ID: 1011613228

View in Genome Browser
Species Human (GRCh38)
Location 6:89173716-89173738
Sequence AGATATAAGGTATAGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011613223_1011613228 -9 Left 1011613223 6:89173702-89173724 CCACTCCCCGTTATAGATATAAG No data
Right 1011613228 6:89173716-89173738 AGATATAAGGTATAGTTGTGTGG No data
1011613222_1011613228 -1 Left 1011613222 6:89173694-89173716 CCTATTTTCCACTCCCCGTTATA No data
Right 1011613228 6:89173716-89173738 AGATATAAGGTATAGTTGTGTGG No data
1011613221_1011613228 0 Left 1011613221 6:89173693-89173715 CCCTATTTTCCACTCCCCGTTAT No data
Right 1011613228 6:89173716-89173738 AGATATAAGGTATAGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011613228 Original CRISPR AGATATAAGGTATAGTTGTG TGG Intergenic
No off target data available for this crispr