ID: 1011602095

View in Genome Browser
Species Human (GRCh38)
Location 6:89069481-89069503
Sequence CTTTCAAGCCCGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011602095_1011602101 16 Left 1011602095 6:89069481-89069503 CCCAGCTTCATCGGGCTTGAAAG No data
Right 1011602101 6:89069520-89069542 TAAAACCTGGTTGGGCACGGTGG No data
1011602095_1011602099 8 Left 1011602095 6:89069481-89069503 CCCAGCTTCATCGGGCTTGAAAG No data
Right 1011602099 6:89069512-89069534 ATGAAAAATAAAACCTGGTTGGG No data
1011602095_1011602098 7 Left 1011602095 6:89069481-89069503 CCCAGCTTCATCGGGCTTGAAAG No data
Right 1011602098 6:89069511-89069533 CATGAAAAATAAAACCTGGTTGG No data
1011602095_1011602097 3 Left 1011602095 6:89069481-89069503 CCCAGCTTCATCGGGCTTGAAAG No data
Right 1011602097 6:89069507-89069529 AGAACATGAAAAATAAAACCTGG No data
1011602095_1011602100 13 Left 1011602095 6:89069481-89069503 CCCAGCTTCATCGGGCTTGAAAG No data
Right 1011602100 6:89069517-89069539 AAATAAAACCTGGTTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011602095 Original CRISPR CTTTCAAGCCCGATGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr