ID: 1011609423

View in Genome Browser
Species Human (GRCh38)
Location 6:89136018-89136040
Sequence GTGGGCAATAAGAATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011609418_1011609423 5 Left 1011609418 6:89135990-89136012 CCTGTGCGGATGCCAGGTAAGTT No data
Right 1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG No data
1011609421_1011609423 -7 Left 1011609421 6:89136002-89136024 CCAGGTAAGTTGCCATGTGGGCA No data
Right 1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG No data
1011609415_1011609423 18 Left 1011609415 6:89135977-89135999 CCCTGAACATTTACCTGTGCGGA No data
Right 1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG No data
1011609416_1011609423 17 Left 1011609416 6:89135978-89136000 CCTGAACATTTACCTGTGCGGAT No data
Right 1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011609423 Original CRISPR GTGGGCAATAAGAATACTGC TGG Intergenic
No off target data available for this crispr