ID: 1011616097

View in Genome Browser
Species Human (GRCh38)
Location 6:89199616-89199638
Sequence GGATGTTTTCAAACTTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011616097_1011616100 6 Left 1011616097 6:89199616-89199638 CCAACAGAAGTTTGAAAACATCC 0: 1
1: 0
2: 2
3: 49
4: 423
Right 1011616100 6:89199645-89199667 GGTTATATATGCTCATCTGAAGG No data
1011616097_1011616101 23 Left 1011616097 6:89199616-89199638 CCAACAGAAGTTTGAAAACATCC 0: 1
1: 0
2: 2
3: 49
4: 423
Right 1011616101 6:89199662-89199684 TGAAGGTATGATGAAGACCTAGG 0: 1
1: 0
2: 2
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011616097 Original CRISPR GGATGTTTTCAAACTTCTGT TGG (reversed) Intronic
900430402 1:2598673-2598695 TGATGTTTTCAAGGTTCTGCAGG + Exonic
904707548 1:32402689-32402711 GGTTGTTTTCATACTTCTCAAGG + Intergenic
905096146 1:35472699-35472721 GGATGGTTTCAAACTTCCAAAGG - Intronic
905276174 1:36819593-36819615 CGATGTCTCCAAACTTCTGCCGG + Intronic
905815309 1:40945897-40945919 AAATATTTTTAAACTTCTGTAGG + Intergenic
907289128 1:53401699-53401721 GGATGTTCTCATAGTTCTGGAGG - Intergenic
908128580 1:61053037-61053059 GGAAGTCTTCAGACTTCTTTTGG - Intronic
908357549 1:63337506-63337528 GAAAGTTTACAAATTTCTGTTGG + Intergenic
908570137 1:65401076-65401098 GGATTTTTTTATACATCTGTTGG + Intronic
908705134 1:66945440-66945462 GAATGTTTTCAATCTGCTGTTGG + Intronic
909347823 1:74613061-74613083 GAAAGTTTTCAAATTTGTGTAGG + Intronic
909475972 1:76081339-76081361 GAATGTTTACAAATTTGTGTTGG + Intronic
909522289 1:76583514-76583536 GGAATTTTTCAAACAACTGTTGG - Intronic
909553796 1:76929981-76930003 GGTTGTTTTCATATTTTTGTGGG + Intronic
910600631 1:89028421-89028443 GGATGTTTGCAACATTCTATTGG + Intergenic
911270177 1:95791544-95791566 GGAATTTTTCAAAGTTCTCTGGG - Intergenic
912461576 1:109836147-109836169 TGATCTTGTAAAACTTCTGTGGG + Intergenic
913338160 1:117729829-117729851 GCATTTTTTCATACTTTTGTTGG - Intergenic
913430877 1:118789284-118789306 GGAAGTTTTCAGACCTCTGTTGG - Intergenic
913499916 1:119462592-119462614 GGCTGTTTTCATACTTCTCATGG + Intergenic
913568232 1:120094690-120094712 CTATTTTTTCCAACTTCTGTGGG - Intergenic
914289041 1:146255719-146255741 CTATTTTTTCCAACTTCTGTGGG - Intergenic
914550076 1:148706462-148706484 CTATTTTTTCCAACTTCTGTGGG - Intergenic
915586301 1:156845644-156845666 GAAAGTTTTCAAACTTCTTCTGG + Exonic
915901800 1:159852405-159852427 GGTTGTTTTCAATGTACTGTAGG - Intronic
916068815 1:161158142-161158164 GGATCATTTCAAACCTTTGTGGG + Exonic
916940243 1:169669268-169669290 GGATGTGTTCAGCCTTCTGGTGG - Intronic
917232482 1:172853149-172853171 GGTTTTTTTCATACGTCTGTTGG + Intergenic
917511351 1:175671636-175671658 GTATGTTTCCAAAATTGTGTGGG + Intronic
917714602 1:177721786-177721808 GGGAGTTTTCAAATTTTTGTAGG - Intergenic
918518742 1:185391157-185391179 AGAGGTTTTCAAACTTTAGTGGG - Intergenic
918811893 1:189132868-189132890 GGCTGTTTTCATACTTCTCATGG + Intergenic
919668347 1:200314484-200314506 GGATGTTTGCAAACTCCTGGAGG + Intergenic
920792559 1:209106805-209106827 GAATGTTTTTAAACCTCTCTAGG - Intergenic
921263144 1:213401416-213401438 AGATGTTTTCACAATACTGTTGG + Intergenic
921470274 1:215539799-215539821 GGATGCTTTTGAACTTCTGCAGG + Intergenic
922026016 1:221749636-221749658 TGATGTTTTCTAAATTCTATGGG - Intergenic
922305720 1:224342602-224342624 GGATCTTTTCATATATCTGTGGG + Intergenic
922944885 1:229504989-229505011 GAAAGTTTACAAACTTGTGTTGG - Intronic
923807518 1:237274336-237274358 GGATGATTTCAATCTTGTGTAGG + Intronic
923834958 1:237600823-237600845 GCATGTTTTCATATGTCTGTTGG - Intronic
923911576 1:238452094-238452116 CGAAATTTCCAAACTTCTGTTGG - Intergenic
1063926897 10:10987841-10987863 GCATGTTTTCATACATTTGTTGG - Intergenic
1064154906 10:12895998-12896020 GGCTGCTCTCAAACTCCTGTAGG + Intergenic
1064703229 10:18044174-18044196 GGCTGGTTTCAAACTCCTGGTGG - Intergenic
1065616766 10:27535215-27535237 GGAAGTTTACAAATTTGTGTTGG - Intronic
1066069206 10:31788757-31788779 GAAAGTTTGCAAATTTCTGTCGG + Intergenic
1066814480 10:39387602-39387624 GAATGTTTCCAAACTTCTGAAGG + Intergenic
1066823800 10:39534925-39534947 GAGTGTTTTAAAACTGCTGTGGG - Intergenic
1067679231 10:48417342-48417364 GTAAGCTTTCAAGCTTCTGTTGG + Intronic
1067744037 10:48920759-48920781 GAATCTTTTTAAAATTCTGTGGG - Intronic
1068182745 10:53543634-53543656 GCATTTTTTCATACATCTGTTGG + Intergenic
1068408848 10:56628637-56628659 GCATGCCTTTAAACTTCTGTGGG + Intergenic
1068769852 10:60808903-60808925 GGAAGTTTACAAATTTGTGTTGG - Intergenic
1068969278 10:62945979-62946001 GGTACTTTTCAAACTTCTTTTGG - Intergenic
1069972440 10:72183443-72183465 GGCTGGTCTCAAACTTCTCTGGG - Intronic
1070427879 10:76307157-76307179 GGCTGTTTTTAATCTTCTGTGGG + Intronic
1070436253 10:76396918-76396940 GGCTGTTTCAAAACTTCTGGGGG - Intronic
1071996783 10:91157022-91157044 GCAAGTTTTTAAACTTCTCTGGG + Intergenic
1072509031 10:96099914-96099936 GTAATTTTTCAAGCTTCTGTTGG + Intergenic
1072888803 10:99303193-99303215 GGATATTAGCAAAGTTCTGTCGG + Intergenic
1073852786 10:107640613-107640635 GTATGTTTTCATAGTTCTGGAGG + Intergenic
1074625964 10:115186992-115187014 GCATGTTTTCATACATCTGTTGG - Intronic
1075312228 10:121424027-121424049 GTATTTTTTCACAGTTCTGTGGG - Intergenic
1075841903 10:125511961-125511983 AGATATTTTCAAACATCTGAGGG - Intergenic
1077916452 11:6614820-6614842 GGACGTTTTCAAACAACTATGGG - Intronic
1078158013 11:8815358-8815380 GGATGTAGTCACACTGCTGTTGG - Intronic
1079062056 11:17257705-17257727 AGATGTCTTCAAAGTTCTGTAGG + Intronic
1079818961 11:25100196-25100218 GGAAGTTTACAAATTTGTGTTGG - Intergenic
1080295904 11:30727184-30727206 GAAAGTTTACAAATTTCTGTTGG + Intergenic
1080303893 11:30816350-30816372 GGATGGTGTCAAACCTTTGTTGG - Intergenic
1080986329 11:37470982-37471004 GCATCTTTTCAAATGTCTGTTGG - Intergenic
1081163119 11:39775854-39775876 GATTCTTTTCAAAATTCTGTAGG - Intergenic
1081509489 11:43755096-43755118 GTTTGTTTCCAAACTTATGTTGG + Intronic
1083004373 11:59328025-59328047 GGATTTTTTCATATATCTGTTGG + Intergenic
1084836809 11:71807836-71807858 TGATGCTTTCAAACAACTGTAGG - Intergenic
1086009774 11:82086617-82086639 GAATATTTTAAAGCTTCTGTGGG - Intergenic
1086485321 11:87294206-87294228 GGTTGTTTTAAAACATCTCTGGG + Intronic
1086813655 11:91341810-91341832 GAATGTTTTCACACATTTGTTGG - Intergenic
1087590323 11:100178939-100178961 GCATGTTTTCACATTTTTGTGGG + Intronic
1088059955 11:105635538-105635560 GGACATTTTTAAATTTCTGTGGG + Intronic
1089573714 11:119426431-119426453 GGCTGTTTGCATAATTCTGTGGG + Intergenic
1089800942 11:121026428-121026450 GGATGTTGTCTAATTTCAGTAGG + Intronic
1090112142 11:123924280-123924302 GCATTTTTTCATACATCTGTTGG + Intergenic
1091256046 11:134187004-134187026 GGATTTTTTCCCAATTCTGTTGG - Intronic
1092071716 12:5636815-5636837 GGATGTTTTCAGACCTCTGGGGG + Intronic
1092397423 12:8140163-8140185 GGAAGTTTACAAATTTGTGTTGG - Intronic
1093613926 12:21197415-21197437 GGATGTTTGTAAACTTTTGTTGG - Intronic
1094290584 12:28843530-28843552 GCATTTTTTCAAGCATCTGTTGG + Intergenic
1095221367 12:39620070-39620092 GTATATTCTGAAACTTCTGTGGG - Intergenic
1095344877 12:41138617-41138639 GCATTTTTTCATACTTCTGTTGG - Intergenic
1095474416 12:42571420-42571442 GGATGGTGTCACCCTTCTGTAGG - Intronic
1095755270 12:45758320-45758342 GAAAGTTTACAAACTTGTGTTGG - Intronic
1095972490 12:47912156-47912178 TGATGTTTTTAAATATCTGTAGG + Intronic
1097842418 12:64334630-64334652 GTATGATTTCAATCTTCTGTTGG + Intronic
1097890562 12:64773317-64773339 GGAAGTTTTCAAATCTCTGTTGG - Intergenic
1097988936 12:65814243-65814265 GTATTTTTTCATACATCTGTTGG + Intergenic
1098658836 12:73067993-73068015 GGGAGTTTTCAAATCTCTGTTGG + Intergenic
1099094878 12:78362084-78362106 GGCTTTATTCAAACTACTGTTGG + Intergenic
1099279426 12:80624932-80624954 GAAAGTTTACAAATTTCTGTTGG + Intronic
1101140568 12:101791517-101791539 GGAAGTTTACAAATTTGTGTTGG + Intronic
1101911250 12:108861622-108861644 GGCTGGTTTCAAACTCCTGGAGG + Intronic
1102569745 12:113820275-113820297 GGAAGTTTACAAATTTGTGTTGG + Intronic
1105289466 13:19040708-19040730 GTATATTTTCAAAGTTCTTTGGG - Intergenic
1105300722 13:19132350-19132372 GAATTTTTTAAAACTTCTCTTGG + Intergenic
1106110846 13:26775434-26775456 GAGTGTTTTCAAACTGCTGTTGG + Intergenic
1106958738 13:34973457-34973479 GGAAGTTTTCAAATCTTTGTTGG + Intronic
1107772968 13:43808187-43808209 TGATGTTTTTAAAATTCTCTTGG + Intergenic
1107895315 13:44956179-44956201 GGAAGTTTACAAATTTTTGTTGG + Intronic
1108607004 13:52049709-52049731 GAAAGTTTACAAACTTGTGTTGG + Intronic
1109213175 13:59558329-59558351 GCATTTTTTCATACGTCTGTTGG + Intergenic
1109282732 13:60375830-60375852 GCATTTTTTCATACGTCTGTTGG - Intergenic
1110269900 13:73577762-73577784 GGATATTTTCACATTTCTGATGG + Intergenic
1111326877 13:86709597-86709619 CTATGTTTTCTAATTTCTGTTGG - Intergenic
1111344249 13:86927460-86927482 GGATGCTTTCAAACTCATATGGG - Intergenic
1111888544 13:94053282-94053304 GCATTTTTTCAAAGCTCTGTAGG + Intronic
1111911357 13:94315908-94315930 GGATGTTTACGAATTTGTGTTGG - Intronic
1112253366 13:97804710-97804732 GGATATTATTAGACTTCTGTTGG - Intergenic
1112312849 13:98334890-98334912 TGATGTTTTCACAGTTCTGGAGG - Intronic
1112768196 13:102768831-102768853 GTAAGTTTACAAACTTGTGTTGG + Intronic
1112821326 13:103339740-103339762 GCATTTTTTCATACATCTGTTGG + Intergenic
1113336892 13:109385233-109385255 GGAAGTTTTAAAACTCCTGCGGG + Intergenic
1114637941 14:24199012-24199034 GGATGGTTCCAAAGTTCTGTTGG - Intronic
1115635760 14:35288917-35288939 GAATGTTTACAAATTTGTGTTGG - Intronic
1115967790 14:38911805-38911827 GGTAGTTTTCTAATTTCTGTAGG - Intergenic
1116197078 14:41741896-41741918 GGATTTTTTCATATATCTGTTGG - Intronic
1117067347 14:52023717-52023739 GAGTGATTTCAAACTTGTGTTGG - Intronic
1117207542 14:53459618-53459640 AGCTGTTTTCAAACATCTGATGG + Intergenic
1117681106 14:58203717-58203739 GTTTGTTTTCAAAATTCTCTGGG - Intronic
1117914943 14:60667938-60667960 GCATTTTTTCATACATCTGTTGG - Intergenic
1118182049 14:63503513-63503535 AGTTGTTTTCAGACTTCAGTGGG - Intronic
1119148329 14:72335752-72335774 GAATGTTTACAAACTTGTATTGG + Intronic
1119563196 14:75607057-75607079 AGGAGTTTTCAAACTTCAGTGGG - Intronic
1121167094 14:91813603-91813625 GCATGTTTTCCAACTTCTTAGGG - Intronic
1121922171 14:97892234-97892256 GAAAGTTTTCAAATTTGTGTTGG - Intergenic
1123402445 15:20001623-20001645 GGAAGTTTGCAAATTTCTGTCGG - Intergenic
1123511784 15:21008285-21008307 GGAAGTTTGCAAATTTCTGTCGG - Intergenic
1125074056 15:35591995-35592017 AGATGTTTTGGAACCTCTGTTGG + Intergenic
1125377828 15:39052006-39052028 AGATGTTTTCAAAATACTATTGG - Intergenic
1125465664 15:39949309-39949331 GGAGGATTGCAAACTACTGTAGG + Intronic
1125885184 15:43224085-43224107 TTATGTTTTCACCCTTCTGTAGG + Intergenic
1126830036 15:52592703-52592725 GAATGTTTACAAATTTGTGTTGG + Intronic
1129157927 15:73730466-73730488 TGCTGTTTTTAAACTACTGTAGG + Intergenic
1129970738 15:79775748-79775770 GGATGTATACAAGCTGCTGTGGG + Intergenic
1130018137 15:80202959-80202981 GGATGATTTGCAACTTCTCTGGG + Intergenic
1130440821 15:83952343-83952365 GAGTGTTTTAAGACTTCTGTAGG + Intronic
1130516972 15:84633204-84633226 GGAAGTGGTCAAAATTCTGTAGG - Intergenic
1130858838 15:87867454-87867476 GGATGTTTGCAAACTTGTTCAGG + Intronic
1133461685 16:5991675-5991697 GGAAGTTCTATAACTTCTGTGGG + Intergenic
1135477394 16:22788877-22788899 GGTTGGTCTCAAACTCCTGTAGG - Intergenic
1135902251 16:26472765-26472787 GCATTTTTTCATACATCTGTTGG - Intergenic
1137287480 16:47028094-47028116 GGCTGTTTTCAAATTTTTGTAGG + Intergenic
1137356459 16:47770420-47770442 GAATTTTTTCACATTTCTGTTGG + Intergenic
1137829585 16:51531263-51531285 GCTTCTTTTCAAACTTTTGTGGG - Intergenic
1138170087 16:54840727-54840749 GGAGGTCTTAAAACTTCTGCAGG + Intergenic
1138308222 16:55998456-55998478 GGATTTTTTCATACACCTGTTGG + Intergenic
1138652631 16:58469960-58469982 ATATGTTTTGAAACATCTGTTGG - Intronic
1138765673 16:59600001-59600023 GTATGTTTTCAAACTTCATCTGG - Intergenic
1139147913 16:64345067-64345089 GGATGTGTTCAGCCTTCTGGTGG - Intergenic
1140035105 16:71365849-71365871 GGGTGTTTTCAAAGCTCTGCAGG - Intronic
1141038771 16:80654006-80654028 GGAGATTTTCCAACTTCCGTTGG - Intronic
1141284018 16:82654407-82654429 GAATGTTTGAAAACTTCTCTTGG + Intronic
1141450743 16:84099872-84099894 TTGTGTATTCAAACTTCTGTAGG - Intronic
1144009408 17:11132095-11132117 GCATTTTTTCAAATATCTGTTGG + Intergenic
1144118306 17:12123468-12123490 TGATCTTTTCAAAGTACTGTTGG + Intronic
1144877017 17:18403316-18403338 GGAAGTTTACAAATTTGTGTTGG + Intergenic
1145155213 17:20541092-20541114 GGAAGTTTACAAATTTGTGTTGG - Intergenic
1146018324 17:29251351-29251373 GGAAGTTTACAAATTTGTGTTGG + Intronic
1146769770 17:35557943-35557965 AGATCTTTTCAAACAGCTGTTGG + Exonic
1149077536 17:52614557-52614579 GTATGTTTTTAAATTTCTTTAGG + Intergenic
1151264010 17:72939692-72939714 GGAAATTTTCTAACTTCTTTTGG - Intronic
1151746198 17:76013225-76013247 GGATGTTTTAAAAGCTCTCTGGG + Intronic
1152213988 17:79021726-79021748 GGATGCTACCAAACTTCAGTGGG - Intergenic
1152228212 17:79102388-79102410 GGAGGTTTCCAGACTTCTGAAGG - Intronic
1153602586 18:6795880-6795902 GTATGTTTTAAAACTTCCCTTGG - Intronic
1153929354 18:9865189-9865211 GGATGTGTTGAAGCTTCTGGAGG + Intergenic
1154379748 18:13838375-13838397 GGTGGTTTTCAAACTTCAGGTGG + Intergenic
1155599476 18:27528420-27528442 GGATGTTTGCATCCATCTGTTGG - Intergenic
1155765938 18:29632729-29632751 GGATTTTTTCATATTCCTGTTGG + Intergenic
1156317527 18:35984493-35984515 GGATGCCTTCAAAGTTCTGATGG - Intronic
1156700018 18:39814862-39814884 GGAAGTTTTCAAACCTCTGTTGG + Intergenic
1156837352 18:41570116-41570138 AGATGTGTTCAAGCTGCTGTTGG - Intergenic
1156962779 18:43052981-43053003 GTAAGTTTTCAAACCTCTCTGGG - Intronic
1157002888 18:43548487-43548509 AGATGTTTCCAAGCTTCTTTTGG - Intergenic
1157854216 18:51090093-51090115 GTACGTTTTCATACTTCTCTGGG - Intergenic
1158240163 18:55368545-55368567 GAAAGTTTTCAAATTTGTGTTGG + Intronic
1158564048 18:58539214-58539236 GGATGTTTATAAGCTTCTCTAGG - Intronic
1159988678 18:74876446-74876468 GGAAGTATTCAAGGTTCTGTTGG + Intronic
1162859401 19:13494778-13494800 TGATGGTTTTAAACTTGTGTGGG - Intronic
1163516534 19:17767343-17767365 GGCTGGTCTCAAACTCCTGTAGG - Intronic
1164248147 19:23452511-23452533 GCATTTTTTCATACGTCTGTTGG + Intergenic
1164391092 19:27822069-27822091 GAAAGTTTTCAAACTTCTGTTGG + Intergenic
1165028079 19:32976565-32976587 GGATGCTTGGAAACTTCTGGAGG - Exonic
1165556809 19:36640888-36640910 TGAAGTTTTAAAATTTCTGTGGG - Intronic
1167108352 19:47444424-47444446 GGATATTTTCAATTTTCTGTGGG + Intronic
1168222739 19:54972667-54972689 GGCTGGTCTCGAACTTCTGTGGG + Intronic
926421796 2:12707266-12707288 GGAAGTTTACAAATTTGTGTTGG + Intergenic
928553815 2:32401364-32401386 GGATGTTTCCAAACTTATGAAGG + Exonic
929345244 2:40874564-40874586 AGATCTTTTCAAACTTATGATGG + Intergenic
930141720 2:47957414-47957436 GGCTGTTTTCTACATTCTGTAGG - Intergenic
930216542 2:48703032-48703054 GGATTTTTTCACAGGTCTGTTGG + Intronic
930219157 2:48728050-48728072 GAAAGTTTACAAACTTCTATTGG - Intronic
930474975 2:51870137-51870159 GCATTTTTTCATATTTCTGTTGG + Intergenic
930532372 2:52605865-52605887 GCATGTTCTTACACTTCTGTGGG - Intergenic
930586001 2:53267823-53267845 GGAAGTTTTCAAATCTCTGTTGG - Intergenic
930718186 2:54613006-54613028 GCAAGGTTTCAAATTTCTGTGGG - Intronic
930750463 2:54929504-54929526 AGATGTTTTAATAATTCTGTTGG + Intronic
931356455 2:61541153-61541175 GGCTGATCTCAAACTCCTGTAGG + Intergenic
931382561 2:61767020-61767042 GTATTTTTTCACAGTTCTGTAGG + Intergenic
931963246 2:67504770-67504792 TGATGTTTTCACACACCTGTAGG + Intergenic
932345448 2:70992334-70992356 GGCTGGTCTCAAACTTCTGATGG + Intronic
933348819 2:81126924-81126946 GGCTGTTTTCTAGATTCTGTAGG + Intergenic
933366230 2:81357725-81357747 GGATTTTTTCAAGTATCTGTTGG + Intergenic
934016848 2:87896617-87896639 GGATGTTTAATAACTTCTTTGGG - Intergenic
935782417 2:106519821-106519843 GGAAGTTTACAAATTTGTGTTGG + Intergenic
937345382 2:121122303-121122325 GGATCTTTTCACACCTATGTGGG - Intergenic
937423554 2:121778389-121778411 GGATGGTTCCCCACTTCTGTAGG + Intergenic
937552020 2:123106451-123106473 GGCTGTTTTCTAGATTCTGTAGG + Intergenic
939831185 2:147072962-147072984 GCATGTTTTCATATTTTTGTTGG + Intergenic
940546083 2:155087240-155087262 GAATGTTTTCGTATTTCTGTGGG + Intergenic
940756686 2:157691105-157691127 GTATGTTTTCATATGTCTGTTGG + Intergenic
941318708 2:164027853-164027875 GCATGTTTTCATACACCTGTTGG - Intergenic
941332731 2:164198920-164198942 GGATGTTTTTAATCTTTTGTGGG + Intergenic
942300301 2:174554862-174554884 GGATGTGATCCAACTTCTTTTGG - Intergenic
942876991 2:180812588-180812610 GCGTGTTTTCATACATCTGTTGG + Intergenic
942894492 2:181035641-181035663 GGAAGTTTTCGAATTTGTGTTGG - Intronic
942926334 2:181437505-181437527 AGATGTTTACAGACTGCTGTGGG - Intergenic
943775473 2:191761164-191761186 GAATGCTTTCAGACTTCTGACGG + Intergenic
944102392 2:196041942-196041964 GCAAGTTTTCACACATCTGTTGG - Intronic
944164224 2:196701114-196701136 TGATTTTTTCCACCTTCTGTTGG - Exonic
944908446 2:204285765-204285787 GGAAGTTTACAAATTTGTGTTGG - Intergenic
945343989 2:208691068-208691090 GGAAGTTATCAAACTTATGATGG + Intronic
945552238 2:211234737-211234759 GCATATTTTCTAACTTCTCTGGG - Intergenic
945605846 2:211929441-211929463 TGATGTTTTCAAATTGCTCTAGG - Intronic
945729646 2:213518177-213518199 GCATGTTTTCATATGTCTGTTGG - Intronic
947158255 2:227185647-227185669 GAATGTTTTCTCTCTTCTGTGGG - Intronic
947628741 2:231637810-231637832 GGATGTTTCCAAGCCTGTGTTGG - Intergenic
948053882 2:234997168-234997190 GGATGGTCTCTAACTGCTGTGGG - Intronic
1168793995 20:598845-598867 GGATATTTTCCATCGTCTGTTGG + Intergenic
1169668202 20:8063896-8063918 GGAAATTCTCAATCTTCTGTGGG + Intergenic
1169821260 20:9713242-9713264 GCATTTTTTCAAACACCTGTTGG - Intronic
1170686345 20:18573129-18573151 TGATGCTTTCAAAATTCTGAGGG - Intronic
1171574063 20:26283391-26283413 GGATGTTTCAAAACTGCTCTAGG - Intergenic
1171727798 20:28641520-28641542 GAATGTTTACAAATTTGTGTTGG - Intergenic
1173048330 20:39534331-39534353 GGATCTTTTCAAACTGCTGGTGG - Intergenic
1173890079 20:46500443-46500465 GTATGTTTTCAAAAATCTCTTGG - Exonic
1174999854 20:55615586-55615608 AAATGTTTGCAGACTTCTGTAGG + Intergenic
1175123982 20:56738055-56738077 GGGTGGTTTCAAAGTCCTGTGGG - Intergenic
1178247390 21:30967176-30967198 GGATTTTTTCATAGTTCTGGAGG + Intergenic
1181322852 22:22022111-22022133 TGATGGTTTCAAACATGTGTAGG - Intergenic
1181682372 22:24504354-24504376 CAATGTGTTCAAACTTCTGAAGG - Intronic
1184108597 22:42382716-42382738 GAATGTTCTGAGACTTCTGTGGG - Exonic
949091476 3:34301-34323 GAATGTTTACAAACTTATGTTGG - Intergenic
950923372 3:16716855-16716877 GGAGGTTTTCAAAACTCTGTTGG + Intergenic
951866013 3:27308556-27308578 GAACGTTTTCAAACATCTGTGGG - Intronic
952097782 3:29974606-29974628 GGATTTTTTTATACTTTTGTGGG - Intronic
952874608 3:37933630-37933652 GCAAGTTTTCTAACTTCTCTGGG + Intronic
954695238 3:52420993-52421015 GGATGTTCTCAACACTCTGTTGG - Exonic
955088707 3:55728649-55728671 AGCTGTTTTCAAACTTCAGTGGG - Intronic
955173793 3:56591530-56591552 GGAAGTTTACAAATTTGTGTTGG + Intronic
955964670 3:64376507-64376529 GGATTTTTTCATATATCTGTTGG - Intronic
956436225 3:69237074-69237096 GTAAGTTTTCAAACTTCAGTGGG - Intronic
957002544 3:74902872-74902894 ACATATTTTCATACTTCTGTAGG + Intergenic
957031795 3:75250523-75250545 GAATGTTTACAAACTTATGTTGG - Intergenic
957035926 3:75292890-75292912 GGATGCCATCAACCTTCTGTGGG - Intergenic
957584649 3:82118289-82118311 GCATTTTTTCACACGTCTGTTGG - Intergenic
957599129 3:82309349-82309371 GCATGTTTTCCTACATCTGTTGG - Intergenic
957700041 3:83698384-83698406 GCATATTTTCAAATATCTGTTGG - Intergenic
958783398 3:98569917-98569939 GCATGTTTTCATATGTCTGTTGG + Intronic
960706667 3:120489001-120489023 GGCTGTTTGTAAACTTCAGTAGG + Intergenic
960779053 3:121297316-121297338 GCATGTTTTCTAATTTCTGATGG - Intronic
961228560 3:125278232-125278254 GGATGTTTAGAAAGTTCTGAAGG - Intronic
962621917 3:137188788-137188810 CAATGTTTTCAAACATCTGAGGG - Intergenic
963056967 3:141193852-141193874 GGGAGTTTTCAAATCTCTGTTGG - Intergenic
963057073 3:141194439-141194461 GGGAGTTTTCAAATCTCTGTTGG - Intergenic
963057129 3:141194707-141194729 GGGAGTTTTCAAATTTCTGCAGG - Intergenic
963362560 3:144293954-144293976 GTATGTTTTCTAATATCTGTAGG + Intergenic
964181173 3:153888163-153888185 AGTTGTTTCCAAACTTGTGTGGG - Intergenic
964699048 3:159542933-159542955 GGATCTTTTCCAAATTCTTTTGG + Intronic
966100327 3:176261232-176261254 TGATGTATTCAAAATGCTGTAGG - Intergenic
966139294 3:176736430-176736452 GGAAGTTTACAAATTTGTGTTGG - Intergenic
966269782 3:178090833-178090855 GGAAGTTTTCAAATCTCTTTTGG - Intergenic
967071081 3:185962798-185962820 GGAGGTTTTAAAAGTTGTGTTGG + Intergenic
970459977 4:16264706-16264728 GTATCTTTTAAAACTTCTTTTGG + Intergenic
971107380 4:23541887-23541909 GGAAGTTTTCAAGCCTCTGTTGG - Intergenic
972017042 4:34260740-34260762 AGATATTTTCAATCTGCTGTTGG + Intergenic
973171502 4:47149900-47149922 GCATCTGTTCTAACTTCTGTTGG - Intronic
973313270 4:48732156-48732178 GCATTTTTTCAAATGTCTGTTGG - Intronic
974078034 4:57185381-57185403 GGGTGTGATCAAACTTCTGCTGG + Intergenic
974331560 4:60485789-60485811 AGATGTTAGAAAACTTCTGTAGG - Intergenic
975036501 4:69690606-69690628 GCATGTTTTCACTCTTATGTTGG - Intergenic
975227179 4:71887660-71887682 GCATTCTTTCAAATTTCTGTTGG + Intergenic
975272900 4:72458539-72458561 GGATGTTTTAAAACTTTCTTAGG + Intronic
975998409 4:80342221-80342243 GTATGTTTTCAAACTTGGTTCGG - Intronic
976173593 4:82330101-82330123 GAATGCTTTCAAAGTTCTGAGGG + Intergenic
976453778 4:85222295-85222317 GGCTGTTTTCTAGATTCTGTAGG + Intergenic
978113249 4:104988107-104988129 GGATGTTTCTTAACTTCTCTGGG + Intergenic
978418878 4:108508460-108508482 GCATGTTTTCATATGTCTGTTGG - Intergenic
978424221 4:108565558-108565580 GAAAGTTTGCAAATTTCTGTTGG + Intergenic
979044940 4:115851525-115851547 GGGTGGTTTGAAACCTCTGTTGG - Intergenic
979465252 4:121029972-121029994 GCATTTTCTTAAACTTCTGTGGG - Intergenic
979912763 4:126390429-126390451 GCATGTTTTCACTCTTCTGTGGG - Intergenic
979968478 4:127106064-127106086 GGGAGTTTTCAAATTTCTATAGG - Intergenic
980105440 4:128583950-128583972 GTATGTTCTCAAACAGCTGTTGG + Intergenic
980109306 4:128619937-128619959 GCATTTTTTCATATTTCTGTTGG - Intergenic
980414706 4:132470884-132470906 GCATTTTTTCATACTTCTATGGG - Intergenic
981468528 4:145101668-145101690 GGATGTTTTATAGCTTCAGTGGG + Intronic
983572147 4:169221525-169221547 TAATGTTTTCAAACTTTTCTCGG - Intronic
984511153 4:180680382-180680404 GGATTTTTTTAAACATCTTTAGG + Intergenic
985432762 4:189897344-189897366 GAATGTTTACAAATTTGTGTTGG + Intergenic
986463762 5:7999823-7999845 GCATTTTTTCAAACATCTGTTGG + Intergenic
987012186 5:13778801-13778823 AGATGTTATCAAACTTCTAAAGG - Intronic
987686047 5:21203229-21203251 GCATCTTTTCATACTTTTGTTGG + Intergenic
989048998 5:37300147-37300169 TCATTTTTTCAAATTTCTGTGGG + Intronic
989501131 5:42169640-42169662 TCATGTTTTCACACTTCTCTTGG - Intergenic
990285862 5:54300083-54300105 GCATGTTTTAAAACCACTGTAGG - Intronic
990636218 5:57730784-57730806 GGATGTTTTCTAATGTCTGATGG + Intergenic
990848390 5:60172317-60172339 GAACGTATTCAGACTTCTGTGGG + Intronic
991961996 5:72054325-72054347 GCATTTTTTCATACATCTGTTGG - Intergenic
992295733 5:75324719-75324741 TGATGTTTTCTAACCTCTGTTGG - Intergenic
992950378 5:81852090-81852112 TGATGTTGACAAACTTCTGGTGG - Intergenic
993397434 5:87407812-87407834 AGTTGTTTTCAAACTTCAGTGGG - Intronic
993552074 5:89285617-89285639 AGTGGTTTTCAAACTTCTTTGGG - Intergenic
993692601 5:91021039-91021061 ATATGTTTTCAAATTTCAGTAGG + Intronic
993897890 5:93560235-93560257 GGATTTTTTTACACTTCTCTTGG + Intergenic
993986193 5:94600903-94600925 GGAAATTTTCAAACCTCTGTGGG - Intronic
996212323 5:120826603-120826625 GGATGTTTTGAAATTTATGCTGG - Intergenic
996425826 5:123312866-123312888 GGAAGTTTTCAGATCTCTGTTGG + Intergenic
997106657 5:131028375-131028397 GGATGTTTTCATACCTTTTTTGG - Intergenic
997568746 5:134909343-134909365 GGATTTTATCTAACTTCTGGGGG - Intronic
997871383 5:137508246-137508268 GCATCTTTTCATACATCTGTTGG + Intronic
998475581 5:142418631-142418653 GCATGTTTTCATACACCTGTTGG + Intergenic
998986406 5:147762758-147762780 GGTTGTTTCCCAATTTCTGTTGG + Intronic
999174368 5:149621583-149621605 GCATGTTATCTAACTTCTCTGGG - Intronic
999948127 5:156619424-156619446 GTGTGTTTTCAAGCATCTGTTGG + Intronic
1000503460 5:162082471-162082493 GAATGTTTTCAAATTTCATTGGG + Intronic
1001769423 5:174281926-174281948 GGATGTTTTAAAATATTTGTGGG - Intergenic
1003773478 6:9334336-9334358 GCACGTTTTCCAACTTCTCTCGG - Intergenic
1003787508 6:9503633-9503655 GGATTTTTTCACATCTCTGTGGG - Intergenic
1003862478 6:10335192-10335214 GCATGTTATCTAACTTCTTTAGG - Intergenic
1004399039 6:15271490-15271512 AATAGTTTTCAAACTTCTGTTGG - Intronic
1004444868 6:15688768-15688790 GAATATTTTCAATCTACTGTTGG + Intergenic
1004792041 6:19037261-19037283 GTATTTTTTCAAAATTCTGGAGG + Intergenic
1004982150 6:21037208-21037230 AATTGTTTTCAAACTTCTGTGGG - Intronic
1005084781 6:21993785-21993807 GGCTGGTTTCAAAGGTCTGTTGG + Intergenic
1006660889 6:35643139-35643161 GGATGTTTTCAAAGTTGTGAAGG - Intronic
1007215599 6:40235043-40235065 GGGAGGTTTCAAATTTCTGTTGG - Intergenic
1008173083 6:48233831-48233853 GGGAGTTTTGAAACCTCTGTTGG - Intergenic
1009643931 6:66373044-66373066 GGAAACTTTCAAACCTCTGTTGG + Intergenic
1010246867 6:73668784-73668806 GCATGTTTTCAAATATCTGCTGG + Intergenic
1010583575 6:77629123-77629145 GCATTTTTTCATACATCTGTTGG + Intergenic
1010903296 6:81454278-81454300 GAATGTTTACAAATTTGTGTTGG - Intergenic
1011256307 6:85425002-85425024 GGATTTTTTCATACGTTTGTTGG - Intergenic
1011297808 6:85842203-85842225 GCATTTTTTCAAATGTCTGTTGG + Intergenic
1011616097 6:89199616-89199638 GGATGTTTTCAAACTTCTGTTGG - Intronic
1011828477 6:91339533-91339555 GCATTTTTTCAAATGTCTGTTGG - Intergenic
1011943632 6:92873601-92873623 GGATGAATTCAAACTCCAGTAGG - Intergenic
1013326601 6:109051195-109051217 TGATGGTTTAAAACTTCTTTTGG + Intronic
1013533760 6:111044233-111044255 GGACATTTTAAAACTTCTTTAGG + Intergenic
1013997196 6:116322435-116322457 GGATGTTCCCAAAGGTCTGTAGG + Intronic
1015745351 6:136504067-136504089 GGGTATTTTAAAACTTCAGTAGG + Intronic
1016275873 6:142351762-142351784 GGATATTTTCTCCCTTCTGTAGG - Intronic
1016569628 6:145497698-145497720 GGAAATTTTCAAACCTCAGTTGG + Intergenic
1017580707 6:155861641-155861663 GCATGTTTTCATACGTCTGTTGG + Intergenic
1018019271 6:159743410-159743432 AGATGTTTTCTGTCTTCTGTTGG + Intronic
1018459325 6:163982654-163982676 GGATGTTCTCGATCTCCTGTTGG - Intergenic
1018666583 6:166143877-166143899 GAAAGTTTACAAACTTGTGTTGG - Intergenic
1020761598 7:12273790-12273812 GCATGTTTTCACTCTTATGTGGG - Intergenic
1021284880 7:18769057-18769079 GGACATTTTCAAACTACAGTGGG + Intronic
1021391395 7:20097342-20097364 GGATGTTTTCATATACCTGTTGG - Intergenic
1021401332 7:20212866-20212888 GGGAGTTTTCAAATTTCTGTAGG + Intronic
1023612516 7:41985345-41985367 CGATAATTTGAAACTTCTGTGGG + Intronic
1024725689 7:52191318-52191340 GAAAGTTTACAAATTTCTGTTGG - Intergenic
1024856760 7:53791448-53791470 GCATGTTTTCATACGTCTGTTGG + Intergenic
1025993929 7:66516265-66516287 GTATGTTTTCACACATCTGATGG - Intergenic
1027612696 7:80381535-80381557 ACATGTTTTCAAAGTTCTCTAGG + Intronic
1029052084 7:97700074-97700096 GGGAGGTTTCAAATTTCTGTGGG - Intergenic
1030062378 7:105633085-105633107 AAATGTCTTCAAAATTCTGTAGG + Intronic
1030149237 7:106386280-106386302 GGATATTTTCAAACTTATGATGG - Intergenic
1030218163 7:107067963-107067985 GGATGTTTTAAAAGTTATGCAGG + Intronic
1030998986 7:116392931-116392953 GGATCTTTTCATTCTACTGTAGG + Intronic
1031291918 7:119949144-119949166 GGGAGTTTTCAAATCTCTGTAGG - Intergenic
1031353682 7:120764729-120764751 GCATGTTTTCACATATCTGTTGG + Intergenic
1031652133 7:124303905-124303927 GCAGGATTTCAGACTTCTGTGGG + Intergenic
1031735476 7:125354275-125354297 GGAAGTTTACAAATTTGTGTTGG + Intergenic
1031874725 7:127125856-127125878 GTATTTTTTCAAATGTCTGTTGG - Intronic
1031896869 7:127360256-127360278 GCATTTTTTCAAAATTTTGTAGG + Intronic
1032526138 7:132579260-132579282 GACTCCTTTCAAACTTCTGTTGG + Intronic
1033297295 7:140151901-140151923 GTATATATTCAATCTTCTGTAGG - Intronic
1033673352 7:143513598-143513620 GGATGTTTTCAGTCTTCTAATGG + Intergenic
1034953134 7:155314672-155314694 GCATTTTTTCATACGTCTGTTGG - Intergenic
1036104029 8:5820655-5820677 GGATGACTACAAACTTCTCTAGG - Intergenic
1037337723 8:17807811-17807833 AGAGTTTTTCAAACTTCTGCAGG - Intergenic
1037771897 8:21806188-21806210 GGAGGGTCTCAAACTTCTGATGG + Intronic
1037847713 8:22298623-22298645 GGAAGTTTTCAAAATTATCTTGG + Intronic
1037871413 8:22500829-22500851 GGAAGTTTTAAATCTACTGTTGG + Intronic
1038697856 8:29821937-29821959 GTATGCTGTCAAATTTCTGTTGG + Intergenic
1040451243 8:47549530-47549552 GCATGTTTTCATATGTCTGTTGG + Intronic
1040650843 8:49447462-49447484 GAAAGTTTACAAACTTGTGTTGG + Intergenic
1040809903 8:51440420-51440442 GGATTTTTTTAAATTTCAGTAGG - Intronic
1041568090 8:59303546-59303568 GGAAGTTCTCAACCTTCTATGGG - Intergenic
1042451320 8:68950234-68950256 GAAAGTTTGCAAACTTGTGTTGG + Intergenic
1043128956 8:76437183-76437205 GCATTTTTTCAAATGTCTGTTGG + Intergenic
1043301870 8:78744242-78744264 GGGAGTTTTCAAATCTCTGTAGG + Intronic
1043770730 8:84196684-84196706 TCATGTTTTCAAACTCCTTTTGG + Intronic
1044001862 8:86892841-86892863 GAATGTTTTGATAATTCTGTTGG + Intronic
1044033733 8:87271520-87271542 GAATGTTGTTTAACTTCTGTGGG + Intronic
1045139475 8:99264523-99264545 TGATGCTTTCAGATTTCTGTAGG - Intronic
1045258593 8:100551287-100551309 GGCTGTTTTCAGACTTCTCAGGG + Intronic
1045743177 8:105386507-105386529 GGATGTGTTCAGCCTTCTGGTGG + Intronic
1046117531 8:109802000-109802022 GTAGGTTTTCAATCATCTGTTGG + Intergenic
1046490096 8:114940579-114940601 TGTTCTTTTCATACTTCTGTTGG - Intergenic
1048750858 8:137673182-137673204 GCATGTTTTCAAAATTCAGCTGG - Intergenic
1050706644 9:8407071-8407093 ACATGTTTTCAGCCTTCTGTAGG + Intronic
1050791297 9:9473735-9473757 GCATTTTTTCAAATATCTGTTGG + Intronic
1052257844 9:26480192-26480214 GCATTTTTTCAAATGTCTGTTGG + Intergenic
1053138823 9:35669166-35669188 GGATTTTTTCACAGTTCTGGAGG - Intronic
1053529534 9:38866059-38866081 GGATTTTTTCAAATACCTGTAGG - Intergenic
1053721941 9:40955563-40955585 GAATGTTTACAAATTTGTGTTGG + Intergenic
1054201760 9:62090486-62090508 GGATTTTTTCAAATACCTGTAGG - Intergenic
1054344025 9:63896425-63896447 GAATGTTTACAAATTTGTGTTGG - Intergenic
1054636598 9:67497873-67497895 GGATTTTTTCAAATACCTGTAGG + Intergenic
1055143108 9:72899163-72899185 AGAGTTTTTCAAACTTATGTTGG - Intergenic
1056136325 9:83632609-83632631 GGAAGTTTACAAATTTATGTTGG + Intronic
1056641337 9:88373536-88373558 GGATGCTTTTAAACTTATTTTGG + Intergenic
1056856469 9:90134170-90134192 GCATGTTGACAAACTTCTGGAGG + Intergenic
1057967463 9:99518023-99518045 GTATTTTTTCACATTTCTGTAGG - Intergenic
1058198732 9:102011689-102011711 GGATTTTTTTAAATTTCTCTAGG - Intergenic
1058563693 9:106258075-106258097 GCATTTTTTCATACGTCTGTTGG + Intergenic
1058571916 9:106355807-106355829 GGATTTTTTAAAATTTCTGTGGG + Intergenic
1062714955 9:138004865-138004887 GTATTTTTTCATACATCTGTTGG - Intronic
1203453228 Un_GL000219v1:140438-140460 GAATGTTTACAAATTTGTGTTGG - Intergenic
1203373196 Un_KI270442v1:333096-333118 GCATTTTTTGAAACTTCTTTGGG + Intergenic
1203421189 Un_KI270448v1:7823-7845 GAATGTTTACAAATTTGTGTTGG + Intergenic
1203421762 Un_KI270521v1:7339-7361 GAATGTTTACAAATTTGTGTTGG + Intergenic
1203538126 Un_KI270743v1:61651-61673 GCATGTTCTCACACTTTTGTGGG - Intergenic
1186743794 X:12545217-12545239 GAATGTTTACAAATTTGTGTTGG - Intronic
1186775111 X:12856974-12856996 GAATGTTTACAAATTTGTGTTGG + Intergenic
1186813161 X:13209751-13209773 GCATTTTTTCATACGTCTGTTGG - Intergenic
1187037454 X:15556547-15556569 CAATGTTTTCAAACTTCAGTAGG + Intergenic
1187436991 X:19280514-19280536 GGATCTTTTCATACTTGTATTGG - Intergenic
1188466380 X:30486324-30486346 GTATTTTTTCATACGTCTGTTGG + Intergenic
1188882141 X:35502014-35502036 AGAAGTTTTGAACCTTCTGTAGG + Intergenic
1189831065 X:44973543-44973565 CAATGTTTTCAAAATTCTGAAGG - Intronic
1193135429 X:77966166-77966188 GAATGTTTTAAAACTGGTGTTGG + Intronic
1193274488 X:79570151-79570173 GGCAGTTTTCAAACCACTGTTGG + Intergenic
1193515374 X:82455577-82455599 GCATTTTTTCATATTTCTGTTGG - Intergenic
1193712330 X:84894563-84894585 GGGAGTTTTCAAATTACTGTTGG + Intergenic
1193779484 X:85684877-85684899 GCATTTTTTCATACATCTGTTGG + Intergenic
1194188657 X:90807761-90807783 AGGAGTTTTCAAATTTCTGTAGG + Intergenic
1194188750 X:90808299-90808321 GAGAGTTTTCAAACTTCTGTTGG + Intergenic
1194671267 X:96735980-96736002 GGATGATATGAAAATTCTGTTGG - Intronic
1195115551 X:101694926-101694948 GAATATTTTCAATCTTCAGTTGG + Intergenic
1195428129 X:104758483-104758505 GGCTTTTCTCAAACTTCTTTTGG + Intronic
1195558517 X:106255600-106255622 GAATGTTTTAAGACTTCTTTTGG + Intergenic
1196159497 X:112467196-112467218 GCATTTTTTCATACGTCTGTTGG - Intergenic
1196468017 X:115992888-115992910 GGCTGTTTTCTACATTCTGTAGG - Intergenic
1196625513 X:117872822-117872844 GGCTGTTTTATAGCTTCTGTAGG - Intergenic
1196631449 X:117944741-117944763 GGACATTTTCTGACTTCTGTGGG - Intronic
1196669884 X:118354582-118354604 AGATTTTTTGAAACTTCTGAGGG + Intronic
1197842257 X:130761431-130761453 GTATGTTGTCAAATTTATGTAGG + Intronic
1198106404 X:133465889-133465911 GGATTTTTTCAAATGTTTGTTGG + Intergenic
1198600359 X:138277850-138277872 GCATTTTTTCACACATCTGTTGG + Intergenic
1198648729 X:138837862-138837884 GGGAGTTTTCAAATCTCTGTTGG + Intronic
1198702406 X:139412438-139412460 GGCTGTTTTCTAAATCCTGTAGG + Intergenic
1198790325 X:140338555-140338577 GTATGTTTACAACCTTCAGTTGG - Intergenic
1198810260 X:140528877-140528899 AGATGTTTTCAACTTTCTGTAGG - Intergenic
1199127635 X:144141923-144141945 GGATGTTTAATAACTTCTTTGGG + Intergenic
1199293530 X:146131791-146131813 GACTGTTTTCAAACTTCTGCTGG - Intergenic
1199416541 X:147589764-147589786 GCATGTTTTCATACATCTGTTGG - Intergenic
1200290842 X:154871928-154871950 GCATTTTTTCAAATGTCTGTTGG - Intronic
1200535241 Y:4389656-4389678 AGGAGTTTTCAAATTTCTGTAGG + Intergenic
1200535332 Y:4390196-4390218 GAGAGTTTTCAAACTTCTGTTGG + Intergenic
1201967562 Y:19754740-19754762 GGAAGTTTTCAAACCTCTCTTGG + Intergenic
1202192098 Y:22255985-22256007 GTATTTTTTCATATTTCTGTTGG + Intergenic