ID: 1011603724

View in Genome Browser
Species Human (GRCh38)
Location 6:89081810-89081832
Sequence TTCATGGGCGCCGGAGCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 31}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011603724_1011603738 5 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603738 6:89081838-89081860 CGAGGCCGGGTGGGGGCAGCTGG 0: 1
1: 0
2: 4
3: 68
4: 623
1011603724_1011603737 -2 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603737 6:89081831-89081853 AAGGAGGCGAGGCCGGGTGGGGG 0: 1
1: 1
2: 3
3: 46
4: 582
1011603724_1011603739 6 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603739 6:89081839-89081861 GAGGCCGGGTGGGGGCAGCTGGG 0: 1
1: 1
2: 7
3: 87
4: 686
1011603724_1011603744 17 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603744 6:89081850-89081872 GGGGCAGCTGGGGAAGGACTGGG 0: 1
1: 0
2: 9
3: 87
4: 711
1011603724_1011603735 -4 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603735 6:89081829-89081851 TGAAGGAGGCGAGGCCGGGTGGG 0: 1
1: 0
2: 3
3: 27
4: 535
1011603724_1011603742 11 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603742 6:89081844-89081866 CGGGTGGGGGCAGCTGGGGAAGG 0: 1
1: 0
2: 8
3: 166
4: 1321
1011603724_1011603736 -3 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603736 6:89081830-89081852 GAAGGAGGCGAGGCCGGGTGGGG 0: 1
1: 2
2: 7
3: 94
4: 920
1011603724_1011603730 -9 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603730 6:89081824-89081846 GCCCATGAAGGAGGCGAGGCCGG 0: 1
1: 0
2: 1
3: 37
4: 344
1011603724_1011603746 29 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603746 6:89081862-89081884 GAAGGACTGGGCCCGGCTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 119
1011603724_1011603745 22 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603745 6:89081855-89081877 AGCTGGGGAAGGACTGGGCCCGG 0: 1
1: 1
2: 6
3: 82
4: 677
1011603724_1011603734 -5 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603734 6:89081828-89081850 ATGAAGGAGGCGAGGCCGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 670
1011603724_1011603732 -8 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603732 6:89081825-89081847 CCCATGAAGGAGGCGAGGCCGGG 0: 1
1: 0
2: 0
3: 32
4: 408
1011603724_1011603740 7 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603740 6:89081840-89081862 AGGCCGGGTGGGGGCAGCTGGGG 0: 1
1: 0
2: 12
3: 76
4: 766
1011603724_1011603743 16 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603743 6:89081849-89081871 GGGGGCAGCTGGGGAAGGACTGG 0: 1
1: 0
2: 11
3: 111
4: 958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011603724 Original CRISPR TTCATGGGCGCCGGAGCGCC GGG (reversed) Intronic