ID: 1011603735

View in Genome Browser
Species Human (GRCh38)
Location 6:89081829-89081851
Sequence TGAAGGAGGCGAGGCCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 535}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011603724_1011603735 -4 Left 1011603724 6:89081810-89081832 CCCGGCGCTCCGGCGCCCATGAA 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1011603735 6:89081829-89081851 TGAAGGAGGCGAGGCCGGGTGGG 0: 1
1: 0
2: 3
3: 27
4: 535
1011603721_1011603735 30 Left 1011603721 6:89081776-89081798 CCGCGGGAGGGCTGACGTCAGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1011603735 6:89081829-89081851 TGAAGGAGGCGAGGCCGGGTGGG 0: 1
1: 0
2: 3
3: 27
4: 535
1011603725_1011603735 -5 Left 1011603725 6:89081811-89081833 CCGGCGCTCCGGCGCCCATGAAG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1011603735 6:89081829-89081851 TGAAGGAGGCGAGGCCGGGTGGG 0: 1
1: 0
2: 3
3: 27
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011603735 Original CRISPR TGAAGGAGGCGAGGCCGGGT GGG Intronic