCAAGGG - Intronic
1061638231 9:131929122-131929144 AGGGAATCTGCTCCCTTGAAGGG + Intronic
1061915614 9:133751666-133751688 AGGGAACCTGCTACTTTGAAGGG - Intergenic
1186601947 X:11048037-11048059 AGTGAACCAGCTGCCTTGAAGGG - Intergenic
1186911717 X:14174437-14174459 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1187090932 X:16095893-16095915 AAGGATCCCACTGCCTTGAAGGG - Intergenic
1187125879 X:16454013-16454035 TTGGAAACTATTGCCTTGGAGGG + Intergenic
1187132733 X:16518181-16518203 AGGGAATCCACTACCTTGAAGGG + Intergenic
1187579356 X:20591947-20591969 AGGGAGCCCACTGCCTTGAAGGG - Intergenic
1187594514 X:20756400-20756422 AGGGAACCTGCTGCCTTGAAAGG - Intergenic
1187612840 X:20961183-20961205 AGGGAACCCACTATCTTGAAAGG + Intergenic
1187618072 X:21020261-21020283 AGGGAACCTGCTACCTTGAAGGG + Intergenic
1187651977 X:21419972-21419994 GGGGAAATTGCTGCCCTGAAGGG - Intronic
1187844946 X:23525316-23525338 AGGGAGCCCACTGCCCTGAAGGG + Intergenic
1188089749 X:25949713-25949735 TCTGAAACTATTGCCTTGAAAGG - Intergenic
1188116508 X:26250889-26250911 AGTGAACCTGCTGCCTTGAAGGG + Intergenic
1188140833 X:26548433-26548455 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1188421159 X:29992068-29992090 TGGAAACCTGCTGCCTTGAAGGG - Intergenic
1188578961 X:31687072-31687094 AGGGAATCTGCTACCTTAAAGGG + Intronic
1188721544 X:33528836-33528858 TGGCAACCTATTGCCTTGAAGGG - Intergenic
1188742997 X:33809290-33809312 AGGGAATCCACTGACTTGAAGGG - Intergenic
1188846327 X:35076746-35076768 AGGTAACCTGCTGCCTTGAAGGG - Intergenic
1188917901 X:35934803-35934825 AGGAAACCTATTGCCTTGAAGGG - Intronic
1188932089 X:36124029-36124051 AGGGAACCCACTGCCATGAAAGG - Intronic
1188980855 X:36725740-36725762 AGAGTAAATACTGCCTGGAATGG + Intergenic
1189013482 X:37071131-37071153 AGGGAACCTGCTTCCTTGAAGGG - Intergenic
1189593814 X:42543367-42543389 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1189628147 X:42921301-42921323 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1189640727 X:43068001-43068023 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1189664607 X:43340386-43340408 AGGCAAACTTATGCCTTGATAGG + Intergenic
1189690597 X:43613368-43613390 AGGGAACCTGATGCTTTGAAAGG - Intergenic
1189770094 X:44416923-44416945 AGCGAACCCGCTGCCTTGAAGGG - Intergenic
1189854442 X:45209669-45209691 AAGGAACCCACTGCCTTGAAAGG - Intergenic
1189868819 X:45360756-45360778 AGGGAACCCACTAACTTGAAGGG - Intergenic
1189874376 X:45420610-45420632 AGGGACCCCACTGGCTTGAAAGG - Intergenic
1189890017 X:45591496-45591518 GGGGAGCCCACTGCCTTGAAGGG - Intergenic
1189890076 X:45591851-45591873 AGAGAACCTGCTGCCTTGACAGG - Intergenic
1189929686 X:45996097-45996119 AGGGAACCTGCTTCCTTGAAGGG - Intergenic
1189935852 X:46067441-46067463 AGTGAACCCACTGCTTTGAAAGG - Intergenic
1190046217 X:47113374-47113396 AGAGAACCTGCTGCCTTGAAGGG + Intergenic
1190122379 X:47672684-47672706 AAGGAACCTGCTGCCTTGAAGGG - Intergenic
1190537789 X:51446856-51446878 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1190588171 X:51968023-51968045 AGGGAACACGCTGCCTTGAAGGG - Intergenic
1190594488 X:52038957-52038979 AGGGAACATAATACCTTGAAGGG + Intergenic
1190602674 X:52108564-52108586 AGGGAACATGCTACCTTGAAGGG - Intergenic
1190614558 X:52217195-52217217 AGGGAACCCACTGTCTTGAAGGG + Intergenic
1190804768 X:53824772-53824794 AGGGAACCCAGTGCCTTGAAGGG + Intergenic
1190899003 X:54650784-54650806 AAGGAATCAACTACCTTGAAGGG + Intergenic
1190907812 X:54745953-54745975 AGGGAACTCACTGCCCTGAAGGG - Intergenic
1190907923 X:54746620-54746642 AGGGAACCTGCTGCATTGAAGGG - Intergenic
1190911630 X:54776700-54776722 AGGAAACCTGCTGCCTTGAAGGG + Intronic
1190919590 X:54839519-54839541 AAGAAACCTACTGCCTTGAAGGG - Intergenic
1191048816 X:56169098-56169120 AGGGAAACTGCTGCCTTAAAGGG + Intergenic
1191194099 X:57703310-57703332 AGGGAACCCACTACCCTGAAAGG - Intergenic
1191197180 X:57736941-57736963 AGGGAGACCACTGCTCTGAATGG + Intergenic
1191646656 X:63488659-63488681 GGGGAGTCCACTGCCTTGAATGG + Intergenic
1191829572 X:65401840-65401862 AAGGAACCCACTGCATTGAAGGG + Intronic
1191943530 X:66504638-66504660 AGGGAATCCACTGCCTTGAGGGG + Intergenic
1191946953 X:66544803-66544825 AGAGAACTCACTGCCTTGAAGGG - Intergenic
1192001748 X:67158835-67158857 AGGGAACCCACTGCCTTGAAAGG + Intergenic
1192008337 X:67241161-67241183 GGGGAACTCACTGCCTTGAAGGG + Intergenic
1192060177 X:67816589-67816611 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1192062134 X:67838634-67838656 AGGGAAGCTACTGCCTTGAACGG + Intergenic
1192073150 X:67962201-67962223 AGGGAAACCACTGCCTTAAAGGG + Intergenic
1192077845 X:68018293-68018315 AGGGAACTCACTGCCTTGAAGGG + Intergenic
1192077899 X:68018652-68018674 GGGGAGTCTACTGCCCTGAACGG + Intergenic
1192088126 X:68121926-68121948 AGGGAACCCACTGCCTTGAATGG + Intronic
1192304469 X:69944415-69944437 AGGGAACCTGCCGCCTTGAAGGG - Intronic
1192374844 X:70549166-70549188 AAGGTACCCACTGCCTTGAAGGG + Intronic
1192380771 X:70613945-70613967 AGAGAACCCATTGCCTTGAAGGG + Intronic
1192393316 X:70753496-70753518 AGGGAACCCACTACCTTGAAGGG + Intronic
1192397255 X:70794726-70794748 AGGGGATCTGCTGCCTTGAAAGG + Intronic
1192402820 X:70854111-70854133 AGGGAAACCAATGCCATGAAAGG + Intronic
1192505692 X:71680765-71680787 AGCAAATCTGCTGCCTTGAAGGG - Intergenic
1192521377 X:71804370-71804392 AGGGAATCTGCTGCCTTGAAGGG + Intergenic
1192640457 X:72857260-72857282 AGGGAACACCCTGCCTTGAAGGG + Intergenic
1192641254 X:72863516-72863538 AGGGAACACCCTGCCTTGAAGGG - Intergenic
1192672578 X:73161370-73161392 GGGGAAATTGCTGCCCTGAAGGG - Intergenic
1192676235 X:73199597-73199619 GGGGAACCTGCTGCCCTGAAGGG + Intergenic
1192793371 X:74406171-74406193 AAGGGAACTGCTGCCTTGAAGGG + Intergenic
1192836093 X:74801484-74801506 AGGGAAAATGCTGCCTTGAAAGG + Intronic
1192836422 X:74804510-74804532 AGGAAACCTGCTGCCTTCAAGGG - Intronic
1192858530 X:75040136-75040158 ATGGAACCCACTGCCTTGAAGGG - Intergenic
1192863722 X:75107606-75107628 AGGGAATCCACGGCCTTGAAGGG + Intronic
1192875279 X:75223080-75223102 AGGAAACCCAATGCCTTGAAGGG - Intergenic
1193063559 X:77233161-77233183 AGGAGAACTGCTGCCTTGAAAGG + Intergenic
1193078633 X:77382555-77382577 AAGGAACCTGCTACCTTGAAGGG + Intergenic
1193116738 X:77782858-77782880 AGGGAATCTGCTGCCCTGAAGGG + Intronic
1193147472 X:78092489-78092511 GGGAAAACCACTGCCCTGAAGGG - Intronic
1193169027 X:78315166-78315188 AGGGAACCTGCTGCCTTGAAGGG + Intronic
1193173008 X:78358290-78358312 AGGGAGACCACTGACCTGAAGGG - Intergenic
1193191156 X:78572768-78572790 AGGGAATCTGCTCTCTTGAAAGG - Intergenic
1193191675 X:78578667-78578689 AGGGAACCTGCTGCCTTAAAGGG + Intergenic
1193252538 X:79308946-79308968 AGAGAAACCACTGTCTCGAATGG + Intergenic
1193280368 X:79641662-79641684 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1193289345 X:79753473-79753495 AGAGAATATACTGTCTTGAAGGG - Intergenic
1193299978 X:79878485-79878507 AGGGAACCTTCTGCCTTAAAGGG + Intergenic
1193408933 X:81140246-81140268 AGGGAACCTGCTGCCTTAAAAGG + Intronic
1193417044 X:81237995-81238017 AGGGAACCCACTGCCTTGAAGGG + Intronic
1193417094 X:81238252-81238274 AGGGAGCCCACTGCCCTGAAGGG + Intronic
1193585049 X:83311165-83311187 AGGGAACCTACTTCCTTGAAGGG + Intergenic
1193596445 X:83451684-83451706 AGGGAACCTACTGCCTTGAAGGG - Intergenic
1193664553 X:84299983-84300005 AGAGAACCCACTGACTTGAAAGG + Intergenic
1193755931 X:85408662-85408684 AAGGAACCCAGTGCCTTGAAGGG - Intergenic
1193756799 X:85418828-85418850 AAGGAAAACACTGCCTTGAAGGG - Intergenic
1193760731 X:85462458-85462480 AGGGAGACTGCTGTCTTGAAGGG + Intergenic
1193802426 X:85952470-85952492 AGGGAACCCATTGCCTTCAAAGG + Intronic
1193830968 X:86289125-86289147 AGGGAAACTTCTGCCTTGAAGGG - Intronic
1193856753 X:86612095-86612117 AGGGAACCCACTACCTTGAAGGG - Intronic
1193880116 X:86911216-86911238 GGGGAATCCACTGCCCTGAAAGG - Intergenic
1193912066 X:87317703-87317725 AAGGAACCTGCTGCCTTGAAGGG - Intergenic
1193931875 X:87562682-87562704 AGGGACTCTACTGCCTTGAAGGG + Intronic
1193984830 X:88227970-88227992 AGGGAAACTTCTGCCTTGAGTGG + Intergenic
1193986844 X:88252865-88252887 AGAGAACCCACTGCCCTGAATGG - Intergenic
1194033129 X:88840120-88840142 AAGGAACCTACTGCTTTGAAGGG + Intergenic
1194065256 X:89253148-89253170 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1194136612 X:90151815-90151837 AGGGAACCTACTTTCTTGAAGGG + Intergenic
1194165136 X:90506275-90506297 AGGTAACTTACTGCCTTGAAGGG + Intergenic
1194219645 X:91175372-91175394 AGGGAACCTGCTGCTTTGAAGGG - Intergenic
1194223605 X:91227308-91227330 AGGGAACCCACTGCCTTCAAGGG + Intergenic
1194247438 X:91533965-91533987 AGGGAAACCACTGCATTAAAGGG - Intergenic
1194253145 X:91602886-91602908 AGGGAACCTGCTGCCTTTAAGGG + Intergenic
1194338737 X:92682556-92682578 AGGAAACCCACTGCCTTGAAGGG - Intergenic
1194370819 X:93069478-93069500 GGGGAACCTGCTGTCTTGAAGGG + Intergenic
1194372484 X:93091110-93091132 GGGGAGACCACTGCCCTGAAAGG - Intergenic
1194378570 X:93165996-93166018 AGAGAATATGCTGCCTTGAAGGG + Intergenic
1194387743 X:93278049-93278071 AGGGAACCTACTGCTTTAGAGGG + Intergenic
1194398175 X:93412018-93412040 AGGGAACATGCTACCTTGAAGGG + Intergenic
1194415450 X:93606307-93606329 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1194447142 X:94002211-94002233 GGGGAGCCCACTGCCTTGAAAGG - Intergenic
1194457554 X:94123653-94123675 AGGGGAGCCACTGCCCTGAAGGG - Intergenic
1194457605 X:94124010-94124032 AGGGAATCCTCTGTCTTGAAGGG - Intergenic
1194476910 X:94369598-94369620 AGGGAGACCACTGCCCTGAAAGG + Intergenic
1194558240 X:95388972-95388994 AGGGTACCCATTGCCTTGAAGGG - Intergenic
1194586171 X:95736772-95736794 AAGGAAACTGCTACCCTGAATGG + Intergenic
1194591509 X:95805272-95805294 AGGGAACTCAATGCCTTGAAGGG + Intergenic
1194605855 X:95976724-95976746 AGGGCATCTGCTGCCTTGAAGGG + Intergenic
1194780813 X:98023373-98023395 ATGGAACCTAGTCCCTTGAAGGG - Intergenic
1194783869 X:98058070-98058092 AGGTAATGTGCTGCCTTGAAGGG - Intergenic
1194823434 X:98532368-98532390 GGGGAGACCACTGCCATGAAGGG + Intergenic
1194882756 X:99274064-99274086 AGGGAACCAAGTGCCTTGATAGG + Intergenic
1194892574 X:99398386-99398408 AGGGAACCCAGTGCCTTGAAAGG - Intergenic
1194928779 X:99861929-99861951 AAGGAACCCACTGCCTTGGAAGG + Intergenic
1194990636 X:100543391-100543413 AGGGAACCTGCAGCTTTGAAGGG + Intergenic
1195014694 X:100766578-100766600 AGGGAACTCACTGCCTTAAAGGG - Intergenic
1195037164 X:100980835-100980857 AGGGAACCCAGTGCCCTGAAAGG - Intronic
1195115718 X:101696257-101696279 AAGGAACCTGCTTCCTTGAAGGG + Intergenic
1195199320 X:102532695-102532717 TGGGAACCCACTGCTTTGAAGGG + Intergenic
1195252440 X:103062453-103062475 AGTGACTCTACTGCCTTCAAAGG + Intergenic
1195290074 X:103423933-103423955 AGGGAACTTTCTGCCTTGAATGG - Intergenic
1195502054 X:105613230-105613252 AGAGAACCCAGTGCCTTGAAGGG + Intronic
1195543257 X:106087174-106087196 GGGGAACTCACTGCCTTGAACGG - Intergenic
1195807871 X:108795883-108795905 AGGGAACCCACTGACTTGAAGGG - Intergenic
1195823356 X:108970671-108970693 AGGGAGCCAACTGCCCTGAAGGG + Intergenic
1195849172 X:109264546-109264568 AGGGAACACACTGCCTCGAAGGG - Intergenic
1195852186 X:109295338-109295360 AGGAAACCTGCTGCCTTGAAGGG - Intergenic
1195872130 X:109497609-109497631 AGGGAACCTGCTGCCTTGAAGGG - Intergenic
1195984589 X:110615200-110615222 AGAGAACCTACTGCCTTGAAGGG - Intergenic
1196096787 X:111808892-111808914 AGAGAACCTGCTGCTTTGAAGGG - Intronic
1196153999 X:112406906-112406928 AGGGTACCTGCTTCCTTGAAGGG + Intergenic
1196226284 X:113171126-113171148 AGGGAGCCCACTGCCCTGAAGGG - Intergenic
1196248456 X:113428876-113428898 GGAGAACCCACTGCCTTGAAGGG + Intergenic
1196357381 X:114810019-114810041 AGAGAACCCACTGCCTTGAAGGG - Intronic
1196385059 X:115140265-115140287 AGGGAACCCACTGCCTTGAAGGG + Intronic
1196461403 X:115935644-115935666 AAGGAACTTGCTGCCTTGAAGGG - Intergenic
1196494387 X:116307174-116307196 AGGGAATGCACTTCCTTGAAGGG - Intergenic
1196508688 X:116479203-116479225 AGGGAACCCACTTCCCTGAAGGG + Intergenic
1196510151 X:116499703-116499725 AAGGAACCTGTTGCCTTGAAGGG - Intergenic
1196523810 X:116707538-116707560 AGGGAGACCAGTGCCTTGAAGGG - Intergenic
1196523858 X:116707882-116707904 AGGGAATGCACTGCCTTGAAGGG - Intergenic
1196537311 X:116862628-116862650 GGGGAAACTACTCCCCTGAAGGG - Intergenic
1196552479 X:117045570-117045592 AGGAAACCCACTGCCTTGAAGGG + Intergenic
1196639216 X:118039054-118039076 AGGAAACCTGCTGCCTTGAAGGG + Intronic
1196660504 X:118264196-118264218 AGCAAACCTGCTGCCTTGAAGGG + Intergenic
1196962151 X:121014816-121014838 AGGGAACCCATTGCCCTGAAGGG - Intergenic
1197072896 X:122321922-122321944 AGCAAACCTGCTGCCTTGAAGGG + Intergenic
1197099538 X:122636494-122636516 GGGGAGCCCACTGCCTTGAAGGG - Intergenic
1197099593 X:122636850-122636872 AGAGAACCCACTGCCTTCAAGGG - Intergenic
1197139089 X:123096583-123096605 AGGGAACCTGCTGTCTTGAAGGG + Intergenic
1197348250 X:125350428-125350450 AGGGAATGTGCTGCCCTGAAGGG + Intergenic
1197363232 X:125532967-125532989 AGGAAACCTGCTGCCTGGAAGGG - Intergenic
1197399667 X:125974634-125974656 AGGAAACCCGCTGCCTTGAAGGG + Intergenic
1197429414 X:126342292-126342314 AGTGAACCTGCTGCCTTGAAGGG + Intergenic
1197429462 X:126342646-126342668 GGGGAGCCCACTGCCTTGAAGGG + Intergenic
1197435676 X:126425397-126425419 AGGGAACCTTCTGTCTTGAAGGG - Intergenic
1197449562 X:126594703-126594725 AGGGAACGTGCTGCTTTGAAAGG - Intergenic
1197468563 X:126837753-126837775 AGGGAATCTGATGCCTTGAAAGG + Intergenic
1197481764 X:126995357-126995379 AGGGAACTTACCGCTTTGAAGGG + Intergenic
1197581351 X:128288153-128288175 AGGGTCCCCACTGCCTTGAAGGG + Intergenic
1197602654 X:128548312-128548334 AGGGAACCTACTACCTTAAAGGG - Intergenic
1197677679 X:129347583-129347605 AGGGAACTCACTGCCCTGAAAGG + Intergenic
1197810877 X:130441929-130441951 AGGGAACCTGCTACCTTGAAGGG - Intergenic
1197876563 X:131114934-131114956 AGGGAACCCACTGCCTTAAAGGG - Intergenic
1198430852 X:136564964-136564986 AGAGAACCCACTGCCTTGAAGGG - Intergenic
1198515288 X:137400779-137400801 AGGGAACCTGCTACCTTGAAAGG - Intergenic
1198697274 X:139355191-139355213 AGAGAACCCACTGCCTTGAAGGG - Intergenic
1198702600 X:139414017-139414039 AGGGAACCTGTTACCTTGAAGGG - Intergenic
1198724704 X:139664916-139664938 AGGGAACCTACTGCCTTGAAGGG - Intronic
1198761807 X:140040371-140040393 ATGGAAACTGCTGCCTTGAAGGG - Intergenic
1198770559 X:140125987-140126009 AGGGAGCCCACTGCCCTGAAAGG - Intergenic
1198773517 X:140155730-140155752 AGGGAACATGCTGCCTTGAAGGG + Intergenic
1198785506 X:140283594-140283616 AGAGGACCTGCTGCCTTGAAGGG - Intergenic
1198788163 X:140313742-140313764 AGGGAACCCACTGCCTTGAAGGG + Intergenic
1198817989 X:140613930-140613952 GGGGACCTTACTGCCTTGAAGGG - Intergenic
1198995255 X:142566977-142566999 AAGGAACCCTCTGCCTTGAAGGG - Intergenic
1199037008 X:143063683-143063705 AGAGAACCTACTACCTTGAAAGG + Intergenic
1199041116 X:143116394-143116416 AGGTAACCTACTGCCTTGAATGG - Intergenic
1199115242 X:143984829-143984851 AGGGAACCCACTGCCTTGAAGGG - Intergenic
1199156113 X:144550923-144550945 AGGGAGACCCATGCCTTGAAGGG + Intergenic
1199175944 X:144787226-144787248 GTGGAACCTGCTGCCTTGAAGGG + Intergenic
1199177653 X:144810675-144810697 AGGGAACATGCTGCCTTTAAGGG + Intergenic
1199197456 X:145048046-145048068 AGGGAGCCTGCTGCCTTGAAGGG + Intergenic
1199223125 X:145340269-145340291 AGGAAACCTGCTGCCTTGAAGGG + Intergenic
1199247644 X:145625388-145625410 AGGGAACCTGTTGCCTTGAGGGG + Intergenic
1199303908 X:146244922-146244944 TGGGAACCCACTGCATTGAAGGG + Intergenic
1199314741 X:146363558-146363580 AAGGAAACGACTGCCTTGAAGGG - Intergenic
1199316044 X:146379415-146379437 AGGGACCCCACTGCCTTGAAGGG + Intergenic
1199334355 X:146600817-146600839 AGGGAACCTGATGCCTTGAAGGG - Intergenic
1199374218 X:147088240-147088262 AGGGAGACTACTACCCTGAAGGG - Intergenic
1199439682 X:147854352-147854374 AGAGAACCTGATGCCTTGAAGGG - Intergenic
1199455224 X:148020630-148020652 AGACAATCTACTGCCTTAAAGGG - Intronic
1199457419 X:148044479-148044501 AGGGAAACTGTTGCCTTAAAGGG - Intergenic
1199485064 X:148338304-148338326 AGGGAATCTACTGCCTTGAAGGG + Intergenic
1199568821 X:149246694-149246716 AGGGAACCTGTTGCCTTGAAAGG - Intergenic
1199645724 X:149909134-149909156 AGGGAATCTGCTGCCTTGAAGGG + Intergenic
1199795487 X:151191623-151191645 AGGGAATCTACTGCCTTGAATGG + Intergenic
1199845234 X:151688107-151688129 AGGGAACCCACTGCCCTGAAAGG + Intergenic
1199908424 X:152259638-152259660 AGGAAACCCATTGCCTTGAAAGG + Intronic
1200315849 X:155132526-155132548 AAGGAACCCACTGTCTTGAAGGG + Intronic
1200370017 X:155715317-155715339 AGGAAATCTGCTGTCTTGAAGGG - Intergenic
1200482363 Y:3721765-3721787 AGGGAACCTACTTTCTTGAAGGG + Intergenic
1200511399 Y:4084075-4084097 AGGTAACTTACTGCCTTGAAGGG + Intergenic
1200556157 Y:4639136-4639158 AGGGAACCTGCTGCTTTGAAGGG - Intergenic
1200560071 Y:4690690-4690712 AGGGAACCCACTGCCTTCAAGGG + Intergenic
1200566461 Y:4775498-4775520 AGGGAAACCACTGCATTAAAGGG - Intergenic
1200647125 Y:5799336-5799358 AGGAAACCCACTGCCTTGAAGGG - Intergenic
1200649041 Y:5817925-5817947 AGAAAACCTGCTGCCTTGAAGGG - Intergenic
1200678614 Y:6181370-6181392 GGGGAACCTGCTGTCTTGAAGGG + Intergenic
1200680525 Y:6205153-6205175 GGGGAGACCACTGCCCTGAAAGG - Intergenic
1200719427 Y:6587232-6587254 AGGGAACCTGCTGCCTTGAAGGG + Intergenic
1201864941 Y:18640211-18640233 AAGGAAATTTCTGGCTTGAAGGG - Intergenic
1201868381 Y:18680155-18680177 AAGGAAATTTCTGGCTTGAAGGG + Intergenic