ID: 1011616100

View in Genome Browser
Species Human (GRCh38)
Location 6:89199645-89199667
Sequence GGTTATATATGCTCATCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011616097_1011616100 6 Left 1011616097 6:89199616-89199638 CCAACAGAAGTTTGAAAACATCC 0: 1
1: 0
2: 2
3: 49
4: 423
Right 1011616100 6:89199645-89199667 GGTTATATATGCTCATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011616100 Original CRISPR GGTTATATATGCTCATCTGA AGG Intronic
No off target data available for this crispr