ID: 1011598506

View in Genome Browser
Species Human (GRCh38)
Location 6:89038744-89038766
Sequence CCATGACAACACTCATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011598506_1011598509 0 Left 1011598506 6:89038744-89038766 CCTTCCTATGAGTGTTGTCATGG No data
Right 1011598509 6:89038767-89038789 ATAAACTAAGCTCCTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011598506 Original CRISPR CCATGACAACACTCATAGGA AGG (reversed) Intergenic
No off target data available for this crispr