ID: 1011603721

View in Genome Browser
Species Human (GRCh38)
Location 6:89081776-89081798
Sequence CGCTGACGTCAGCCCTCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011603721_1011603732 26 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603732 6:89081825-89081847 CCCATGAAGGAGGCGAGGCCGGG 0: 1
1: 0
2: 0
3: 32
4: 408
1011603721_1011603735 30 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603735 6:89081829-89081851 TGAAGGAGGCGAGGCCGGGTGGG 0: 1
1: 0
2: 3
3: 27
4: 535
1011603721_1011603727 16 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603727 6:89081815-89081837 CGCTCCGGCGCCCATGAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 145
1011603721_1011603729 21 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603729 6:89081820-89081842 CGGCGCCCATGAAGGAGGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 122
1011603721_1011603734 29 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603734 6:89081828-89081850 ATGAAGGAGGCGAGGCCGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 670
1011603721_1011603730 25 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603730 6:89081824-89081846 GCCCATGAAGGAGGCGAGGCCGG 0: 1
1: 0
2: 1
3: 37
4: 344
1011603721_1011603723 1 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603723 6:89081800-89081822 GCGCTACGTGCCCGGCGCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 40
1011603721_1011603722 -7 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603722 6:89081792-89081814 GTCAGCGCGCGCTACGTGCCCGG 0: 1
1: 1
2: 0
3: 4
4: 42
1011603721_1011603726 13 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603726 6:89081812-89081834 CGGCGCTCCGGCGCCCATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011603721 Original CRISPR CGCTGACGTCAGCCCTCCCG CGG (reversed) Intronic