ID: 1011618422

View in Genome Browser
Species Human (GRCh38)
Location 6:89219493-89219515
Sequence AATAACAAGGAGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1528
Summary {0: 1, 1: 1, 2: 22, 3: 177, 4: 1327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011618419_1011618422 21 Left 1011618419 6:89219449-89219471 CCAGCTTTTTTCTGTGATCAAGA 0: 1
1: 0
2: 1
3: 28
4: 283
Right 1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG 0: 1
1: 1
2: 22
3: 177
4: 1327
1011618418_1011618422 22 Left 1011618418 6:89219448-89219470 CCCAGCTTTTTTCTGTGATCAAG 0: 1
1: 0
2: 1
3: 15
4: 230
Right 1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG 0: 1
1: 1
2: 22
3: 177
4: 1327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011618422 Original CRISPR AATAACAAGGAGAAGGAAGA TGG Intronic
900253941 1:1687075-1687097 AATAAAAAGAAGAAAGAAGATGG + Intronic
900792107 1:4687531-4687553 AATAAGACAGAGAAGGAACAAGG + Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901136705 1:7001789-7001811 AATGTCAAGAAGAAGGAAGGTGG - Intronic
901258820 1:7856345-7856367 AATAACAAGGAGACAGTACAGGG + Intergenic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901383340 1:8889947-8889969 AATAACAACGACAAGAAACAAGG + Intergenic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
901796758 1:11684018-11684040 AATCACAAACAGAAGGAAGGTGG + Intronic
902069838 1:13724833-13724855 AAAAGGAAGGAGGAGGAAGAGGG + Intronic
902139703 1:14342655-14342677 AATAAAAAAGAAAGGGAAGAAGG + Intergenic
902150524 1:14439227-14439249 AATACAAAAGAGAAGGAGGAAGG - Intergenic
902325300 1:15696240-15696262 AACACCATGGAGAAGGAAAAGGG - Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902586119 1:17439400-17439422 AATAAAAAGAGGAAGGAAGGCGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902756175 1:18550645-18550667 AATAACAAGGAACACGCAGAGGG + Intergenic
903000835 1:20264497-20264519 AAGAACAGAGAGAGGGAAGAGGG - Intergenic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903339424 1:22644422-22644444 GGTAAGGAGGAGAAGGAAGATGG - Intronic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903609176 1:24597502-24597524 AAAAAGAAAGAGAAGGAAGGGGG + Intronic
903875382 1:26470301-26470323 AAAAAAAAGAAGAAGGAAAATGG - Exonic
904225659 1:29016156-29016178 AACAACAAAAAGAAGGAACATGG - Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904755459 1:32766288-32766310 AATTCCTAGGAGAAGGAAGGAGG - Intronic
904821886 1:33250751-33250773 AAAAAAAAGAAGAAAGAAGAAGG + Intergenic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905319102 1:37103126-37103148 AAAGACAAGAAGGAGGAAGAGGG + Intergenic
905456602 1:38092427-38092449 CCTGTCAAGGAGAAGGAAGAAGG - Intergenic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905741493 1:40374642-40374664 AATGACGAGGAGGAGGAGGAGGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180864 1:43817668-43817690 AGAAGGAAGGAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906485871 1:46234573-46234595 AATATAAAGTAGAAGGAAGGAGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906723521 1:48026623-48026645 AATAAGAGGGAGTAGGAAGAAGG - Intergenic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
907770500 1:57457787-57457809 AGTAAGAAAGAGAAAGAAGATGG + Intronic
907829784 1:58053746-58053768 CATAACTAGGAAAGGGAAGAAGG - Intronic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908871111 1:68613733-68613755 GATAACTAGAAGAAGGAAGAAGG + Intergenic
908887221 1:68803269-68803291 AAAAACAAAAAGAAGGCAGAAGG - Intergenic
909232766 1:73112699-73112721 AATAACAATGATCAAGAAGAGGG + Intergenic
909498110 1:76302504-76302526 AATAAGAAAGAAAAGTAAGATGG - Intronic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909686580 1:78355370-78355392 AAGAACAAGAAGAAGAAAAAGGG - Intronic
909727412 1:78851989-78852011 AAGAACAAGGCAAAGGAACAGGG + Intergenic
910770502 1:90826562-90826584 AACAAAAAGGCCAAGGAAGAGGG - Intergenic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911302782 1:96195672-96195694 AAAAAGAAGGAGATGAAAGAAGG + Intergenic
911323807 1:96445707-96445729 AATATCAAGCAGAAGGAACATGG - Intergenic
911379135 1:97090237-97090259 AATAAGAAAGAAAAGGAAGGTGG - Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911937069 1:103990407-103990429 AATAACAAAAAGAAAGAAAATGG - Intergenic
912194337 1:107379636-107379658 AATAACAAGAATAATGAAGGTGG + Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912393728 1:109323198-109323220 AAGAACAAGGAGAGGGAAAGTGG + Intronic
912629961 1:111238443-111238465 ACTCAAAAGGGGAAGGAAGATGG + Intronic
912870369 1:113299030-113299052 AATTATAGGGAGATGGAAGATGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913008866 1:114662957-114662979 AAAGAAAAGGAAAAGGAAGAAGG + Intronic
913063021 1:115225190-115225212 ACAGACAAGGACAAGGAAGAAGG + Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914058627 1:144187754-144187776 GAAAAGAAGGAGAGGGAAGAAGG - Intergenic
914120522 1:144778617-144778639 GAAAAGAAGGAGAGGGAAGAAGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914440771 1:147704350-147704372 AAAAACAAGGACGAGGAACAAGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914596017 1:149153674-149153696 AATAAAAATAAGAAGCAAGATGG + Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
914975791 1:152360107-152360129 GATAACAATGTGAAGGAGGAAGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915257091 1:154641896-154641918 AACAAAAAGGAGGAGGAAGAGGG - Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915307681 1:154990034-154990056 AAGGACAAGGAAAAGGGAGAAGG + Intronic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915447216 1:155980528-155980550 AATAACAAGGAAAGGGACTAGGG + Intronic
915607161 1:156959822-156959844 GATTAGAAGGAGAAGGGAGACGG + Intronic
915622500 1:157094382-157094404 GATTAGAAGGAGCAGGAAGAAGG - Intronic
915643231 1:157246128-157246150 AGTCACAAGGTGAAGGCAGAAGG - Intergenic
915866980 1:159512363-159512385 AAAAATAGGGAGGAGGAAGAGGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916261320 1:162845452-162845474 AATAACAAGGAGAGAAAAAAGGG + Intronic
916337636 1:163691492-163691514 AATGTAAAGGAGAAGGAAGTGGG - Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916610666 1:166388369-166388391 AAAAAAAAAAAGAAGGAAGAAGG + Intergenic
916739998 1:167639466-167639488 AAAAACAATGAGAATGAAAATGG - Intronic
916879240 1:169003289-169003311 AGAAAGAAGGAGGAGGAAGAAGG + Intergenic
916977442 1:170096234-170096256 AACCACAAGGAGAAGTAACAAGG - Intergenic
916981630 1:170144324-170144346 AATACCAGGAAGAAAGAAGATGG + Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917140303 1:171828516-171828538 AATAAGAGAGAGAAGCAAGAGGG + Intergenic
917252896 1:173081426-173081448 AAAAAAAAGAAGAAGAAAGAAGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917499201 1:175570669-175570691 AAAAAGAGAGAGAAGGAAGAAGG - Intronic
917512653 1:175681096-175681118 AATAAAAAGGGACAGGAAGAAGG + Intronic
917741710 1:177967596-177967618 AAATAAAAGGAAAAGGAAGAAGG + Intronic
918080280 1:181202519-181202541 AGTTACCAGGAAAAGGAAGAAGG - Intergenic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
918605316 1:186417425-186417447 AAAAACAAGTAGAAAGAAAATGG + Intronic
918981279 1:191562709-191562731 AATCACAATAAGAAAGAAGAAGG + Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920381490 1:205536960-205536982 AGTAAAAAGAAGCAGGAAGAAGG - Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
920767104 1:208843811-208843833 AATAAAAAGAATAAGGAAAAGGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
920916595 1:210262578-210262600 AAAAATGAGGAGAAGGAAGGAGG - Intergenic
921175702 1:212592524-212592546 AAAAATAAGGAGAAAGAATATGG - Intronic
921253943 1:213322723-213322745 AAGAAGAAGGAGAAAGAAAATGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921866101 1:220089121-220089143 AAAAAGAAGGAGGAGGAAGGAGG + Intronic
922277071 1:224089015-224089037 AAAAAAAAGGATAATGAAGAAGG + Intergenic
922333846 1:224602761-224602783 AGTAACAAGAAAAAGGAAAAGGG + Intronic
922561293 1:226571621-226571643 AAGAAGAAGAAGAAGGGAGAAGG - Intronic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923548738 1:234944189-234944211 AAGGACAAGGAGGAGGAAGGAGG + Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923747944 1:236720150-236720172 AATAGCAAAGCGAAGGATGATGG - Exonic
923837069 1:237623731-237623753 AAAAACAAGAAAGAGGAAGAAGG - Intronic
923931815 1:238708834-238708856 AGTAAAAAGCAGAAGGAAAATGG + Intergenic
924016548 1:239731556-239731578 AAGAACAAGAGAAAGGAAGAGGG + Intronic
924263590 1:242256884-242256906 AAAAAGAAAGAGAAAGAAGAGGG - Intronic
924389022 1:243531040-243531062 AACATCAATGAGTAGGAAGAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
924937125 1:248781539-248781561 AATTACAAAAAGAAGTAAGAAGG - Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1062781121 10:208769-208791 AATGAGGTGGAGAAGGAAGAAGG + Intronic
1062943551 10:1442879-1442901 AAAAACAAAAACAAGGAAGATGG + Intronic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1063877641 10:10496839-10496861 AATAATGAAGGGAAGGAAGATGG + Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064741018 10:18434795-18434817 AATTACAAGAATAAGGAAGCAGG + Intronic
1064843456 10:19623715-19623737 AATAAAAAGGTGAAGGGAGAGGG - Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1065321864 10:24517564-24517586 AACAAAAAGGAGAACGAGGAGGG - Intronic
1065379202 10:25072258-25072280 AAAAAAAAGGAGGAAGAAGAAGG + Intergenic
1065463088 10:25990159-25990181 AAAAACAAGAGGAAGGAACATGG - Intronic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1065835369 10:29652986-29653008 AAAAAAAAGGAAAAGGAAAAAGG - Intronic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066406514 10:35124436-35124458 AAAAAAAAAGAGACGGAAGAGGG + Intergenic
1066483315 10:35819376-35819398 AACACCACGGAGAAGGTAGAAGG + Intergenic
1066721205 10:38341614-38341636 AAAAAGAAAGAGAAAGAAGAGGG + Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067908152 10:50315934-50315956 AAAAAAGAGCAGAAGGAAGAGGG + Intronic
1068452896 10:57215008-57215030 AATAAAAAAGAAAAGTAAGAAGG - Intergenic
1068460898 10:57327045-57327067 TAAAAAAAGGAGGAGGAAGAAGG - Intergenic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1069078450 10:64063325-64063347 AAAAAAAAGGGGAAGGAAGGAGG - Intergenic
1069171352 10:65233842-65233864 AAAAAAAAAGAGAAGGAAAATGG - Intergenic
1069180737 10:65355199-65355221 AAAAATAAGGACAAGGAAAATGG + Intergenic
1069186713 10:65431979-65432001 ATTGACAAGGAGAAGGTAGTTGG + Intergenic
1069208676 10:65728004-65728026 AACAACAATGAGAAGGGAGAAGG + Intergenic
1069351548 10:67532695-67532717 GATACCAAGGAGAAGAAAGATGG + Intronic
1069361317 10:67645501-67645523 AATTATAAGGAGTAGGAATAGGG - Intronic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069770561 10:70896630-70896652 AAGAAAAAAGAAAAGGAAGAGGG - Intergenic
1069959211 10:72069847-72069869 CATAAGAAGGTGATGGAAGAAGG - Intronic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1070697878 10:78576379-78576401 AAGTTCAAGGGGAAGGAAGAAGG + Intergenic
1070935133 10:80288149-80288171 AAGAACAAGAGCAAGGAAGATGG + Intronic
1071029273 10:81155362-81155384 AATAGCAAGCAGAAGGCACACGG - Intergenic
1071677925 10:87673946-87673968 GATAACATGCAGAAGGAAAAGGG - Intronic
1071727537 10:88214977-88214999 GATAGCAAAGAGAAGAAAGAAGG - Intergenic
1071858243 10:89646878-89646900 GAGTACAAGGAGTAGGAAGAGGG - Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072088868 10:92107357-92107379 AATCATAAGGAGCAGGAAGCAGG + Intronic
1072096058 10:92181479-92181501 AATGGCAACCAGAAGGAAGACGG + Intronic
1072101574 10:92234117-92234139 AAAAAAAAGGAGAAGGATAAAGG + Intronic
1072827417 10:98621523-98621545 AATACCAAGGAGCAGGAATGAGG + Intronic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1072866707 10:99069900-99069922 CATAACAAGGAGAGGGAAAGTGG + Intronic
1072990376 10:100186740-100186762 AATAAAAAAGGGAAGGAAAAAGG + Exonic
1073340866 10:102743749-102743771 AATAAAAAGTAGGAGGAAGCCGG - Intergenic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073764314 10:106665357-106665379 AAAAAAAAAGGGAAGGAAGAAGG - Intronic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074096359 10:110316878-110316900 AATGAAAAGTAGAAGAAAGAAGG + Intergenic
1074503709 10:114047970-114047992 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1074522038 10:114234804-114234826 AAGAACAAGGAGAACAAAGTTGG - Intergenic
1074543680 10:114386238-114386260 AATAAAAAGGAAAAGGAACTGGG + Intronic
1074561901 10:114542608-114542630 AAAAAGAAAGAGAAAGAAGAAGG + Intronic
1074844757 10:117387864-117387886 AATAACATAGGTAAGGAAGAAGG + Intergenic
1074867226 10:117552037-117552059 ATTAACAAGGAAACGGAACATGG - Intergenic
1075004900 10:118823081-118823103 CCTAACAAAGAGAAGGAACAGGG - Intergenic
1075339285 10:121632739-121632761 AATAAAAATAAGAATGAAGAGGG + Intergenic
1075744744 10:124719052-124719074 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1075837146 10:125463742-125463764 AATAACAAGGGTAATCAAGATGG - Intergenic
1075925059 10:126245017-126245039 TGCACCAAGGAGAAGGAAGATGG + Intronic
1076029168 10:127143056-127143078 AATAAGCTGGAGAAGCAAGAAGG - Intronic
1076086947 10:127640681-127640703 AATAACAATGAGAAAGGAGGGGG + Intergenic
1076249215 10:128971950-128971972 CATAACAAGGATAGGCAAGATGG + Intergenic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076379694 10:130016549-130016571 AATAGTAAGAAGAAGGCAGAAGG + Intergenic
1076642823 10:131930400-131930422 AAAAGCCAAGAGAAGGAAGATGG - Intronic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078041877 11:7872740-7872762 AATAGCAGGGAGGAGTAAGAGGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078114023 11:8426806-8426828 AATAACAATGATATGGAAGGGGG - Intronic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078617602 11:12880072-12880094 AGAAAAAAGGAAAAGGAAGAGGG + Intronic
1078806104 11:14706262-14706284 AATATCAAGTTGAATGAAGAAGG + Intronic
1078829070 11:14961714-14961736 AATGACATGGAGGAGGAAGATGG + Intronic
1079341674 11:19616773-19616795 AAGAACCAGGAAAAGGAAAAAGG - Intronic
1079375970 11:19892368-19892390 AATAACAGTGTGTAGGAAGAAGG - Intronic
1079505045 11:21143919-21143941 AAGAACAAGGAGCTGGGAGATGG + Intronic
1079597535 11:22269246-22269268 AAAAAGAAAGAGAAGGAAAAGGG + Intronic
1079597549 11:22269324-22269346 AAAAAGAAAGAGAAGGAAAAGGG + Intronic
1079852508 11:25554441-25554463 AATATCAAGGAAAAGGTAGCAGG + Intergenic
1079930631 11:26555566-26555588 AATAACATGTATAAGGAAGGTGG + Intronic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080474247 11:32574978-32575000 AAGAACAAGAGAAAGGAAGAAGG + Intergenic
1080496233 11:32823108-32823130 AAGAAAAAGGAAAAGGAAAAAGG + Intergenic
1080680761 11:34473648-34473670 AAAAAAAAGGAGGAGGATGAGGG - Intergenic
1080872366 11:36248096-36248118 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1081742574 11:45450801-45450823 AATTACAAGGAGATGGAAGGGGG - Intergenic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1082621049 11:55422581-55422603 AAAAAAAAGAAGAAAGAAGAAGG - Intergenic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1083060747 11:59868335-59868357 AATAAAATGGTGAAGGAAGGGGG + Intergenic
1084005513 11:66321385-66321407 AGAAAGAAGGGGAAGGAAGAAGG + Intergenic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085792856 11:79510935-79510957 AAGGACCAGGAGTAGGAAGAGGG - Intergenic
1085887480 11:80537130-80537152 AATAAAAAGGAGAAGCCAGCTGG - Intergenic
1085954427 11:81374090-81374112 AGAAAAAAGGAAAAGGAAGAAGG - Intergenic
1085962452 11:81478059-81478081 AATAACCATAAGAAGGAAAAAGG - Intergenic
1085973053 11:81616994-81617016 AATAAAAAGAACAAAGAAGAAGG + Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086221619 11:84452113-84452135 AAAAAAAAAAAGAAGGAAGAAGG + Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086506475 11:87509754-87509776 AATAAAAAAGAAAAGGAAGAAGG - Intergenic
1086571606 11:88291347-88291369 AGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1087061676 11:93984939-93984961 AATAAAGAAGAGAAGGAAGCAGG + Intergenic
1087514155 11:99136071-99136093 AATGACAAGAAGAAGGCAAAAGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087594733 11:100238423-100238445 AAAAAAAAGGAGAAAGAAGAAGG + Intronic
1087806564 11:102561899-102561921 AATCACAAGGAGCAGGAAGAGGG - Intergenic
1087911078 11:103754007-103754029 CAAAACAATGAGAAGGAAAATGG + Intergenic
1087973610 11:104516611-104516633 AATAATAAAGAAAAAGAAGATGG - Intergenic
1087973739 11:104517890-104517912 AAAAAAAAGGAGTAGGAAGCAGG - Intergenic
1088000822 11:104878077-104878099 AAAAACAAGGAGAATGAATTGGG + Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088059874 11:105634362-105634384 AAAAAAAAGAAGAAGAAAGAAGG + Intronic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088681824 11:112249977-112249999 AAAAAAAAGGAAAAGGAAGAAGG + Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089778116 11:120853359-120853381 AATAACATGGAGAAGGAACTTGG + Intronic
1089950601 11:122522155-122522177 AAAAATGAGGAGAAAGAAGAAGG + Intergenic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090966455 11:131601574-131601596 AAAAAAAAGGAGAGGGAAGGGGG - Intronic
1091968660 12:4766961-4766983 AATATCAATTAGAAGGAGGAGGG + Intronic
1091983153 12:4882832-4882854 AATAATAAGGGAAAGAAAGAGGG + Intergenic
1092058921 12:5532157-5532179 AATCACAAGGAGAGGGACCAGGG + Intronic
1092243248 12:6848489-6848511 ATTCACAAGGATAGGGAAGAGGG + Intronic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1092485250 12:8897311-8897333 AGTAACAAGGCAAAGGAAGGGGG + Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092890820 12:12967773-12967795 AATAACAAGGACAGAGTAGATGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093114648 12:15194473-15194495 AAAAACAAAGAAGAGGAAGAAGG + Intronic
1093363781 12:18266826-18266848 AATGAGGAGGAGGAGGAAGAAGG - Intronic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093771378 12:23022203-23022225 AGTACCAATGAGAAGCAAGAAGG - Intergenic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1093956489 12:25225907-25225929 AATAACTAGTAGAAGAAGGAAGG - Intronic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094084584 12:26575492-26575514 ACCAACAAGGAAAACGAAGAAGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094312839 12:29104352-29104374 AAAACCAAGGAGTAGAAAGAGGG + Intergenic
1094324897 12:29226948-29226970 AAACACAATGAGAAGGAAGAAGG + Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1094774823 12:33713408-33713430 AATAATAATCAGTAGGAAGAAGG - Intergenic
1095181549 12:39152929-39152951 AATAACACGGAGAAGAAATTAGG - Intergenic
1095263732 12:40128886-40128908 AACAAAAAGTAGAAGGCAGATGG - Intergenic
1095318947 12:40801961-40801983 AAAAAAAAGTAGATGGAAGATGG + Intronic
1095366185 12:41408860-41408882 AGTAATAAGGAGAAAGAAAAAGG - Intronic
1095366652 12:41414562-41414584 TATAAAAAGGAAAAGAAAGAAGG + Intronic
1095694356 12:45127965-45127987 AAGAACAAGGGGGAGAAAGAGGG - Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1095904051 12:47359099-47359121 AAAAACTAGAAGAAGAAAGAAGG - Intergenic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096661536 12:53128256-53128278 AAAAAGGAGGAGAAGAAAGAGGG - Intergenic
1096673585 12:53214558-53214580 AAGAAAGAGGTGAAGGAAGAAGG - Exonic
1096766976 12:53899308-53899330 AGTAAGAAAGAGAAGGAAAAAGG + Intergenic
1096883773 12:54696578-54696600 CGCAACAAGGAGAAGAAAGAGGG - Intergenic
1097439689 12:59594501-59594523 AAAATCAAAGAGAAGGAAAAGGG + Intergenic
1097745671 12:63300144-63300166 AGTAGCAAGGAGACAGAAGAGGG + Intergenic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098313116 12:69167214-69167236 AAAAAAAAGGAAAAAGAAGAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098528155 12:71510741-71510763 AATAACAAGGAGTGAGAAGGAGG + Intronic
1098589081 12:72188849-72188871 AGACACAAGGAAAAGGAAGAAGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098726108 12:73969825-73969847 AGTAAGAAGGAGGAAGAAGAGGG + Intergenic
1098902194 12:76124410-76124432 AACAACAAAGAGAAGAAAGAAGG - Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1100743172 12:97617546-97617568 TAAAACAAGGAGAAAGAAAAAGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100877271 12:98975308-98975330 AAGAAGGAGGAAAAGGAAGAAGG - Intronic
1101662881 12:106782013-106782035 AAGAACAAGAAAAAGAAAGAAGG - Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102596055 12:113993438-113993460 GATACCAGGGAGAAGGAAAAAGG + Intergenic
1102624042 12:114220324-114220346 AACAAGAGGGAGCAGGAAGATGG - Intergenic
1102798798 12:115713491-115713513 AAACACACGGGGAAGGAAGAGGG + Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103304224 12:119951703-119951725 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304276 12:119951843-119951865 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304299 12:119951907-119951929 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304322 12:119951971-119951993 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104455520 12:128908527-128908549 AAAAAAAAGAAGAAGAAAGAAGG - Intronic
1104549952 12:129747186-129747208 AGTAAGAAGGAGAGGGAGGAGGG - Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105743881 13:23358395-23358417 AATAGCAAGAAGCAGGAAAAAGG - Exonic
1105801808 13:23911330-23911352 AATAACAATGTGAAAGAAGAAGG + Intergenic
1105966207 13:25387071-25387093 ATTAACAAGGCTAAGGAAGTGGG - Intronic
1105993971 13:25652477-25652499 AAAAATAAGAATAAGGAAGAGGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106096784 13:26653235-26653257 AATAATACAGAGAAGAAAGAAGG - Intronic
1106211755 13:27655061-27655083 AATAACTAGGAGGAGAAAAAAGG + Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1107219318 13:37962488-37962510 AATAAACAGTAGAAGTAAGAAGG - Intergenic
1107342575 13:39423999-39424021 AAAGGCAAGGGGAAGGAAGAAGG + Intronic
1107405586 13:40109576-40109598 ACGAAGAAGGAGAAGGGAGAGGG + Intergenic
1107504410 13:41017589-41017611 AGTTTCAAGGAGAAGGGAGAAGG - Intronic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1108372937 13:49788939-49788961 AATTTGAAGGAGGAGGAAGAGGG + Intronic
1108782249 13:53850398-53850420 AATAACATGCATAAGGAAAAGGG - Intergenic
1109007460 13:56897143-56897165 TATAAATAAGAGAAGGAAGATGG + Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109204764 13:59468919-59468941 AAAAAAAAGAAGAAAGAAGAAGG + Intergenic
1109210228 13:59526829-59526851 AATAAAAATGGGAAAGAAGAGGG - Intergenic
1109211193 13:59537948-59537970 TATAGCAAGGAGAGGGAAGAGGG - Intergenic
1109321572 13:60816664-60816686 AAAAAGAAGGAAGAGGAAGAAGG - Intergenic
1109376748 13:61505107-61505129 GATGACAAGAAGAAGGAAGTAGG + Intergenic
1109789046 13:67224364-67224386 AGTAGCAAGGAGAAGGGGGAGGG - Intronic
1109911048 13:68910900-68910922 AAAAAAAAAGAGAAGGATGAGGG - Intergenic
1110077445 13:71265436-71265458 AAAAAAAATAAGAAGGAAGAAGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110541954 13:76716236-76716258 AAGAAAAAGGATAAGGAACAGGG + Intergenic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1110761777 13:79238626-79238648 AAGAAAGAGGAGGAGGAAGAGGG + Intergenic
1111278658 13:85988753-85988775 AATAAAAAGAAGAAACAAGAGGG - Intergenic
1111399324 13:87711653-87711675 AATAAGGAGGAGAAGGAAAAAGG + Intergenic
1111425582 13:88076495-88076517 AGGAACAAGGAGTAGCAAGAGGG - Intergenic
1111498420 13:89084979-89085001 GAAAAGGAGGAGAAGGAAGAAGG + Intergenic
1111968649 13:94887067-94887089 AATAACAGAGAGAAGGAAATAGG + Intergenic
1111993817 13:95142902-95142924 AATAATAAGAAGAAGAAACAAGG + Intronic
1111997399 13:95178453-95178475 GCTAAGAAGGAGAAGGAAGCTGG + Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112616230 13:101008540-101008562 AATAAAAAGGAGTATGAGGAAGG - Intergenic
1112956413 13:105064274-105064296 AAAAGCAAGAAGAAGCAAGATGG + Intergenic
1112960654 13:105121219-105121241 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1113422454 13:110181242-110181264 AATAACAAGGATGGGGGAGAAGG + Intronic
1113432468 13:110262529-110262551 AATAAAAAGTAGAATTAAGAGGG - Intronic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114248405 14:20935565-20935587 ATTGACAAGGAGGTGGAAGAAGG - Intergenic
1114507280 14:23226795-23226817 AAAAAGAAGAAGAAGAAAGAAGG - Intronic
1114628217 14:24143121-24143143 GATAAGCAGGAGAAGAAAGAAGG + Intergenic
1114628528 14:24145242-24145264 GATAAGCAGGAGAAGAAAGAAGG - Exonic
1114661248 14:24346623-24346645 AATTTTCAGGAGAAGGAAGAGGG - Intergenic
1114718744 14:24857257-24857279 AATAACAGAGAGAAGGCAGAGGG + Intronic
1114863843 14:26562523-26562545 AAAGACAAGGAGAAGGGTGAGGG + Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115138016 14:30134440-30134462 AAAAACATGGAGAATGAAGTAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116028859 14:39546853-39546875 GATAAGAGGGAGAAGGAAAAGGG + Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116806858 14:49502045-49502067 AATAGAAAGGGGAAGGAAGACGG + Intergenic
1117106857 14:52406251-52406273 AATAGGTAGGTGAAGGAAGAAGG - Intergenic
1118299892 14:64605920-64605942 AAGATCCAGGAGAGGGAAGATGG + Intergenic
1118571225 14:67197441-67197463 AGTAAGTAGAAGAAGGAAGAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1118909479 14:70049284-70049306 AATAAGGAAGAGAAGAAAGAAGG + Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1120028627 14:79614550-79614572 AATAAGAAGGAAAAGCAAGGAGG - Intronic
1120077756 14:80179455-80179477 AAAAATAAAGAAAAGGAAGAGGG + Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1120605941 14:86578045-86578067 AAGAACATGGGGAAAGAAGAGGG - Intergenic
1120630261 14:86881810-86881832 CATTTCAAGGTGAAGGAAGATGG + Intergenic
1120940790 14:89947110-89947132 AGTGCAAAGGAGAAGGAAGATGG + Intronic
1121067660 14:90983644-90983666 AAGAAAAAGAAAAAGGAAGAAGG + Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121195016 14:92063481-92063503 AAAAATAAGGCGCAGGAAGAAGG + Exonic
1121425830 14:93851296-93851318 AAAAACAAAGAGAACGTAGAAGG - Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122221694 14:100243051-100243073 AATCACAAGGAAAAGTAAGGGGG - Intronic
1123219487 14:106842836-106842858 AATAACAAGGAGAATGGTCAGGG - Intergenic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1124083561 15:26524085-26524107 AACAACAGGAAAAAGGAAGAGGG - Intergenic
1124454753 15:29831582-29831604 AATAAAAAAGAAAAGGAAAATGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124708712 15:31987032-31987054 AATCACAAGGGAAAGGAAAAGGG - Intergenic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125428526 15:39573665-39573687 GATGAAAAGGAGGAGGAAGAAGG + Intergenic
1125596011 15:40886534-40886556 AACATGAAGGAGAAGAAAGAAGG + Intergenic
1125805653 15:42491338-42491360 AGAAACAAGGAGAATGAAAAAGG - Intronic
1125811711 15:42547948-42547970 AATTACAAGAAGTAGAAAGAAGG + Intronic
1126343088 15:47665306-47665328 AAGAAGAATGAAAAGGAAGATGG - Intronic
1126463502 15:48938819-48938841 AATAACCATGAGAGGGGAGAAGG + Intronic
1126540056 15:49812583-49812605 AATTAAGAGGAGGAGGAAGAAGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127019142 15:54726594-54726616 GATAACACAGAGAAGGAAGTTGG - Intergenic
1127360411 15:58240275-58240297 AATAACAATGAGTAGGACCATGG - Intronic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1127691055 15:61398366-61398388 AAAAACAAGGAGAAGGAAAGTGG + Intergenic
1127838552 15:62810284-62810306 AATAGCATGTAAAAGGAAGAGGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128095677 15:64952885-64952907 AGAAGGAAGGAGAAGGAAGAAGG - Intronic
1128095733 15:64953538-64953560 AGAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128095837 15:64954743-64954765 AAGAACAAAAAGAAAGAAGAAGG - Intronic
1128095838 15:64954778-64954800 ACAACTAAGGAGAAGGAAGAAGG - Intronic
1128262510 15:66242433-66242455 AAGAAAAAGAAGAAGAAAGAAGG + Intronic
1128393913 15:67203844-67203866 AAAAAGAAAGAGAACGAAGATGG + Intronic
1128412359 15:67412325-67412347 AACAACAAGGTGATGGACGATGG - Intronic
1128882854 15:71259416-71259438 AATACAAAGAAGAAGGAACAAGG + Intronic
1128955286 15:71935248-71935270 AAAAAAATGAAGAAGGAAGATGG - Intronic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1130088813 15:80802189-80802211 AGTAACAAGGAGCAGTAACAAGG + Intronic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131656598 15:94466997-94467019 AATAACAATGAGAAAAATGAGGG + Intronic
1131876939 15:96817990-96818012 AATAACAATGAGATGTAAGGAGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132538816 16:497687-497709 AAAACAAATGAGAAGGAAGACGG - Intronic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1133884620 16:9814612-9814634 ACTAAACAGGACAAGGAAGAGGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1135087319 16:19485929-19485951 AATACCATGGGGGAGGAAGAAGG + Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135187413 16:20327235-20327257 AATATCTGGGACAAGGAAGAGGG + Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135573031 16:23563853-23563875 AATAACAAGGAATGGGAAAAAGG - Intronic
1136170122 16:28484114-28484136 AATAGCTAGGAGTAGGATGAAGG + Exonic
1136711872 16:32244462-32244484 AATCACAAGAAGAAGGAAACTGG - Intergenic
1136756044 16:32684944-32684966 AATCACAAGCAGAAGGAAACTGG + Intergenic
1136812069 16:33185428-33185450 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136818545 16:33295508-33295530 AATCACAAGCAGAAGGAAACTGG - Intronic
1136825109 16:33352041-33352063 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136830175 16:33450812-33450834 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137015791 16:35373189-35373211 AATCACAAGCAGAAGGAAACTGG + Intergenic
1137024856 16:35463143-35463165 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137376367 16:47955461-47955483 TAAAACAAGGAGAAGGAAATTGG - Intergenic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137772089 16:51024543-51024565 AAAAACAAAGAAAAGGAAAATGG + Intergenic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1138101314 16:54254346-54254368 AGTCACAGGGAGAAGGAACAGGG + Intronic
1138133960 16:54505302-54505324 AATAAAAAGGAGAAGGGAGTGGG + Intergenic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1139057891 16:63208404-63208426 ACTAAAAAGGAAAAGGAACATGG + Intergenic
1139193467 16:64891595-64891617 GAAAGAAAGGAGAAGGAAGAGGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140268321 16:73439942-73439964 AAAAACAAGGAGAAGGGCCAAGG + Intergenic
1140333886 16:74084933-74084955 AATACCAGGGAGGTGGAAGAGGG - Intergenic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140713430 16:77699722-77699744 GATGATAAGGAGAAGAAAGAGGG + Intergenic
1141058560 16:80842131-80842153 ATTAACAAGGAGAAAACAGAAGG + Intergenic
1141076371 16:81009436-81009458 AAAACCAAGGAGAGGGAAGCAGG + Intronic
1141350283 16:83288436-83288458 AGTAACAAGGAGACGGAAGGTGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141448610 16:84080943-84080965 AATAACAAGATGAAGGAAAACGG + Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1202990647 16_KI270728v1_random:8398-8420 AATCACAAGCAGAAGGAAACTGG - Intergenic
1203058184 16_KI270728v1_random:945297-945319 AATCACAAGCAGAAGGAAACTGG + Intergenic
1142643374 17:1297559-1297581 AATAACAAGCAGCAGCAGGATGG - Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143654419 17:8285601-8285623 AAAAAAAAGGTGAAGGGAGAAGG + Intergenic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1143968901 17:10778219-10778241 GAGAACAAGGCGAAGAAAGATGG + Intergenic
1144083064 17:11782355-11782377 AAGATCAAAGAGAGGGAAGATGG - Intronic
1144087615 17:11824928-11824950 AATAGCATGGAAAAAGAAGAAGG - Intronic
1144116652 17:12100026-12100048 ACTTGCAAGGAGAAAGAAGAGGG - Intronic
1144169656 17:12647767-12647789 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
1144184134 17:12780511-12780533 AATAGTGATGAGAAGGAAGAAGG - Intergenic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1145850599 17:28091841-28091863 AATAAAAAGGAAGAGTAAGAAGG - Intronic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146370525 17:32263266-32263288 AATAAAAGGGAGAGGGAAGATGG - Intergenic
1146495776 17:33320722-33320744 AAAAGCAAGGAGAGAGAAGATGG - Intronic
1146655106 17:34630408-34630430 AATATCCAGGGGCAGGAAGAGGG - Intronic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1147432429 17:40380642-40380664 AATAACAGTGTGAAGAAAGAAGG - Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147659564 17:42110324-42110346 AATGACAAGGAGGAGGCAGCAGG + Intronic
1147876912 17:43628244-43628266 AAAAAGAAGAAGAAGTAAGAGGG + Intergenic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148521012 17:48274954-48274976 ATTATCTAGGAGAAGGAAGGAGG - Intronic
1148538681 17:48462413-48462435 AATTTCAAGGTGAAGGAATAAGG + Intergenic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149664393 17:58355605-58355627 AATAAGGTTGAGAAGGAAGATGG + Intronic
1149696970 17:58623738-58623760 AAAAAAAAGAAGAAGAAAGAAGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1151073503 17:71245083-71245105 AATAACAGGTATAAGCAAGATGG + Intergenic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152115174 17:78381995-78382017 AATTACAAGAAGTAGGTAGAAGG + Intronic
1152302175 17:79501500-79501522 AATGACAAGGAGGAGGCAGAGGG - Intronic
1152322916 17:79618321-79618343 CAAGACAAGGAGATGGAAGACGG - Intergenic
1153084605 18:1270041-1270063 AATATCAAGAAGAAAAAAGAAGG + Intergenic
1153349138 18:4059255-4059277 AAAAAAAAGGAAAAGGAACAAGG - Intronic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155218485 18:23663444-23663466 AATAACGCGGAGGAGGAGGAGGG - Intergenic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1155442008 18:25871873-25871895 AAAGAAAAAGAGAAGGAAGAAGG + Intergenic
1155520052 18:26658335-26658357 AATAGCAAAGAGAAGGGAGGAGG - Intergenic
1155524423 18:26702068-26702090 ACTTACATTGAGAAGGAAGAGGG + Intergenic
1156005589 18:32437435-32437457 AAAGAAAAGGAAAAGGAAGAAGG + Intronic
1156357667 18:36356476-36356498 AATAAAAATCAGAAGGAAAAAGG - Intronic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1158067303 18:53425662-53425684 AATAACTAAAAGAAGGAATAGGG - Intronic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158493461 18:57931393-57931415 AAAAAAAAGAAGAAGAAAGAAGG - Intergenic
1158561085 18:58514289-58514311 AAAAACTGGGAGAAGGAAGAAGG - Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1158784579 18:60694372-60694394 AATAACAAGGAGCCAGAAAAGGG + Intergenic
1158920084 18:62182020-62182042 ATTAAAAAGGAGAAGGCAGCCGG - Intronic
1159200357 18:65175498-65175520 CATAACATGGAAAAGCAAGATGG - Intergenic
1159663982 18:71134458-71134480 AAAATAAAGGTGAAGGAAGATGG + Intergenic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1159940379 18:74402482-74402504 AATAGAAAAGAGAAGAAAGAAGG + Intergenic
1159994204 18:74947143-74947165 AATAAAAAGGAGAAAAAATAGGG - Intronic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1160950837 19:1666518-1666540 AATAAGGAGAAGAAGGAAGAAGG - Intergenic
1161277664 19:3427827-3427849 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1161835358 19:6642380-6642402 AGGAACAAGGACAAGAAAGAAGG + Intergenic
1162024139 19:7884318-7884340 AAAAAAAAGAAGAATGAAGAAGG + Intergenic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162454900 19:10777584-10777606 AACAAAAAGGAAAAGGAAAAGGG - Intronic
1162510682 19:11116320-11116342 AAAAACAAAGAAAAGAAAGAGGG - Intronic
1162973418 19:14194867-14194889 AAAAAAAAAGAGAAGAAAGAAGG - Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163154192 19:15431253-15431275 GACATCAAGGATAAGGAAGAAGG - Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163235650 19:16029021-16029043 AAAAAAAAGGAGGAGGAAGAAGG + Intergenic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163498715 19:17662929-17662951 AAAAAAAAGGAAAAGGAAAATGG + Intronic
1164292347 19:23879805-23879827 AAAAACGAGGAGGAAGAAGAAGG + Intergenic
1164588505 19:29493077-29493099 AATCACAAGGAAAAGGAAACTGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1165397713 19:35575956-35575978 ATTAAGAAAGAGAAGGAATAGGG - Intergenic
1165657191 19:37544408-37544430 AAAAAAAAGGAAAAGAAAGACGG - Intronic
1165898953 19:39159718-39159740 GATAACAAGGTGAAGGTTGAGGG + Intronic
1166387576 19:42390713-42390735 AATAACAAGAAGAGGGGAGATGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166816862 19:45551539-45551561 AATCACCAGGAGCTGGAAGAGGG + Intronic
1167338053 19:48898638-48898660 AATAGGGAGGAGAAGAAAGACGG + Exonic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168475562 19:56672355-56672377 AAAAAAAAGAAGAAGAAAGAAGG + Intergenic
1168635260 19:57991158-57991180 AATACCAAGGAACAGGAAAACGG - Intronic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
925146632 2:1587070-1587092 GAAAACAAGGAGAAGGAATGTGG + Intergenic
925429786 2:3781183-3781205 AATAACAATGAAAAAGAAGCAGG + Intronic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
926270054 2:11358747-11358769 AAAAAAAAGGAAAAGGAAAACGG + Intergenic
926569479 2:14513691-14513713 AACAACTGGGAGAAGGCAGAAGG + Intergenic
926654271 2:15383329-15383351 CATAAAAAAGACAAGGAAGAGGG + Intronic
926779935 2:16461346-16461368 AACAAAAAGGAAGAGGAAGAAGG - Intergenic
926878167 2:17508920-17508942 AATAATAAAAAGACGGAAGAGGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927165788 2:20319901-20319923 AATAACAAATAGAAAGAACAAGG + Intronic
927263806 2:21122067-21122089 AATCATAAGGACAAGAAAGAAGG + Intergenic
927602550 2:24456899-24456921 AATAAAAAGGAAAAGAAAAAAGG + Intergenic
927668279 2:25047242-25047264 AATAGCAAGGAGAGGGCTGAAGG - Intronic
927996823 2:27492709-27492731 AATCCCAAGGAGAAGGGAAAGGG - Exonic
928118368 2:28564248-28564270 AATAAGAAGGTGAATGAAGCTGG + Intronic
928640260 2:33290668-33290690 AATAACAATGTGAGGAAAGAGGG + Intronic
928889866 2:36191588-36191610 AACAAAAAGGCGAAGTAAGAGGG + Intergenic
928921838 2:36534711-36534733 AGGAAGAAGGAAAAGGAAGATGG + Intronic
929015009 2:37485227-37485249 AATAAGGAGGAGAAGGAATATGG - Intergenic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929348707 2:40920622-40920644 AATAATAAGGATAAGAAATATGG - Intergenic
929518191 2:42623554-42623576 AAAAAGAAAGAGAAGGAAAAGGG - Intronic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930067337 2:47337758-47337780 AAAAACATGGAGAGGGAAGGTGG - Intergenic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930429760 2:51259807-51259829 AATAACAGAGAGGAGGAGGACGG + Intergenic
930873197 2:56187064-56187086 AATAAAAAAGAGAAGGGAGAAGG - Intronic
930959527 2:57242447-57242469 AATAACAAAGTAAAGAAAGAAGG + Intergenic
930981698 2:57533613-57533635 AATAAAAATGAGAGGGAAAATGG + Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931125972 2:59276641-59276663 AAAACCCAGGAGCAGGAAGAGGG + Intergenic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
931942609 2:67269088-67269110 AAAGAAAAGGAGAAGGAAAAAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932112745 2:69015537-69015559 GATAACATGGAGAATGAAAAAGG + Intronic
932301274 2:70668703-70668725 AAAGACATGGAGAAGGAATATGG + Intronic
932736962 2:74261004-74261026 AGGAGCAAGGAGGAGGAAGAGGG - Intronic
932925488 2:75968849-75968871 AAGAACATAGACAAGGAAGATGG + Intergenic
933155612 2:78969834-78969856 AATAATAAGGAGAACAAAAAAGG - Intergenic
933461252 2:82588686-82588708 GAAAAAGAGGAGAAGGAAGATGG + Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934882071 2:97991928-97991950 AATTAGAAGGAGGAGGAAAATGG + Intronic
934982562 2:98856682-98856704 AATAACAACAAAAAGGAGGAGGG + Intronic
935130410 2:100257165-100257187 AATAAAAAGGCTGAGGAAGAGGG - Intergenic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935383370 2:102476665-102476687 AAGAAGGAGGAGAAGGAAAACGG + Intronic
935660144 2:105459581-105459603 AAAAAAAAGTATAAGGAAGAAGG + Intergenic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936657410 2:114504540-114504562 TATAAAAAGGAGGAAGAAGAGGG - Intronic
936768101 2:115878048-115878070 AATAAGAAGTAGAAGGAAAAAGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937140921 2:119599483-119599505 TCTAACTAGGAGAAGGCAGATGG + Intronic
937300741 2:120839494-120839516 AATAACATAGAGAATGAAAAAGG - Intronic
937828433 2:126393094-126393116 AATAAAAAGGTGTAGGAAGGAGG + Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938004086 2:127773411-127773433 AATAACAACAAGGAGGAGGAGGG + Intronic
938010570 2:127825598-127825620 GGTAACAAAGAAAAGGAAGACGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938219553 2:129553720-129553742 AATAACCTGCAGAAGAAAGAGGG - Intergenic
938888415 2:135677960-135677982 AAAAACAAAGAGAAGGAAGGAGG - Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938977713 2:136495360-136495382 ATTAACAAGGAGAAGAAAGGAGG - Intergenic
939241522 2:139566834-139566856 AATAAAGAGGAGAAAGAACATGG + Intergenic
939252278 2:139697322-139697344 AATAAAAATGAGTGGGAAGATGG - Intergenic
939614669 2:144348998-144349020 AAAAACAAGGACAAGCTAGAGGG + Intergenic
939818481 2:146926257-146926279 AAGAAAGAGGAGAAGAAAGAAGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940159631 2:150697286-150697308 AAGAACCAGGAGAAGGTAAATGG + Intergenic
940164050 2:150748370-150748392 AAGAAGGAGGAGAAGGACGAGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
941690990 2:168500589-168500611 AATTACAAGGAGGTGGGAGAAGG + Intronic
941995997 2:171602528-171602550 AGGAAGTAGGAGAAGGAAGAGGG - Intergenic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942868783 2:180709462-180709484 AATAACATGGAGTGGGAAGAAGG + Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943033913 2:182716623-182716645 AATAACAGGGAGGAGGAAGGTGG - Intronic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943161778 2:184263097-184263119 AATACCCAAGAGAGGGAAGAAGG + Intergenic
943175764 2:184472049-184472071 AGTAAGAAGGAGGAGGATGAAGG + Intergenic
943425149 2:187722391-187722413 AAAAAAAAGAAGAAGGAAGAAGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943626865 2:190210932-190210954 ATTAACAAGAAAAAGGAAGCAGG - Intronic
944306997 2:198189826-198189848 GATAATAATGAGAAGGATGATGG + Intronic
944324036 2:198382555-198382577 AATAACATGGAGCAGGAGGGAGG + Intronic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944332054 2:198481203-198481225 AATAACAAGCAAAAGAAGGAGGG - Intronic
944469296 2:200035861-200035883 AAAAACAATGAGAAAGAAGAAGG + Intergenic
944702941 2:202261839-202261861 AATAACAAGGATGAGAAACATGG - Intergenic
944980158 2:205108468-205108490 AATAACGAGGAGAAAGAAGAAGG - Intronic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945358915 2:208871856-208871878 GATAAAAGGGAAAAGGAAGACGG + Intergenic
945372659 2:209038563-209038585 AAAAAAAAGGAGAAGAAAAAAGG - Intergenic
945405236 2:209439139-209439161 AATAAAATGGAGAACAAAGAGGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945531857 2:210965142-210965164 AATACCAAGTAGAAGTAATACGG + Intergenic
946033320 2:216722486-216722508 AGGAACAAAGAGAAGGCAGAAGG - Intergenic
946064169 2:216972184-216972206 AAACACAGGGAAAAGGAAGATGG + Intergenic
946218562 2:218205977-218205999 AATAAGCAGGAAAAGGTAGAAGG + Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946866825 2:224048494-224048516 AAGAATGAGGAAAAGGAAGAGGG + Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947008166 2:225536325-225536347 AATGACAAGGGGCAGGAAGCAGG - Intronic
947432426 2:230042849-230042871 TATAGCAGGGAGAAGGAAGTGGG - Intronic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948857651 2:240737540-240737562 AATAACAAGGAAAGGGAGGGAGG + Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168792424 20:588527-588549 AATAACAAGTTGAAGGAAAATGG - Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169098677 20:2926755-2926777 AAAAAAAAGGAAAAGGAAAAAGG - Intronic
1169261027 20:4138060-4138082 AATAAAAAGGAAAAAAAAGATGG + Intronic
1169318592 20:4612715-4612737 AATGAACAGAAGAAGGAAGAGGG + Intergenic
1169635813 20:7690250-7690272 AATAACAACAATAAGGAAGGAGG + Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169844791 20:9977798-9977820 AAAAACAAGGGAAGGGAAGATGG - Intergenic
1170585474 20:17730924-17730946 AAAGACAGGGAGGAGGAAGAAGG + Intronic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1170810891 20:19673484-19673506 GATAGTAAGGAGAAGGCAGACGG - Intronic
1170936233 20:20812217-20812239 GCTGACAAAGAGAAGGAAGATGG - Intergenic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172395903 20:34604949-34604971 AATCCCAAGCAAAAGGAAGATGG + Intronic
1172455469 20:35068841-35068863 AAAAAAAAGAAGAAGAAAGAAGG + Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173122019 20:40302154-40302176 AATAAGAAGGAGGAGAAGGAGGG + Intergenic
1173215433 20:41077606-41077628 ATAAAGAAGGAGAAGGAAAATGG + Exonic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173791620 20:45831644-45831666 AAGAAGCAGGAGGAGGAAGAAGG + Intronic
1174986641 20:55461491-55461513 AACAACAAGGTAAAGGAAGGGGG + Intergenic
1175026440 20:55907508-55907530 AGAAATAAGAAGAAGGAAGAGGG + Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175606105 20:60313625-60313647 AATAATAATGAGAAGGAACCAGG + Intergenic
1175642693 20:60644043-60644065 AATAAAATGGAGAGGCAAGAAGG + Intergenic
1175698799 20:61122739-61122761 AGCAACAAGGAGAATGAAAATGG + Intergenic
1176087113 20:63302730-63302752 AATGTCAAGGAAAAGGGAGAGGG - Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176363345 21:6016902-6016924 AATAACATTGAGAAAGAAGAGGG + Intergenic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1177017141 21:15805998-15806020 AACAAAAAGCACAAGGAAGATGG - Intronic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177168611 21:17630636-17630658 AAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1178327341 21:31656652-31656674 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178816406 21:35933966-35933988 ACTTAGAAGGAGAAGGAAGGAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1179536377 21:42055400-42055422 AATAGCAGGGAGGAGGAGGAAGG + Intergenic
1179760173 21:43521643-43521665 AATAACATTGAGAAAGAAGAGGG - Intergenic
1181301013 22:21881215-21881237 AAAAAGAAGAAGAAGAAAGAAGG + Intergenic
1181790630 22:25262992-25263014 AACAACAAGAAGGAGGGAGAAGG + Intergenic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182173820 22:28262111-28262133 AATAACAAAGAGAAGGAGAAGGG + Intronic
1182653992 22:31875022-31875044 AATAACAAGGAAATGGGAAACGG + Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182954397 22:34407758-34407780 AATCACAAGTAGATGGAAGGTGG + Intergenic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184767707 22:46580190-46580212 AGTAACAGGCAGAAGGCAGAGGG + Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185159655 22:49215567-49215589 GAAAAAAATGAGAAGGAAGAAGG - Intergenic
1185180856 22:49362035-49362057 AATCACAGAGAGAGGGAAGAGGG + Intergenic
1185406086 22:50651968-50651990 AAAAAAAAAGAGAAAGAAGAAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949273170 3:2244769-2244791 ACAAACAAGGAGAGGGAACAGGG + Intronic
949376124 3:3392304-3392326 AAGAAAAAGGCAAAGGAAGATGG + Intergenic
949465878 3:4343143-4343165 TATAACATGGAGATGGGAGATGG + Intronic
949540825 3:5030945-5030967 AAAAAAAAAGAGAAGAAAGAAGG + Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
949912019 3:8918982-8919004 AATATCAAAGAGAAGGAAACTGG + Intronic
949919432 3:8989488-8989510 GTTCAAAAGGAGAAGGAAGAAGG - Intronic
950108824 3:10405530-10405552 AATAGGAAGGGGAGGGAAGAGGG + Intronic
950175948 3:10874485-10874507 ATTAAAAAGGAAAAGGAAGCAGG - Intronic
950203810 3:11062762-11062784 AATGAGATGGAGAAGGCAGAGGG + Intergenic
950979974 3:17292121-17292143 GATAAAAGGGAGTAGGAAGAAGG + Intronic
951073925 3:18366293-18366315 AATACAAAGGAAAAGGAAGCAGG - Intronic
951344820 3:21535245-21535267 AATAAAAAGGAAAAAGAAAAAGG - Intronic
951438408 3:22692233-22692255 AAATACAAGGAGAAGCTAGATGG - Intergenic
951477812 3:23126973-23126995 AATAGCAAGGAGGAGCATGAGGG - Intergenic
951703197 3:25516921-25516943 AATAAAAGGGACAAGGAAGCTGG - Intronic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
951842579 3:27049806-27049828 AAAAACATGGATAAGGACGAAGG - Intergenic
952285644 3:31966580-31966602 AATATCAGGGAGAAGAAAAAGGG + Intronic
952705851 3:36377274-36377296 AACAACAAGAAAAAAGAAGAGGG - Intergenic
953099642 3:39811370-39811392 ATTAAAAAGTCGAAGGAAGATGG + Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953617076 3:44500801-44500823 AAAAACAAGGAAGAAGAAGACGG + Intronic
953820269 3:46202321-46202343 AATAACAGGCAAAAGGAAGCAGG - Exonic
953903684 3:46857648-46857670 AAAAAAAGGGGGAAGGAAGAAGG + Intergenic
954099957 3:48363506-48363528 AAAAAAAAGAAGAAGAAAGAAGG + Intergenic
954140991 3:48605351-48605373 AAAAACATGGAGAAGGATTATGG - Intronic
955094275 3:55781887-55781909 AAAAAAACGGAAAAGGAAGAGGG + Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955565539 3:60240628-60240650 ACAAAGAAAGAGAAGGAAGAGGG + Intronic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
955991419 3:64631769-64631791 AAGAACCATGAGAAGGAATATGG - Intronic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956143826 3:66172423-66172445 AAAAAAAAGGAAAAGAAAGAGGG + Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956839960 3:73129789-73129811 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
956892897 3:73629761-73629783 ACTTACATGGAGCAGGAAGAGGG - Intergenic
957036523 3:75298456-75298478 AGTAGCAAAGAAAAGGAAGAAGG + Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957239213 3:77636594-77636616 AAAAAAAAAGAAAAGGAAGAAGG + Intronic
957592801 3:82223006-82223028 TATAACAAGAAGAAGAAAGAAGG - Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958440423 3:94149753-94149775 AATAAGGAGGAGGAGGATGAAGG - Intergenic
958550434 3:95605834-95605856 ATTAAAAAGGAGAAGGTAAAAGG - Intergenic
958833548 3:99117670-99117692 AAGAAGGAGGAGAAGGAAAAAGG + Intergenic
958870475 3:99552828-99552850 AATAACAAGGAGATCAAAGGAGG + Intergenic
959225040 3:103569440-103569462 AATGACAAAGAAAAGAAAGATGG + Intergenic
959324258 3:104916438-104916460 AATAACATGAAGAAAGAATATGG + Intergenic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960061512 3:113327469-113327491 AATAACAGGAAAAAGGAGGAGGG + Intronic
960307589 3:116080958-116080980 ATTAAGAAAGGGAAGGAAGAAGG + Intronic
960337488 3:116435874-116435896 AATAACAATAAGAAGGCAGCAGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960399023 3:117173057-117173079 AGGAACAAGTAGAAGGAAGTTGG - Intergenic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960623961 3:119662156-119662178 AAAAGGAAGGAGAAGAAAGAAGG + Intronic
960640915 3:119821896-119821918 AATAGTAGGGTGAAGGAAGAGGG + Intronic
960758014 3:121039740-121039762 AATAAAAAAGAGAAAGAGGAGGG - Intronic
961440707 3:126951554-126951576 AAGACCAGAGAGAAGGAAGAGGG + Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962568867 3:136691991-136692013 AACAACAAGGATAATGAAGAAGG + Intronic
962691702 3:137905659-137905681 AACAACAAGGAGAGTGAAGAAGG + Intergenic
962935713 3:140078682-140078704 AAGAACAAAGAAAAGGAAAACGG + Intronic
963244083 3:143044275-143044297 AAAAAAAAGGAGAGGGGAGAGGG - Intronic
963296655 3:143554335-143554357 ACTAAAAAGGAGAAGGCAGTGGG - Intronic
963392653 3:144687490-144687512 AATAATAAGGATAATGATGATGG - Intergenic
963398524 3:144765561-144765583 AATAACCAAAAGAATGAAGAGGG + Intergenic
963451912 3:145492670-145492692 AAATACAATGAGAATGAAGAAGG + Intergenic
963452268 3:145497428-145497450 AGAAAAAAGGAGAGGGAAGACGG + Intergenic
963573890 3:147034180-147034202 AAAAACAAGGAGAACAAAGTCGG + Intergenic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
963914258 3:150842872-150842894 AGAAAAAAGGAGAAGAAAGAAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964237126 3:154544845-154544867 AATAACAGGAAAAAGGATGAGGG - Intergenic
964239225 3:154572344-154572366 AATAAAAAGCAGAAGAGAGAAGG - Intergenic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964453799 3:156838561-156838583 ACCAACTGGGAGAAGGAAGAAGG + Intronic
965478897 3:169191661-169191683 AAAAACAGAGAGAAAGAAGAAGG + Intronic
965545833 3:169915501-169915523 AGGAAAAAGGAGAAGGAAAAAGG - Intronic
965733040 3:171792544-171792566 ACAAACCAGGAGAAGGAAGAGGG + Intronic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
965921247 3:173917033-173917055 AATAACATAGAAAGGGAAGAAGG + Intronic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966310685 3:178590174-178590196 AATAAGAGAGAGAAGGAAGGAGG - Intronic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967133482 3:186493977-186493999 AATCACTAGGAGAAGGGCGAGGG - Intergenic
967264444 3:187677970-187677992 GATGACAGGGAGAGGGAAGAAGG - Intergenic
967277966 3:187795253-187795275 AATAAACATGGGAAGGAAGAGGG + Intergenic
967287538 3:187888076-187888098 AATGACAAGGAGAGGTAAAAGGG - Intergenic
967443446 3:189536595-189536617 AAAAAGAAGGAAAAGAAAGAAGG - Intergenic
967448960 3:189600583-189600605 AATAACAAAGAGAATGAATTTGG - Intergenic
967544503 3:190708669-190708691 AATAACAAGGGGCAGTGAGATGG + Intergenic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968451618 4:678667-678689 AAGACCAAGAAGAAGGAAGGGGG + Exonic
969928080 4:10603951-10603973 AATGAGAAGGAGCAGAAAGAAGG + Intronic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970219689 4:13797969-13797991 AGGAAGAAGGAGAAGAAAGAAGG + Intergenic
970697318 4:18693529-18693551 AATAAAAAGGAAGAGAAAGAAGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971156462 4:24088366-24088388 AAAAGAAAGAAGAAGGAAGAAGG + Intergenic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
971577994 4:28301393-28301415 AATAAAAAAAGGAAGGAAGAAGG + Intergenic
971579838 4:28322157-28322179 AAAAAGAAGGTGATGGAAGAGGG + Intergenic
971586761 4:28414512-28414534 AATAAGAAGAAGAAAGAAGGGGG - Intergenic
971586764 4:28414515-28414537 ACTAATAAGAAGAAGAAAGAAGG - Intergenic
971949247 4:33322575-33322597 AATAAGGAAGAGAAAGAAGAGGG + Intergenic
972229683 4:37056758-37056780 AATAACAAAGATAAAGCAGATGG - Intergenic
972253983 4:37333820-37333842 GATAACACAGAGAAGGAATATGG + Intronic
972268255 4:37483598-37483620 ACCAACAAGGATAAGGAAAAAGG + Intronic
972316344 4:37929875-37929897 AAGAAAAAGGAGGAGAAAGATGG + Intronic
972580279 4:40389170-40389192 AAGAACTGGGAGAAGAAAGATGG + Intergenic
972848521 4:43019559-43019581 AAAACCATAGAGAAGGAAGAAGG - Intronic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973088796 4:46105146-46105168 ACAAACAAAGAGAAGGAAGCTGG + Intronic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
973696606 4:53496611-53496633 AAGAACAAGGTGGAGAAAGATGG - Intronic
974268016 4:59610908-59610930 AAAAAAAAGGAAAAGGAACAAGG + Intergenic
974535641 4:63170401-63170423 AATCACAAATAGAAGTAAGAAGG + Intergenic
974545741 4:63305238-63305260 AATAACAATAAGAAGCATGAGGG - Intergenic
974659384 4:64865858-64865880 AATACGAAGGAAAAGGAAGGAGG - Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974988578 4:69058988-69059010 AATAATAAGGAGAAGGGTCAGGG + Intronic
975426645 4:74237117-74237139 AATAAAGAGGAGAAGGAGAAAGG + Intronic
975501314 4:75088343-75088365 TATAAGAAGGAGAAGCAACAGGG - Intergenic
975503123 4:75109501-75109523 AATAAGAAGGTGGAGGAAGATGG + Intergenic
975823127 4:78291603-78291625 AATAAAAGGAACAAGGAAGAAGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976230492 4:82837731-82837753 AATCACTGGGGGAAGGAAGAGGG + Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
976673459 4:87679065-87679087 AAAAAAAAAGAGAAGAAAGATGG - Intergenic
976757435 4:88513447-88513469 AAGAACAGGAAGAAGGAAAAGGG - Intergenic
976777193 4:88719627-88719649 GAAAAGAAGGAGAAGAAAGAAGG - Intergenic
976802119 4:89004554-89004576 ATTAGAAAGGAGAAGGAAAAGGG - Intronic
977313072 4:95411150-95411172 AATGACCAGGACAGGGAAGATGG + Intronic
977473637 4:97474572-97474594 TATATCAGGGACAAGGAAGATGG + Intronic
977837089 4:101657678-101657700 AATAAAAAGGAGGATGAACATGG - Intronic
978085953 4:104654990-104655012 AAGAACAAGGAGAAGAGAGATGG + Intergenic
978264747 4:106810305-106810327 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978595904 4:110376896-110376918 AAAAAGAAGGAGAAAGAAGGAGG - Intronic
979084493 4:116389554-116389576 AACAAGACAGAGAAGGAAGAAGG + Intergenic
979222873 4:118248944-118248966 AATGAGAAGGAGAAGCTAGAAGG - Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979768372 4:124490939-124490961 AATAAGAAGAAGGAAGAAGAAGG + Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980150075 4:129035274-129035296 AATGACAAGGAGCAGGAAAAGGG + Intronic
980187434 4:129479793-129479815 AAAAACAAGGAAAAGAAAGTAGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980265328 4:130507555-130507577 AATACCTAGGAGAAGAAAGTGGG - Intergenic
980337038 4:131489194-131489216 AGAAACAAGGAGAAAGAACAGGG - Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
980812046 4:137895461-137895483 AAAAAAAAGGAAAAGAAAGAAGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981120133 4:141040031-141040053 GATAGCATGGAGAAGGAAAAAGG - Intronic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
981413480 4:144460060-144460082 AATAGCAAGGGGATGGAAGTGGG + Intergenic
981608726 4:146569327-146569349 AATAAAAAGGTAGAGGAAGAGGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981711200 4:147710275-147710297 AAAAAGAAGGAAAAGAAAGATGG + Intergenic
981791114 4:148537541-148537563 AATATCAGGTTGAAGGAAGACGG + Intergenic
981955570 4:150469052-150469074 AATCAGAAGGAGAAGGAAGTGGG - Intronic
982059206 4:151586012-151586034 AATAGCAAGGAGAAAGAATTGGG - Intronic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982211105 4:153037152-153037174 AATAACAAGGAAAACAAGGAAGG - Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982506901 4:156229828-156229850 AATAAATAGGAGATGGAATAGGG + Intergenic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
983161979 4:164427772-164427794 GAAGACAAGGAGAAGGAAGAGGG + Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983502745 4:168518260-168518282 AATAACAAAGAGACAGATGATGG - Intronic
983587734 4:169374318-169374340 AATAACAAAGACAAGGAAGAAGG + Intergenic
983885940 4:172980655-172980677 AACAACAAGAGGAAGGAAGAGGG - Intronic
984023713 4:174518681-174518703 AATAATAGTGAGAAAGAAGAAGG - Intronic
984097800 4:175453255-175453277 AATAAAAAGGGAAAGGAAAAAGG - Intergenic
984197201 4:176672263-176672285 AAAAAAAAGAAGAAGGGAGAGGG + Intergenic
984389673 4:179112713-179112735 AAAGAAAATGAGAAGGAAGAAGG + Intergenic
984907017 4:184637855-184637877 AATAACTAGCAGATGGAAAAAGG - Intronic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985216773 4:187661668-187661690 AAAAGGAAGGGGAAGGAAGAAGG - Intergenic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
985492088 5:186060-186082 AATAAAAAGCAGGAGCAAGATGG - Exonic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986028154 5:3870377-3870399 AGTCAAAAGGAGAAAGAAGAAGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986442245 5:7792685-7792707 AATAATAAGGAAAGGCAAGATGG + Intronic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986660807 5:10058107-10058129 AATAAGAAGAAAAAGGAAAAAGG + Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988088518 5:26503753-26503775 AATAAGAAGGAGAAGAAGAAAGG + Intergenic
988089614 5:26519699-26519721 AGAAAGAAGGAGAAGGAAGAAGG + Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988790118 5:34600101-34600123 AAAAGCATAGAGAAGGAAGAAGG + Intergenic
988982770 5:36588097-36588119 ATTAACAAGGAGAGAGAAGCTGG - Intergenic
989443915 5:41506596-41506618 AATTACAAAGAGGAGGAAGATGG + Intronic
989565648 5:42898578-42898600 AAAAAAAAGGAAAAAGAAGAAGG + Intergenic
989756214 5:44958755-44958777 AGGAAGGAGGAGAAGGAAGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990125598 5:52513415-52513437 AATAAATAGCAGAAGGAAAATGG + Intergenic
990461812 5:56037731-56037753 GAAAACAAGGGGAAGGAAGGTGG - Intergenic
990509447 5:56477148-56477170 AATAAGAAGGGGATGGCAGAGGG - Intronic
990658748 5:57988232-57988254 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
991548907 5:67815134-67815156 AATATAAAGAAGAAGGAAGTAGG + Intergenic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991959770 5:72032924-72032946 AATATAAAGGTCAAGGAAGAGGG + Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992546584 5:77819711-77819733 ACCAACAAGTATAAGGAAGAAGG - Intronic
993177111 5:84501349-84501371 AATAACAAGAGGAAGAAAAAAGG + Intergenic
993260359 5:85649947-85649969 AGTAAAAAGGAAAAGAAAGATGG - Intergenic
994144894 5:96383844-96383866 AATAGCAATGTGAAAGAAGATGG + Intergenic
994154872 5:96491992-96492014 AATAACTAGAAGAAGGCACAGGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994668058 5:102731251-102731273 AGCAACAAGGAGAAGGACCAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994912617 5:105931915-105931937 AATAAGTAGGAGAAGATAGAGGG - Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
994927210 5:106132249-106132271 AAGAACAAGGAAGATGAAGAAGG + Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
994956669 5:106541734-106541756 AATAAGAAGTAGGAGGAAGAGGG - Intergenic
995141569 5:108741085-108741107 AATAAAAAGGACTAGAAAGAAGG - Intergenic
995213863 5:109572395-109572417 AATAAGAAGAAGAAAAAAGAAGG + Intergenic
995230164 5:109752186-109752208 AATATGGAGGAGGAGGAAGACGG - Intronic
995442432 5:112206623-112206645 AAAAGCAAAGAGAAGGGAGAAGG + Intronic
995470716 5:112499397-112499419 AAAAAAAAGAAGAAGAAAGAAGG + Intergenic
995511816 5:112918241-112918263 AAGAACAACCAGTAGGAAGAGGG + Intronic
995714358 5:115067698-115067720 AATAAAAAGAAAAAGGAAAAAGG - Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995735885 5:115298539-115298561 AATAAGAAGAAAAAGAAAGAAGG + Intergenic
995773408 5:115697968-115697990 AAAAACACTGAGAAGGAAGAAGG + Intergenic
995995991 5:118300044-118300066 AGAAAGAAGGAGGAGGAAGAAGG + Intergenic
996109672 5:119550433-119550455 AAGCAAAAGGAGAAGGAAAAAGG + Intronic
996569657 5:124918572-124918594 AATAACAAGCAAAAAGAAGCAGG - Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
997226261 5:132211555-132211577 AATAACGAGGAATAGGAAGTTGG + Intronic
997380996 5:133438132-133438154 AATAAGAAAAAGCAGGAAGATGG + Intronic
997684008 5:135776034-135776056 AATATCAAGAAGAGGAAAGAAGG + Intergenic
997726443 5:136124232-136124254 AATGACAAGGAAAAGGAAGGAGG + Intergenic
998014185 5:138719148-138719170 AAGAACCAAGTGAAGGAAGAAGG - Intronic
998014830 5:138723850-138723872 AAAAACAAGTGGAAGGAAGATGG + Intronic
998404344 5:141865444-141865466 AAAAACAAGGAGAACAGAGATGG + Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999051178 5:148525395-148525417 ATTAACAAGAGAAAGGAAGAAGG - Intronic
999162132 5:149510451-149510473 AAAAACAAAGAAAAGGAAAAAGG - Intronic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999517204 5:152313503-152313525 AATAAAGAGGAGGAGGAAGAAGG - Intergenic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000810322 5:165853706-165853728 AAAAAAAAGGAAAAGAAAGATGG - Intergenic
1000831876 5:166111982-166112004 AAGATAAAGGAGAAGGCAGAAGG - Intergenic
1000992892 5:167928908-167928930 AAAAAAAAGAAGAAGAAAGAAGG + Intronic
1001079410 5:168656112-168656134 AATAAAAAGGAGGAGGAGGGAGG - Intergenic
1001462490 5:171929492-171929514 AATAACAAAAAGAATGTAGATGG + Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001737812 5:174021150-174021172 AGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1001770935 5:174295277-174295299 AAGAAATAGGAGGAGGAAGAGGG + Intergenic
1001794771 5:174492836-174492858 AGAAACAAGGGGAAGAAAGAAGG - Intergenic
1001837950 5:174847785-174847807 ATTAACAAGGTGAATGATGAAGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003131960 6:3402379-3402401 AATAACAAAGCCAAGGAAGGAGG - Intronic
1003266629 6:4570570-4570592 AATAAAAAGAAGAAGTAAAAAGG + Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003393226 6:5731311-5731333 GAAAACAAAGAGGAGGAAGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003693675 6:8380147-8380169 AAGAACAGCAAGAAGGAAGAGGG + Intergenic
1003807352 6:9740298-9740320 AATTAAAAGGGGAAGGAAGGAGG + Intronic
1003857819 6:10293808-10293830 AATAACAAAGAAAAGCAGGATGG + Intergenic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1003957054 6:11173846-11173868 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1004052623 6:12101923-12101945 AATAACAAGCATAAGAAAGCTGG + Intronic
1004798165 6:19113116-19113138 AAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005358425 6:25007684-25007706 AAGATCACCGAGAAGGAAGATGG - Intronic
1006470024 6:34223523-34223545 AATAACAAGCATAGGGAAGCAGG + Intergenic
1007023161 6:38543107-38543129 GGTAACAAGGACAAGAAAGAAGG - Intronic
1007394564 6:41570219-41570241 AAGAAAAAGGAGAATGCAGAAGG - Intronic
1007472726 6:42101352-42101374 AATTACAAGGAGTAGTAAGAAGG - Exonic
1007621153 6:43215429-43215451 AATAACAGGGATAGGGAAAAGGG - Intronic
1007793202 6:44325783-44325805 ACTATGAAGGGGAAGGAAGAAGG + Intronic
1007938070 6:45751575-45751597 AATAAAAGGGAGGAGCAAGAAGG - Intergenic
1008439490 6:51516302-51516324 AAAAACAAGGAGAACCAGGAAGG - Intergenic
1008784499 6:55150305-55150327 AATAATAAGAAGAAAGAACAAGG - Intronic
1008887264 6:56444683-56444705 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1008915862 6:56785866-56785888 AAGATCAAGAATAAGGAAGAGGG - Intronic
1008982002 6:57494691-57494713 AATAAAAAGGAGATGGAAAAAGG + Intronic
1008993002 6:57625648-57625670 AATAAAAAAGAGAATGATGAAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009170069 6:60387533-60387555 AATAAAAAGGAGATGGAAAAAGG + Intergenic
1009181616 6:60524753-60524775 AATAAAAAAGAGAATGATGAAGG + Intergenic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009557273 6:65188776-65188798 AAAAAAAAGATGAAGGAAGAGGG + Intronic
1009884467 6:69608717-69608739 AAAAACAAAGAGAATGTAGAAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010954724 6:82076988-82077010 AATAGCAAGCAAAATGAAGAAGG - Intergenic
1011041840 6:83038064-83038086 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1011223779 6:85085166-85085188 AATAAAAAAGAAAAAGAAGAAGG + Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1011610380 6:89145593-89145615 AATGTCAAGGAGAAGAAAGTGGG + Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011923311 6:92610263-92610285 CATAAGGAGGAGAAGAAAGACGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012252778 6:96997288-96997310 AGCAACAGGGAGAATGAAGATGG - Intronic
1012290285 6:97447169-97447191 AAAAAACAGGAGAAGGATGAGGG - Intergenic
1012473300 6:99594581-99594603 AAAAAAAAGAAGAAGGTAGAAGG - Intergenic
1012547498 6:100436152-100436174 ACTCACAATTAGAAGGAAGAGGG - Intronic
1013093406 6:106921605-106921627 AAGAAGAAGGAAAAGGAAAAGGG + Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013351785 6:109312458-109312480 AATAACAAGGTGGAGGATGGTGG - Intergenic
1013395020 6:109727146-109727168 AATAACTAAAAGGAGGAAGATGG + Exonic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014362472 6:120497457-120497479 AATGACCAGGAAAATGAAGAGGG + Intergenic
1014503745 6:122227296-122227318 AAAAACAAGATGAAAGAAGAAGG - Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014911440 6:127098639-127098661 AAAAAGAAAGGGAAGGAAGAAGG + Intergenic
1015085011 6:129280019-129280041 GAAAACAGGGACAAGGAAGAAGG - Intronic
1015771115 6:136769594-136769616 AACAAATAGGAGAGGGAAGAGGG + Intronic
1015890660 6:137966950-137966972 AATGGGAAGGAGAAGGCAGAGGG + Intergenic
1015955699 6:138595910-138595932 AATAATAAGGAGGAGAAAGTCGG - Intronic
1016026135 6:139288796-139288818 AATGGCCTGGAGAAGGAAGATGG - Exonic
1016027750 6:139305700-139305722 AATGTTAAGGAGAAGGAAGTGGG + Intergenic
1017288345 6:152704438-152704460 AATAAAAAGGAGAATAAAGTTGG - Intronic
1017612671 6:156207253-156207275 AATAACAATAATAAGCAAGAGGG + Intergenic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018411314 6:163551503-163551525 AACAACAAAGAAAAAGAAGATGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019377597 7:702094-702116 AATAATAAGGGGAAGGTAAATGG + Intronic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019593816 7:1849257-1849279 AATAACGAGGACATGGATGAGGG - Exonic
1019697281 7:2452634-2452656 AAGAAGAAGGAAAAGAAAGAAGG - Intergenic
1019707684 7:2504373-2504395 AATAACTAGCAGAGGCAAGATGG + Intergenic
1019936574 7:4262004-4262026 AAAAAAAAGGAGAAAGCAGAGGG - Intronic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020453192 7:8343444-8343466 CATAACAAGAAGAAAGCAGATGG + Intergenic
1020516650 7:9129691-9129713 AAAAACAAGGAATAGAAAGATGG - Intergenic
1020531619 7:9345437-9345459 AATACCTATGACAAGGAAGACGG + Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020760163 7:12259126-12259148 AATAACAAGAAGAAAGAAATAGG - Intergenic
1021104545 7:16622030-16622052 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021904716 7:25321955-25321977 GATAACAAAGAGACGGAAGGTGG + Intergenic
1022037809 7:26550568-26550590 AAGAAAAATGAGGAGGAAGAGGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022285099 7:28949263-28949285 AATAAAAAAGAAAAGGAATAGGG + Intergenic
1022502173 7:30888595-30888617 GATTACAAGGACAAGTAAGAAGG - Intronic
1022769950 7:33459163-33459185 AAGAACAAGCAAAGGGAAGAGGG - Intronic
1022931947 7:35127051-35127073 AACAAAAAGGAGATGCAAGAAGG - Intergenic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023161519 7:37301247-37301269 AAAAACAATCAGAAGGAAAAGGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023207692 7:37768736-37768758 AATGAAAAGAAGTAGGAAGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023439194 7:40169141-40169163 TATAATTAGGAGAAGGAAAAAGG - Intronic
1023440202 7:40177568-40177590 ATTAACAAAGAGAAATAAGAAGG - Intronic
1023550906 7:41369161-41369183 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1023641312 7:42261917-42261939 AAGAAGAAAGAAAAGGAAGAAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1023728933 7:43171752-43171774 AACAACAGGGAGAAGGGATAAGG - Intronic
1023853598 7:44165758-44165780 AATAACAATATAAAGGAAGAAGG + Intronic
1024542616 7:50491088-50491110 ATTAAAAAGGAAAAGAAAGAAGG - Intronic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024952249 7:54876897-54876919 AATAAAAATGAAAAGGTAGAGGG - Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025228135 7:57181183-57181205 AATGAGGAGGAGGAGGAAGAGGG - Intergenic
1025677275 7:63653298-63653320 ATTTACAAGGAGAAGGAAAGAGG + Intergenic
1025715429 7:63951564-63951586 GATACCAAGGAGAATGAACAAGG - Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1025887753 7:65614429-65614451 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
1026062608 7:67039473-67039495 AATGACAAGTAGATGGAATATGG + Intronic
1026231144 7:68485220-68485242 AATTACAAAGAGAAGGAAAAAGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026715740 7:72787959-72787981 AATGACAAGTAGATGGAATATGG - Intronic
1027155872 7:75767541-75767563 AATACCAAAGAGTAGGATGATGG + Intergenic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027589284 7:80097190-80097212 AATAACAAGGAGCAGGATGGTGG + Intergenic
1027683113 7:81245213-81245235 AGGAAGGAGGAGAAGGAAGAAGG + Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028433828 7:90778688-90778710 AATAAAGAAGAGAAGGAGGAAGG - Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028487921 7:91380225-91380247 AATAGCCAGGAGACTGAAGAGGG - Intergenic
1028509275 7:91605076-91605098 GAAAACAAAAAGAAGGAAGAAGG + Intergenic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029789826 7:102830626-102830648 AATAAAAAGGAGGAGGCAGCAGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030207481 7:106964989-106965011 ATTAAGTAGGGGAAGGAAGAAGG - Intergenic
1030292358 7:107885287-107885309 AGTAACTAGGAGATGGAAAAGGG - Intergenic
1030353084 7:108511527-108511549 AATAACACTGAGAAGGAAGAAGG + Intronic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030868500 7:114728853-114728875 AAAAAAAAGAGGAAGGAAGAAGG - Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031388458 7:121182547-121182569 AATAACAAGGAGAAATGAAAAGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031935152 7:127728509-127728531 AAGAACTAGGTCAAGGAAGAGGG - Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032328056 7:130950838-130950860 AATGAGAAGGAAAAGCAAGAAGG + Intergenic
1032349761 7:131149987-131150009 AACTTAAAGGAGAAGGAAGAGGG - Intronic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032472724 7:132190099-132190121 AACAGGAGGGAGAAGGAAGAAGG - Intronic
1032736294 7:134695617-134695639 GAAAAGAAAGAGAAGGAAGAAGG - Intergenic
1032736695 7:134698895-134698917 AATAGCAAGGAAAAGGAAGACGG - Intergenic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1033004596 7:137548004-137548026 AAGAGCAAAGAGAATGAAGAAGG + Intronic
1033200614 7:139365797-139365819 TATAAGAAGGTGAAGGAAGTTGG + Intronic
1033282300 7:140014913-140014935 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1033733048 7:144196620-144196642 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033743900 7:144295200-144295222 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033750001 7:144354367-144354389 CCTAAGTAGGAGAAGGAAGAGGG + Intergenic
1033878826 7:145856623-145856645 AACTACAAAGAGAAGGCAGATGG - Intergenic
1033990668 7:147282106-147282128 AAGAACAAGGAGGACTAAGAAGG - Intronic
1034051562 7:147989547-147989569 AGGAACATGGAGCAGGAAGATGG - Intronic
1034239166 7:149596630-149596652 GAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1034281531 7:149858185-149858207 GTTAACAAGGAGAAGCAAGCTGG - Intronic
1034290046 7:149923435-149923457 AAACACAAGGAGAAGCAAGCAGG + Intergenic
1034397691 7:150839652-150839674 GATGACATGGACAAGGAAGATGG - Intronic
1034661022 7:152769411-152769433 AAACACAAGGAGAAGCAAGCAGG - Intronic
1034664986 7:152810095-152810117 AAAAACAAGGTGGAGGGAGAGGG - Intronic
1034751494 7:153572844-153572866 AATAACAAGTAGAACAAAGATGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035316450 7:158000482-158000504 AATAAAGAGGAGGAGGAAGAAGG - Intronic
1035333435 7:158111178-158111200 AATAAAGGGGAGAAGGGAGAAGG + Intronic
1035463269 7:159059656-159059678 AATAGCAAGGAGAAGGGATCTGG - Intronic
1035521868 8:281074-281096 AAGAAGACGGAGAAGGAAAATGG + Intergenic
1035731666 8:1857983-1858005 AATAATAATGAAGAGGAAGAGGG + Exonic
1036000044 8:4592368-4592390 GATAACAAGGAAAATGAATACGG - Intronic
1036562811 8:9911775-9911797 AAAAAAAAGGAGATGGAAAAAGG + Intergenic
1036577894 8:10045391-10045413 AATCCCAGGGAGAAGAAAGAAGG + Intergenic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037410906 8:18596085-18596107 AATTAAAAGCAGAAGGAAAATGG + Intronic
1037591738 8:20318080-20318102 AATCACAGAGAGAAGGAAGAGGG - Intergenic
1038281254 8:26167199-26167221 AATAAGAAGGAGATGTAAAAAGG + Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038483728 8:27919124-27919146 GAAAAGGAGGAGAAGGAAGAAGG + Intronic
1038503929 8:28068070-28068092 AAAAAGGAAGAGAAGGAAGAAGG + Intronic
1038698096 8:29824260-29824282 AAAAAGAAGAAGAAGGAAGTGGG + Intergenic
1038970937 8:32634372-32634394 ATCAACAAGATGAAGGAAGAAGG - Intronic
1039157818 8:34581589-34581611 AAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1039280306 8:35977175-35977197 AATAACAAAGTGAAGGGAAATGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040351472 8:46572851-46572873 AATGTCAAGAAGATGGAAGAAGG + Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041079857 8:54206092-54206114 GATAACAAGATGAAGGGAGAGGG + Intergenic
1041145346 8:54870246-54870268 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1042120202 8:65479093-65479115 ATTGACAAGGTGAAGGCAGAGGG + Intergenic
1042150033 8:65771903-65771925 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042350820 8:67775582-67775604 AATAACAATGTGAAGAAATATGG + Intergenic
1042383434 8:68146221-68146243 CATATCAAGCAGAAGGAAGTCGG + Exonic
1042430997 8:68706329-68706351 TATACCTAGGAGAAAGAAGAGGG + Intronic
1042431016 8:68706471-68706493 GATACCTAGGAGAAAGAAGAGGG + Intronic
1042879752 8:73473880-73473902 AGAAAAAAGGAGATGGAAGAAGG + Intronic
1042889348 8:73590069-73590091 AAGAAAGAGGAGAAGGAAGTAGG + Intronic
1042890973 8:73609673-73609695 AATTATAAGGGGAATGAAGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043008111 8:74845905-74845927 AAAAAATAAGAGAAGGAAGAAGG - Intronic
1044002532 8:86901788-86901810 AATATGAAAGAGAAGGCAGAAGG - Intronic
1044276900 8:90311614-90311636 AGTAAAAAGGAGTAGGAACAGGG + Intergenic
1044389928 8:91638185-91638207 AATAAAAAGGAGAAGATAAATGG - Intergenic
1044407339 8:91843657-91843679 AAAATCAAGGTGAAGAAAGAAGG - Intergenic
1044434002 8:92140862-92140884 ATTAACAGAGAAAAGGAAGACGG - Intergenic
1044532401 8:93322296-93322318 AAAATCAAAGAGAAGGAAGTTGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045047080 8:98289496-98289518 AAAAGCAAGAAGAAGGAAGAGGG - Intronic
1045316664 8:101049305-101049327 AAAAAGAAAGAGAAGGAAGGAGG - Intergenic
1045355176 8:101380633-101380655 AAGAAAAAGGAGAAGTAAAAGGG - Intergenic
1045380640 8:101621000-101621022 AATAAAAATGAAGAGGAAGATGG + Intronic
1045587830 8:103559217-103559239 AAAAAGAAGAAGAAGGAAGTGGG - Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045956742 8:107917071-107917093 AATAACAAGGGGAAAGAAAGAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046872032 8:119214431-119214453 AATAGCTATGAGAAGGAGGAAGG + Intronic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1047326057 8:123836899-123836921 AATAACAAAGAGAAGGAAGCGGG - Intergenic
1047395721 8:124497274-124497296 AAAAAAAAGAAGAAGAAAGAAGG - Intronic
1047405455 8:124581941-124581963 ATTATCATGGAGCAGGAAGAGGG + Intronic
1047515151 8:125547420-125547442 AATAACAAGATGAAGGAATCTGG - Intergenic
1047623353 8:126631073-126631095 AATAACAGAGAGAAGGAAGCAGG + Intergenic
1047684301 8:127288795-127288817 AATGGCAAGTAGAATGAAGAAGG - Intergenic
1047782519 8:128121888-128121910 AATGACAAGCTGAAGGAAGGAGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1048806115 8:138242790-138242812 AAAAACAAGGGGTGGGAAGATGG + Intronic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1049456372 8:142693060-142693082 AATCACCAGGAGAAGGAAAATGG + Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1050688495 9:8198929-8198951 AATAGGAAGGAGAAGCAGGAAGG + Intergenic
1051041302 9:12815543-12815565 AATATGAATTAGAAGGAAGAAGG - Intronic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051106534 9:13587294-13587316 AATGACAGGAAGTAGGAAGATGG - Intergenic
1051106877 9:13590419-13590441 GATAAGAAAGGGAAGGAAGAGGG + Intergenic
1051260168 9:15256169-15256191 AAAAAAAAGAAGAAGGAAAAAGG - Intronic
1052387686 9:27841264-27841286 ATAAAAAGGGAGAAGGAAGAAGG - Intergenic
1052519908 9:29533433-29533455 AATATCAAAAAGAATGAAGAAGG + Intergenic
1052715571 9:32112298-32112320 AAAAAAAAGAATAAGGAAGAAGG + Intergenic
1052918221 9:33940086-33940108 AAAAAGGAGGAGGAGGAAGAAGG + Intronic
1053269088 9:36737847-36737869 AAAAAAAAGAAGAAGAAAGAAGG - Intergenic
1053697945 9:40655386-40655408 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1054309236 9:63454794-63454816 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1054441177 9:65262742-65262764 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1054489099 9:65758747-65758769 AGTAAAAAGGAGGAGGAAGAGGG - Intergenic
1054841545 9:69746752-69746774 TATAACAAGGAGAAGATAAAAGG + Intronic
1054946807 9:70804602-70804624 AATAGCAAAGAAGAGGAAGAAGG - Intronic
1054952992 9:70873877-70873899 TAAAAATAGGAGAAGGAAGAAGG - Intronic
1055266060 9:74497499-74497521 AAGAAGAGGGAGAAGGAACAAGG - Exonic
1055284242 9:74711531-74711553 AATGCCTAGGAGAAGGAAGCGGG - Intergenic
1055362057 9:75502502-75502524 AGAAACAAGGAGAAAAAAGATGG - Intergenic
1055426635 9:76203482-76203504 CAAAACAAGCAGAAGGCAGAAGG + Intronic
1055490596 9:76801054-76801076 AAAAACAAGGAGAGGGCAGTTGG - Intronic
1055540217 9:77296455-77296477 AATGACAGAAAGAAGGAAGAGGG - Intronic
1055583167 9:77729714-77729736 CATAACATGGAGAACTAAGAAGG - Intronic
1055752457 9:79521931-79521953 ATTATAAAGAAGAAGGAAGAGGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056170003 9:83975721-83975743 AAAAACAAGGAGAGGGAAAAGGG + Intronic
1056251904 9:84757143-84757165 AAAAAAAAGAAGAAGGAAGAGGG - Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056742557 9:89271892-89271914 AAAAAAAAGAAGAAGAAAGAAGG - Intergenic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057201826 9:93144582-93144604 ACTTGCAGGGAGAAGGAAGAAGG + Intergenic
1057367381 9:94435636-94435658 AAAAAAAAGAAGAAGGAAAAAGG - Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057887479 9:98841132-98841154 ATTAACAAGAAAAAGGAAGAGGG - Intronic
1058122886 9:101158042-101158064 AAAAACAAGCTTAAGGAAGATGG + Intronic
1058138693 9:101335642-101335664 AATCTCAAGGAGGACGAAGAAGG + Intergenic
1058345511 9:103956244-103956266 AAAAACAAGGATAGGGAAGAGGG + Intergenic
1058399496 9:104597798-104597820 AATAACAAGTAAAAGAATGAGGG - Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561475 9:106233343-106233365 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1058904412 9:109470028-109470050 AAAAAAAAGTAGAGGGAAGAAGG - Intronic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059562857 9:115352000-115352022 AATAATAAGGGGGAGAAAGAAGG + Intronic
1059596971 9:115731270-115731292 AATAACAAGAAGAAAGATGCAGG - Intergenic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1059918316 9:119129117-119129139 AATAAGAATGAGGAGGAGGAGGG + Intergenic
1060253100 9:122001879-122001901 AATTTCAAGGAGAAGCACGAAGG + Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1060762197 9:126263974-126263996 AATAATTAGGAGAAGAAAGGAGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062215829 9:135389321-135389343 AATGACAGTGAGAAGGAAGTAGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1202780308 9_KI270717v1_random:28576-28598 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185701241 X:2232020-2232042 AAAAAGGAGGAGAAGGAAGAAGG - Intronic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186095250 X:6094300-6094322 AACAGAAAGTAGAAGGAAGAAGG + Intronic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186450370 X:9667693-9667715 AATGGCAGGGAAAAGGAAGAGGG + Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471176 X:9823145-9823167 GAAAAGAAGAAGAAGGAAGAAGG - Intronic
1186639635 X:11441575-11441597 AGTAAAAAAGAGAAGGAACAGGG + Intronic
1186684227 X:11907953-11907975 AAAGAAGAGGAGAAGGAAGAAGG - Intergenic
1186720644 X:12300233-12300255 AATGACAAGGAGAAGGACAATGG + Intronic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187025810 X:15434275-15434297 AAGAAAGAGGAGAAAGAAGAAGG + Intronic
1187030901 X:15487095-15487117 GATAACAATGAGAAGGCAGAAGG + Intronic
1187330227 X:18331745-18331767 AATAAAAACGAGAAGAAAGGAGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187435020 X:19259769-19259791 AAAAAGAAGAAGAAGAAAGAAGG + Intergenic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187660510 X:21541564-21541586 TATAACAATGAGGAAGAAGATGG + Intronic
1188218049 X:27502994-27503016 AAGAAAGAGGAGAAAGAAGAGGG + Intergenic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1188750485 X:33898928-33898950 AATAACAAAGAGAAGGTTAAAGG - Intergenic
1189254299 X:39625629-39625651 AATACCAAGGACAAGGCAGCAGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189992544 X:46608636-46608658 AATAAAAAGAAAAAGAAAGAAGG - Intronic
1190239254 X:48644598-48644620 AATAAGTAGGAGAAGGAGAAGGG - Intergenic
1191740284 X:64429746-64429768 TAAAACAAGGAAAAGGAAGCAGG + Intergenic
1191772187 X:64773051-64773073 AAAAACTAGCAGAAGGCAGAAGG - Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192286708 X:69746067-69746089 AATAAGTGGGGGAAGGAAGAGGG - Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1192475741 X:71440942-71440964 AACAAGAAGAAGAAGAAAGAAGG - Intronic
1192989507 X:76433604-76433626 AATAACAAGGAGGAGAAGGTGGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193523479 X:82559815-82559837 AATAAAAAAGAGAAACAAGATGG - Intergenic
1194017310 X:88639326-88639348 AATAATCATGAAAAGGAAGAAGG - Intergenic
1194413650 X:93583798-93583820 GATATCAAAGAGAAGGAAGTTGG + Intergenic
1194739612 X:97557192-97557214 AATAAACAGGAGATGGTAGACGG + Intronic
1194830025 X:98612125-98612147 AATAAAAAGGAGCATGTAGATGG - Intergenic
1195068879 X:101260969-101260991 AATTCCACGGAGAAGGAAGAGGG - Exonic
1195101609 X:101560594-101560616 AAAAAGAATGAGAAGGAACAAGG - Intergenic
1195192269 X:102460764-102460786 AATGACAAGAGGAACGAAGACGG + Intronic
1195376393 X:104231954-104231976 AATAACAGGGTGGGGGAAGACGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195883535 X:109617574-109617596 AGTAAGATGGAGAAGAAAGAAGG + Intergenic
1196141102 X:112264674-112264696 AATGAGGAAGAGAAGGAAGATGG - Intergenic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196383689 X:115123124-115123146 ATTTACAATGAGAAGAAAGATGG - Exonic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1196987550 X:121291514-121291536 ACTACCAAGGAGATGGAAAAAGG - Intergenic
1198050875 X:132952488-132952510 AAAATCAAGGAGAAGAAAGAGGG + Intronic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1198581155 X:138066217-138066239 ATTAACCAGGAGAAGAGAGAAGG + Intergenic
1199286007 X:146054898-146054920 AATAAAAAGGAAGAGGAAGGAGG + Intergenic
1199328588 X:146531453-146531475 AAGAAAAAGGAGAATGAATAAGG + Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201416704 Y:13754421-13754443 AAAAAAAAAAAGAAGGAAGATGG + Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202336888 Y:23821221-23821243 AATACCCAGAAGAAGGATGATGG - Intergenic
1202533877 Y:25848850-25848872 AATACCCAGAAGAAGGATGATGG + Intergenic
1202594063 Y:26517934-26517956 AATTACAAGGGCAAGCAAGATGG + Intergenic