ID: 1011627029

View in Genome Browser
Species Human (GRCh38)
Location 6:89291132-89291154
Sequence CCACAGAATCAGAGGAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 404}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011627029_1011627036 20 Left 1011627029 6:89291132-89291154 CCTAGGTTCCTCTGATTCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 404
Right 1011627036 6:89291175-89291197 TTCCCTCTGTAGCATCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 184
1011627029_1011627033 -8 Left 1011627029 6:89291132-89291154 CCTAGGTTCCTCTGATTCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 404
Right 1011627033 6:89291147-89291169 TTCTGTGGGATACCAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011627029 Original CRISPR CCACAGAATCAGAGGAACCT AGG (reversed) Intronic
900286644 1:1904328-1904350 CAACAGAATCACTTGAACCTAGG + Intergenic
900775565 1:4582228-4582250 CTGCTGAATCAGAGGACCCTGGG - Intergenic
900986009 1:6073077-6073099 CCACAAAATCAGAGGCCCTTAGG + Intronic
901028311 1:6291010-6291032 CCACAGAGACAGAGGCAGCTTGG + Intronic
901563138 1:10089097-10089119 CAGCAGAATCACTGGAACCTGGG - Intronic
902143142 1:14373706-14373728 CCACAGAGTCCTAGGATCCTGGG + Intergenic
902232277 1:15035744-15035766 GCACAGAATCACTGGAACCCAGG + Intronic
902308117 1:15559030-15559052 CAAGAGAATCAGTTGAACCTGGG - Intronic
904242280 1:29155583-29155605 GCACAGAATCACTTGAACCTGGG - Intronic
905127358 1:35725175-35725197 CCACTGCACCAGATGAACCTAGG + Intronic
905407775 1:37747673-37747695 CAGCAGAATCACTGGAACCTGGG + Intronic
905407830 1:37748264-37748286 CAGCAGAATCACTGGAACCTGGG + Intronic
905547827 1:38813920-38813942 CTCCAGAAGCAGAGGAACCTGGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906667201 1:47630388-47630410 GCACAGATTGGGAGGAACCTGGG + Intergenic
907318774 1:53589606-53589628 CCCTAGATTCAGAGGCACCTGGG + Intronic
907400330 1:54221319-54221341 CCACAGCAAAAGAGGAACCAGGG - Intronic
907439555 1:54470712-54470734 TCAGAGAATCAGTTGAACCTGGG + Intergenic
907831850 1:58071763-58071785 ACACAGAATCACAGGATCTTAGG + Intronic
907835104 1:58101446-58101468 CCAGAGAGTGAGAGCAACCTAGG + Intronic
908232530 1:62119849-62119871 CAACAGAATCACTTGAACCTGGG + Intronic
908599491 1:65723757-65723779 CAAGAGAATCACTGGAACCTGGG + Intergenic
910536408 1:88302935-88302957 ATGCAGAATCAGAGTAACCTTGG + Intergenic
912000760 1:104831941-104831963 CAAGAGAATCACTGGAACCTGGG + Intergenic
912545194 1:110445746-110445768 CCAGAGAATAACAGGGACCTGGG - Intergenic
912788146 1:112624207-112624229 CTACATAATCAGAAAAACCTGGG - Intronic
914195554 1:145446395-145446417 GCACAGAATCAGGGGACCCTGGG + Intergenic
915993793 1:160544240-160544262 CAACAGAATCACTTGAACCTGGG - Intronic
916400866 1:164447443-164447465 CCAGAGAATCACTTGAACCTGGG + Intergenic
916933043 1:169599722-169599744 CCACAGATTCAGAGAAATGTTGG + Intronic
918193736 1:182201585-182201607 CAAAAGAATCACATGAACCTGGG + Intergenic
918973823 1:191454295-191454317 CACCAGAATCACTGGAACCTGGG - Intergenic
920956038 1:210620960-210620982 TCACAGAATCAAAGGAAGCACGG + Intronic
921310710 1:213840529-213840551 ACCCAGTATCAGAGGAAACTTGG + Intergenic
921332444 1:214053033-214053055 CAAGAGAATCACTGGAACCTGGG - Intergenic
924604892 1:245524851-245524873 GAACAGAATCAGAGGAAACACGG - Intronic
1063269646 10:4493596-4493618 CAACAGCATCAGAATAACCTGGG - Intergenic
1063400513 10:5740105-5740127 CCACAGAAACAGAAGAGCTTTGG - Exonic
1064812615 10:19217623-19217645 CAAGAGAATCAGTTGAACCTGGG - Intronic
1065581177 10:27173671-27173693 CCAGAGAATCACTTGAACCTGGG - Intronic
1065797390 10:29319749-29319771 CCTCATCATCAGAGTAACCTGGG + Intergenic
1066225485 10:33378794-33378816 CCAGAGAATCACTTGAACCTGGG - Intergenic
1066278907 10:33895982-33896004 CAACAGAATCACTTGAACCTGGG - Intergenic
1066661941 10:37745400-37745422 CCACAGAATCAAAGGTTCCATGG + Intergenic
1067065838 10:43103668-43103690 CCAGAGAATGAAAGGAATCTGGG - Intronic
1067247539 10:44559088-44559110 GCACAAAATCAAAGGATCCTGGG - Intergenic
1067676022 10:48377670-48377692 CAACAGGATAAAAGGAACCTGGG + Intronic
1069181811 10:65370461-65370483 CCAGAGAATCACTTGAACCTGGG - Intergenic
1069656019 10:70089204-70089226 CCACAGACTGAGAGGAATTTAGG + Intronic
1070210589 10:74316145-74316167 CCAGAGAATCGGTTGAACCTGGG + Intronic
1070564772 10:77595252-77595274 CCAGAGAATCACTTGAACCTGGG + Intronic
1070965827 10:80529695-80529717 TCACAGACTGAGAGGAACCAGGG + Exonic
1071097794 10:81998907-81998929 CAGGAGAATCAGTGGAACCTGGG - Intronic
1071935395 10:90525381-90525403 CCAAATATTCAGAGGAACTTGGG + Intergenic
1072308038 10:94126968-94126990 CCACAGAGTTAGAGAAATCTGGG + Intronic
1073042737 10:100618451-100618473 CCACAGGATCCCAGGACCCTGGG - Intergenic
1074032289 10:109700840-109700862 TCACAGAATAAGAGGAATCTTGG + Intergenic
1074249459 10:111730089-111730111 CCATAAAATCAAAGGAATCTGGG + Intergenic
1074304341 10:112262934-112262956 CCACGGAGCCAGAGGAACCTGGG - Intergenic
1074308570 10:112301312-112301334 CCAGAGAATCACTTGAACCTGGG + Intronic
1074955744 10:118387223-118387245 CCATAGAATCAGAAGGACCTGGG + Intergenic
1075106150 10:119541689-119541711 CTTCAGAGTCAGGGGAACCTGGG + Intronic
1075517309 10:123119231-123119253 CCAGAGAGCCAGAGGAGCCTGGG + Intergenic
1076626838 10:131826302-131826324 CCACTGACTCAGTGGAAGCTTGG + Intergenic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1081827608 11:46072456-46072478 CAACAGAATAGGAGGAACCTGGG + Intronic
1082829966 11:57609183-57609205 GCACAGAATCACTTGAACCTGGG + Intronic
1083989645 11:66239050-66239072 CCACAGGATGGGAGGAACCCCGG + Intronic
1084007450 11:66330960-66330982 CCCCAGAATCTAAGGGACCTGGG + Intronic
1084067614 11:66714336-66714358 CCACAGAAGCAGGGCATCCTTGG + Exonic
1085535765 11:77216428-77216450 CCACAGAATGAGAGGGGCATGGG - Intergenic
1085653720 11:78292949-78292971 CCACAGAATAAGAAGATCTTGGG - Intronic
1085726570 11:78960156-78960178 GCACAGAAACACAGGAACCCTGG - Intronic
1085829891 11:79888255-79888277 CCACTGAATCAGATGCTCCTTGG + Intergenic
1086499004 11:87433155-87433177 CCACAGAATGAAAGGAGCATGGG + Intergenic
1088024036 11:105156166-105156188 CCACAGGATAAGAGGATCCAGGG - Intergenic
1088713059 11:112525476-112525498 TCACAGAATCAGCAGAGCCTGGG + Intergenic
1089862281 11:121600501-121600523 CCACATAATAAGATGAACATTGG + Intronic
1089921833 11:122216211-122216233 GCACACAAACAGAAGAACCTTGG - Intergenic
1090668012 11:128927729-128927751 CCCCAGAATCACAGGGACCATGG - Intergenic
1090932210 11:131308233-131308255 CCAGAGAATCACTTGAACCTGGG - Intergenic
1092135411 12:6143616-6143638 CCAGAGAATCACTTGAACCTGGG - Intergenic
1092280935 12:7097115-7097137 GCCCAGAATCAGACGACCCTCGG - Exonic
1092428531 12:8391783-8391805 CCACAGAAACAGAGGAGGCCAGG + Intergenic
1092429617 12:8397935-8397957 CCACAGAAGCAGAGGAGGCCAGG + Intergenic
1092530974 12:9344656-9344678 ACAGAGAATCTGAGTAACCTTGG + Intergenic
1093447300 12:19275010-19275032 ACACAGCATCAAAGAAACCTGGG - Intronic
1094194961 12:27739359-27739381 TCACAGAATCACAGTAACTTGGG - Intronic
1095936510 12:47689430-47689452 GTACAGAATCACTGGAACCTGGG - Intronic
1100027563 12:90148509-90148531 CCAAAGAAACAGGGAAACCTGGG - Intergenic
1100243707 12:92735273-92735295 CCACAGCAGCAAAGGAATCTTGG - Intronic
1100754927 12:97740840-97740862 CAATACAAGCAGAGGAACCTGGG + Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103190376 12:118996250-118996272 CCAAAGAATCACAGGCATCTTGG + Intronic
1104538298 12:129639288-129639310 CAGGAGAATCAGTGGAACCTAGG + Intronic
1105020319 12:132811916-132811938 GCAGAGAATCACTGGAACCTGGG + Intronic
1106740910 13:32640337-32640359 CCAGAGAATCACTTGAACCTGGG - Intronic
1108352978 13:49604199-49604221 CCACAAAATGAAAGGAGCCTTGG - Intergenic
1108353330 13:49607123-49607145 CCACAGAATGAAAGGAGCCTTGG + Intergenic
1109197213 13:59391305-59391327 CCATAGAATCAGAAAAACTTGGG + Intergenic
1111613388 13:90634128-90634150 CCACAGAATCACAGGATATTGGG + Intergenic
1112036935 13:95505845-95505867 CAAGAGAATCACTGGAACCTGGG - Intronic
1112800760 13:103107435-103107457 CCCCAGACTCAGAGTCACCTGGG - Intergenic
1113844636 13:113379599-113379621 CCAGAGAATCACTTGAACCTGGG + Intergenic
1114205058 14:20562987-20563009 TTACAGAATCAGAGAAACCCAGG + Intergenic
1114259629 14:21026908-21026930 CATCAGCACCAGAGGAACCTGGG + Intronic
1115341015 14:32292866-32292888 CCTCTGAATCAGAGGAGCCTTGG + Intergenic
1117054758 14:51900540-51900562 CTACAGTGTCAGATGAACCTAGG + Intronic
1119509150 14:75197561-75197583 ACACAAAATCAGAGGAACGCAGG + Intergenic
1119623866 14:76153534-76153556 CCACACAATCACAGAAAACTAGG - Intronic
1119818356 14:77591651-77591673 CCCCAGAATCATCTGAACCTGGG - Intronic
1120199845 14:81524909-81524931 CAACAGATTAAGAGAAACCTAGG + Intronic
1120867346 14:89307117-89307139 ACACACACTCAGAGCAACCTAGG - Intronic
1121470707 14:94152071-94152093 CCAGAGAATCACTTGAACCTGGG - Intronic
1122664878 14:103322013-103322035 CAAGAGAATCAATGGAACCTGGG + Intergenic
1124358514 15:29017060-29017082 CCACCGAATCAGGGGTACCCGGG - Intronic
1125275543 15:37986100-37986122 ACACAGAATCATAGAAACTTGGG + Intergenic
1126788641 15:52199941-52199963 CCACAGAAAGGGAGGAGCCTGGG + Intronic
1127972880 15:63975689-63975711 CCTGAGAATCAGTTGAACCTGGG - Intronic
1128007803 15:64261506-64261528 CAACAGAATCACTTGAACCTGGG + Intronic
1128044712 15:64607595-64607617 CAACAGAATCACTTGAACCTGGG - Intronic
1132008182 15:98249836-98249858 CCAGAGAATCACTGGAACCTGGG - Intergenic
1132237893 15:100235625-100235647 CCACAGCATCAGCAAAACCTGGG - Intronic
1132270214 15:100517578-100517600 CCACAGATAAAGAGGAAGCTGGG + Intronic
1132294431 15:100725186-100725208 CCACTGAATAAGAGCCACCTGGG - Intergenic
1132594815 16:743909-743931 TCACAGCATCACAGCAACCTGGG - Intronic
1133259903 16:4541893-4541915 CCACAGGCTCACAGGAACCTAGG + Intergenic
1133270963 16:4610619-4610641 CCCCAGCCTCAGAGGAGCCTGGG - Intronic
1133905528 16:10018779-10018801 CTAGAGAATCAGAGCAACCTCGG - Intronic
1134009159 16:10838515-10838537 CCTCAGAAGCAGACGAGCCTGGG - Intergenic
1134605336 16:15566571-15566593 CCAGAGAATCACTTGAACCTGGG + Intronic
1135208487 16:20503326-20503348 CAACAGAAACAAAGGAAGCTAGG + Intergenic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1135569920 16:23541232-23541254 CCAGAGAATCACTTGAACCTGGG + Intronic
1135636994 16:24086137-24086159 CCACAGCATCAGAGAACCTTGGG + Intronic
1136472687 16:30492341-30492363 CAAGAGAATCAGTTGAACCTGGG - Intronic
1136489926 16:30600799-30600821 GCACAGAATCACTTGAACCTGGG + Intergenic
1137713210 16:50581614-50581636 CCACTTACTCAGAGGCACCTCGG + Intronic
1138118688 16:54380787-54380809 CCAGAGAATCACCTGAACCTGGG + Intergenic
1138366574 16:56483486-56483508 CCACATGATTAAAGGAACCTGGG + Intronic
1138496471 16:57412063-57412085 CCAGAGAAGCAGAGGAATGTTGG + Intronic
1138560243 16:57797063-57797085 CCATAGAAGCAGAGAGACCTCGG + Intronic
1138819764 16:60244873-60244895 CCAGAGAATCACTTGAACCTGGG + Intergenic
1138869445 16:60864218-60864240 GCACAGGATCAGAGGAAACTGGG - Intergenic
1140390960 16:74586206-74586228 CCACAAGATAAAAGGAACCTGGG + Intronic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1140864895 16:79051411-79051433 CCACAGAATGGAAGGAGCCTGGG - Intronic
1141154046 16:81584612-81584634 CCACATAATGACAGGAGCCTTGG + Intronic
1141310632 16:82910425-82910447 CAACAGATGCAGAGGAGCCTAGG - Intronic
1141566329 16:84904489-84904511 CCAGAGAATCACTTGAACCTGGG + Intronic
1143075548 17:4339754-4339776 CCACAGAATCACTTGAACCCGGG + Intronic
1143549116 17:7618362-7618384 CAAGAGAATCACTGGAACCTGGG - Intronic
1143896736 17:10142459-10142481 CCAGAGAATCACTTGAACCTGGG - Intronic
1144513373 17:15896855-15896877 CCAATGAGCCAGAGGAACCTGGG - Intergenic
1144522426 17:15962622-15962644 CCACAGAATCTCTTGAACCTAGG - Intronic
1145886053 17:28383279-28383301 CAGAAGAATCACAGGAACCTGGG + Intronic
1146073760 17:29708495-29708517 CAAGAGAATCACTGGAACCTGGG + Intronic
1148167910 17:45496448-45496470 GCAGAGAATCACTGGAACCTGGG + Intergenic
1148395732 17:47306771-47306793 GCACAGAATCACTTGAACCTGGG - Intronic
1150102228 17:62433645-62433667 CCAGAGAATCACTTGAACCTGGG + Intronic
1150254139 17:63730647-63730669 CCAGAGAATCACTTGAACCTGGG - Intronic
1150512909 17:65775251-65775273 ACACGGAGTCAGAGGAAGCTAGG + Intronic
1152231623 17:79116873-79116895 CCACAGCATCAGCAGCACCTGGG + Intronic
1152686964 17:81698972-81698994 CAAGAGAATCACTGGAACCTGGG + Intronic
1152700475 17:81815973-81815995 GCAGAGAATCACATGAACCTGGG - Intergenic
1155253286 18:23971402-23971424 CCAGAGAATCACTTGAACCTGGG - Intergenic
1155375283 18:25150662-25150684 ACACAGACTCAGAGTATCCTGGG + Intronic
1157244077 18:46038355-46038377 CCACTGTATCAGGGGACCCTTGG + Intronic
1158438375 18:57451359-57451381 CCTCAGTGTCAGAGGAAACTTGG - Intronic
1159593335 18:70358412-70358434 CCAGAGAATCACCTGAACCTGGG + Intergenic
1159860879 18:73647885-73647907 CCACAGGAGCAGAGGAGACTGGG - Intergenic
1161299468 19:3535895-3535917 ACAGAGAAGCAGAGGAGCCTGGG - Intronic
1161552920 19:4924057-4924079 CAACAGAATCATTTGAACCTGGG - Intronic
1162981183 19:14241136-14241158 CAGGAGAATCACAGGAACCTGGG - Intergenic
1163669984 19:18621822-18621844 CAAGAGAATCACTGGAACCTGGG - Intergenic
1164563184 19:29308153-29308175 CAAGAGAATCAGTTGAACCTGGG - Intergenic
1165132186 19:33639930-33639952 CCAGAGAATCACTTGAACCTGGG - Intronic
1165188824 19:34045002-34045024 CAAAAGAATCATATGAACCTGGG + Intergenic
1166534805 19:43566141-43566163 CCAGAGAATCACTTGAACCTGGG + Intronic
1166537958 19:43587235-43587257 CAAGAGAATCAGTTGAACCTGGG + Exonic
1166713113 19:44949694-44949716 ACACAGAATCGCTGGAACCTGGG - Intergenic
1166935112 19:46327406-46327428 CCAGAGAATCACTTGAACCTGGG - Intronic
1167361196 19:49031420-49031442 CAGGAGAATCACAGGAACCTAGG - Intronic
1167362454 19:49037377-49037399 CAGGAGAATCACAGGAACCTAGG + Intergenic
1167733990 19:51280251-51280273 TCACTGAATCAGAGGCATCTTGG - Intergenic
1167996061 19:53403068-53403090 CAACAAAATCACATGAACCTGGG + Intronic
1168608341 19:57777846-57777868 CCAGAGAATCACTTGAACCTGGG - Intronic
1168690646 19:58374838-58374860 GCAGAGAATCACTGGAACCTGGG + Intronic
925208960 2:2031395-2031417 CCACAGGATGAGAGGCACTTGGG - Intronic
925208987 2:2031523-2031545 CCACAGGATGAGAGGCACTTGGG - Intronic
925358629 2:3261714-3261736 CCACAGACTCAGAGGATCTGCGG - Intronic
925612660 2:5715653-5715675 CAGCAGAATCACTGGAACCTGGG + Intergenic
926024561 2:9529876-9529898 CCACAGAATCACTTGAACCCAGG + Intronic
926329242 2:11811107-11811129 CCACAGAAGCAGAGGGTGCTTGG - Intronic
926597284 2:14805105-14805127 CCACAGGATCAGAAGCAGCTGGG + Intergenic
926749520 2:16187387-16187409 CCACAGCTGCGGAGGAACCTAGG - Intergenic
927128714 2:20038516-20038538 CAAGAGAATCACATGAACCTGGG - Intronic
927791300 2:26011854-26011876 CCAAAGAATCAGGGGAAGCCAGG - Intergenic
927817821 2:26235214-26235236 CGAGAGAATCACTGGAACCTGGG + Intronic
927855530 2:26525283-26525305 CCACAGAATCAGAGACTCCTTGG + Intronic
929639100 2:43558172-43558194 CCAAAGAAGGAGAGTAACCTAGG + Intronic
929671957 2:43883167-43883189 CAGCAGAATCACTGGAACCTGGG + Intergenic
930321649 2:49862219-49862241 CCATAGAATTACAGCAACCTTGG - Intergenic
931231096 2:60375455-60375477 CCACAGAATGAGAGGGAGGTGGG + Intergenic
931635177 2:64334109-64334131 GCACAGAATCGCTGGAACCTGGG + Intergenic
931789428 2:65650860-65650882 CCACAGGATGAGAGCAACCCAGG + Intergenic
932142006 2:69287302-69287324 CCACAGGAGCAGAGGCTCCTGGG + Intergenic
933302386 2:80556733-80556755 CCAAGGAATGAGAGGAAACTAGG + Intronic
934071190 2:88385193-88385215 GCACAGAATGAGGGGAACCCAGG - Intergenic
934106726 2:88701695-88701717 ACACAGACTCAGAGCAAACTGGG + Intronic
934536238 2:95136338-95136360 CCGGAGAATCACATGAACCTGGG - Intronic
935085416 2:99839702-99839724 CCAGAGAATCACTTGAACCTGGG - Intronic
936449088 2:112619967-112619989 CAACAGAATCACTTGAACCTGGG + Intergenic
938953144 2:136275736-136275758 TCACAGAATCACAGGGTCCTTGG - Intergenic
939998580 2:148943786-148943808 CCACAGAATCAGAGAGTCTTGGG - Intronic
940396995 2:153201081-153201103 CAACAGAATCAGAGAAACCGGGG - Intergenic
941313136 2:163959456-163959478 ACTAAGAATCAGAGGAACGTTGG - Intergenic
942244343 2:173993053-173993075 CAAGAGAATCACTGGAACCTGGG + Intergenic
942849292 2:180464487-180464509 CCACAGGATGAGAAGAACTTTGG - Intergenic
944014169 2:195012898-195012920 CCACAGAATCATAGTAATTTAGG - Intergenic
944525992 2:200620289-200620311 CTACAGAATCGCTGGAACCTGGG - Intronic
944725068 2:202462803-202462825 CAAGAGAATCACATGAACCTGGG - Intronic
945308992 2:208288335-208288357 CCATAGAGTCAGACAAACCTAGG - Intronic
945753041 2:213812162-213812184 TCACAGAATGAGAGGAACTTAGG + Intronic
946039492 2:216771577-216771599 CCACAGAAACGGTTGAACCTGGG - Intergenic
946203206 2:218083653-218083675 CAACAGAATCACTTGAACCTGGG + Intronic
946612105 2:221470144-221470166 CCAGAGAGTCAGAGGAAACATGG + Intronic
946679301 2:222196271-222196293 CCACAGAAGCACATGAGCCTGGG + Intergenic
946800753 2:223413703-223413725 CCTTAGAATAAGAGGAATCTTGG + Intergenic
947177228 2:227380235-227380257 CCAGAGAATCACTTGAACCTGGG + Intronic
948076070 2:235166149-235166171 CCAGAGAATCACTTGAACCTGGG + Intergenic
1168791695 20:581906-581928 CCACAGACTCTGAGGGAACTGGG + Intergenic
1169087059 20:2833515-2833537 CCCCAGAATCAGAGGCACAAAGG + Intergenic
1169808452 20:9583593-9583615 CCAGAAGATCAGAGGATCCTGGG - Intronic
1169989002 20:11478363-11478385 CCACATAATAAGAGGAACTTTGG + Intergenic
1171246516 20:23614314-23614336 TCACTGAATCAGAGGATCCTGGG - Intergenic
1172885129 20:38225789-38225811 CCAAAGAATCAGGAGAACCAGGG + Intronic
1173624437 20:44461976-44461998 CGCCTGAATCAGAGGGACCTGGG - Exonic
1174228432 20:49024029-49024051 TCACAGAATCACAGGTAACTGGG + Intronic
1175132456 20:56799716-56799738 CCCCAGAAGCAGAGCCACCTAGG + Intergenic
1175291562 20:57879330-57879352 GCACAAAAACAAAGGAACCTGGG - Intergenic
1175569949 20:60010858-60010880 CCACAGAGTGGGAGGACCCTGGG - Intronic
1176241631 20:64078275-64078297 CCCCAGTCTCAGAGGAAACTGGG - Intronic
1177300162 21:19233876-19233898 CAACAGAATCACTTGAACCTGGG - Intergenic
1177479900 21:21673344-21673366 CCACAGAATCACTTGAACCCAGG + Intergenic
1178075326 21:29010512-29010534 AGACAGAATCACTGGAACCTGGG + Intronic
1179400311 21:41076828-41076850 CAGGAGAATCATAGGAACCTGGG + Intergenic
1180069440 21:45428993-45429015 CAAAAGAATCAGTTGAACCTGGG - Intronic
1181146791 22:20854211-20854233 CCAGAGAATCACTGGAACCCAGG - Intronic
1183359735 22:37377214-37377236 CCACAGACTCAGGGGAGACTTGG + Intronic
1185401339 22:50619492-50619514 TCACAGAATCAGAGGGAATTAGG + Intergenic
950133657 3:10565139-10565161 CAACAGAATGCAAGGAACCTGGG + Intronic
951000169 3:17549206-17549228 CAACAGAATCACTTGAACCTGGG + Intronic
951275206 3:20676743-20676765 CAAGAGAATCACTGGAACCTGGG - Intergenic
951763126 3:26166259-26166281 TCACAGAATGGAAGGAACCTGGG - Intergenic
952742190 3:36744887-36744909 CCCCAGAATCAGAGCATCCTAGG - Intergenic
953732098 3:45458592-45458614 CAGGAGAATCACAGGAACCTAGG + Intronic
953769631 3:45770149-45770171 CCACACACTCATGGGAACCTTGG - Intronic
954199593 3:49016418-49016440 CCACAGAGTCAGGTGAGCCTGGG - Exonic
954548064 3:51455802-51455824 CAAAAGAATCACTGGAACCTGGG + Intronic
957163469 3:76640436-76640458 CCACAGAATCACTTGAATCTGGG + Intronic
957168999 3:76712580-76712602 CCAGAGAATCACTTGAACCTGGG + Intronic
957892697 3:86380490-86380512 CAACAGAATCACTTGAACCTGGG - Intergenic
958428960 3:94015174-94015196 CTACAGAAACAGAGGAACAAGGG - Exonic
959255818 3:104011980-104012002 CCAGAGAATCACTTGAACCTGGG + Intergenic
959532987 3:107454494-107454516 CCAGAGAATCACTTGAACCTGGG + Intergenic
960033747 3:113082499-113082521 CCGGAGAATCACATGAACCTAGG - Intergenic
961580156 3:127874435-127874457 CAACAGAATCACTTGAACCTGGG - Intergenic
961979589 3:131062978-131063000 CAACAGAATCAGAGAATCTTAGG + Intronic
962707634 3:138061018-138061040 CCACAGAAGCACAGGAAGCCTGG + Intergenic
964533999 3:157699527-157699549 CCACAAAATGGGAGGAGCCTGGG + Intergenic
964689282 3:159431714-159431736 CAACAGAATCACTTGAACCTGGG + Intronic
965317199 3:167207720-167207742 CAATAGAATAATAGGAACCTGGG + Intergenic
965339107 3:167464104-167464126 CAAGAGAATCAGTTGAACCTGGG - Intronic
965436194 3:168654967-168654989 CCACACAGACAGAGAAACCTAGG - Intergenic
967720507 3:192811155-192811177 CCACAGAGTCTGGGGAAGCTAGG - Intronic
967728305 3:192882538-192882560 CTAGAGAATCAGATGACCCTTGG - Intronic
967922051 3:194620931-194620953 GCACAGAATCACTGGAACCCGGG + Intronic
968831829 4:2936173-2936195 CCACAACATCAGATGAGCCTGGG - Intergenic
969235670 4:5863768-5863790 CCACAGAATTAAAGGATTCTTGG + Intronic
969393083 4:6903562-6903584 CTAGAGAAGCACAGGAACCTGGG - Intergenic
970280231 4:14446872-14446894 GCATAGTATCAGAGGAATCTGGG - Intergenic
970302558 4:14696797-14696819 CCAGAGAATCACTTGAACCTGGG - Intergenic
971225866 4:24751039-24751061 GCACAGAGTCAGGAGAACCTGGG + Intergenic
973805666 4:54523869-54523891 TACCAGAATCAGAGGAACATTGG - Intergenic
973842322 4:54874886-54874908 CAACAGAATCACTTGAACCTGGG - Intergenic
975062869 4:70024959-70024981 GCATAGAATCAGAAGAAACTAGG - Intergenic
975300862 4:72789865-72789887 CCACAAAATTAGAAAAACCTTGG - Intergenic
975728966 4:77319375-77319397 CCCCAGAATAGGAGGGACCTGGG + Intronic
975783728 4:77866142-77866164 CTACAGAATCACTTGAACCTGGG - Intronic
977066312 4:92320565-92320587 CAAGAGAATCACTGGAACCTGGG - Intronic
977955928 4:103025711-103025733 CCACTGAAATAAAGGAACCTGGG + Exonic
978336883 4:107678881-107678903 ACCCAGAAACAGAGGACCCTGGG - Intronic
981019114 4:140006491-140006513 CAAGAGAATCACTGGAACCTGGG + Intronic
981094649 4:140765948-140765970 CAGCAGAATCAGTTGAACCTGGG - Intergenic
981980822 4:150788666-150788688 CCAGAGAATCACTTGAACCTGGG + Intronic
983234000 4:165158217-165158239 CCACAGAATCAATTGAACCCAGG + Intronic
984272862 4:177568950-177568972 CAGCAGCATCAGAGGAATCTGGG + Intergenic
984430986 4:179648753-179648775 CAGCAGAATCACATGAACCTGGG - Intergenic
984944209 4:184958512-184958534 CCAGAGAAGCAGAGGAACACTGG + Intergenic
987212665 5:15699309-15699331 CCACAGTCTCAGAGGGACCTTGG - Intronic
987914395 5:24192259-24192281 CAAGAGAATCACTGGAACCTGGG + Intergenic
988364650 5:30280581-30280603 CCACAGACTCACTTGAACCTGGG - Intergenic
988391559 5:30640312-30640334 CCACAGAATCATAGAAAACATGG + Intergenic
988985925 5:36618975-36618997 CAACTGCATCAGAAGAACCTTGG - Intronic
989451317 5:41589386-41589408 ACAAAGAATCAGAGAAATCTTGG - Intergenic
990280760 5:54248413-54248435 GCCCTGAATCAGAGCAACCTTGG - Intronic
992759341 5:79937798-79937820 CCTGAGAATCAGTTGAACCTGGG - Intergenic
993085589 5:83359496-83359518 ACACAGAAGCAGAGCACCCTGGG + Intergenic
993973519 5:94448907-94448929 CCGTACAATCAGAGGAACCCAGG - Intronic
995050377 5:107696692-107696714 ACACAGAACCAGAGAAACCTGGG - Intergenic
995537946 5:113156247-113156269 TCACAGAATCAGATAAAGCTGGG + Intronic
995655491 5:114421700-114421722 CAACAGAATCACTTGAACCTGGG - Intronic
997319869 5:132969142-132969164 CCAGAGAATCACTTGAACCTGGG - Intergenic
997401192 5:133604072-133604094 CCCCAGAATCAGATAAGCCTGGG + Intronic
997592612 5:135085189-135085211 CCAAGGAATCAGAGAAATCTGGG - Intronic
998090098 5:139360871-139360893 CAAGAGAATCACTGGAACCTGGG - Intronic
1001274577 5:170341045-170341067 CCACAGATGCAAAGGAGCCTGGG + Intergenic
1001907286 5:175483727-175483749 CCAGAGACACAGAGGGACCTAGG - Intronic
1002457941 5:179356318-179356340 CCTCAGAATCATTGGACCCTGGG + Intergenic
1003261614 6:4521584-4521606 TCACTGAATCAGAGGACCCAAGG - Intergenic
1004884190 6:20036150-20036172 CCACAGATTCAGAGGTCTCTGGG + Intergenic
1008394831 6:50994307-50994329 CCACAGAAAAAGAAAAACCTAGG + Intergenic
1010836159 6:80589480-80589502 CCAGAGAATTAAAGGAAGCTTGG + Intergenic
1011627029 6:89291132-89291154 CCACAGAATCAGAGGAACCTAGG - Intronic
1013526552 6:110979853-110979875 CAAGAGAATCACTGGAACCTGGG - Intergenic
1013604202 6:111732836-111732858 CCACAGGATGGAAGGAACCTGGG + Intronic
1014216177 6:118754680-118754702 CCACAGAATAACTGGAACCCGGG - Intergenic
1015019304 6:128452925-128452947 CTACATAGTCAGAGGAACTTTGG + Intronic
1015618529 6:135105150-135105172 TGACAGAATCCAAGGAACCTAGG + Intergenic
1016431384 6:143989550-143989572 CCTGAGAAGCAGAGGAACCAGGG - Intronic
1016977118 6:149820149-149820171 CCACAGAACAAGGGGAAGCTGGG + Exonic
1017811489 6:157987077-157987099 CCAGAGAATCACTTGAACCTGGG - Intronic
1018195311 6:161351415-161351437 CCAGAGAATCACTTGAACCTGGG - Intronic
1018990765 6:168671689-168671711 CCACAGAAGCAGAGGGACCAGGG - Intronic
1018993857 6:168695670-168695692 CCCCAGAAACAGAGGACCATAGG - Intergenic
1019373963 7:678993-679015 CAGGAGAATCACAGGAACCTGGG + Intronic
1021277483 7:18671477-18671499 TCAGAGAATCTGAGGAACTTAGG - Intronic
1021963400 7:25894560-25894582 CCACAGAATGAAAGGTGCCTGGG + Intergenic
1022031089 7:26492468-26492490 CCACACCATCAGAGAGACCTGGG + Intergenic
1022071310 7:26917770-26917792 TGAAAGAATTAGAGGAACCTTGG + Intronic
1023264430 7:38391447-38391469 CCACAGATTCACAGGCACCTGGG + Intronic
1024225639 7:47324657-47324679 CCAGAGAATCACTTGAACCTGGG + Intronic
1024226721 7:47330981-47331003 GCACACAATAAGAGGAACCCTGG + Intronic
1024496528 7:50053979-50054001 CCAGAGAATCACTTGAACCTGGG - Intronic
1025036053 7:55593049-55593071 CCACAGAATGAGAGGAATTGGGG - Intergenic
1025120548 7:56298079-56298101 ACACAGAATCATTTGAACCTGGG - Intergenic
1026052584 7:66959669-66959691 CCAGAGAATCACTTGAACCTGGG + Intergenic
1026924351 7:74179537-74179559 CCATAGAATCACTTGAACCTGGG + Intronic
1026980677 7:74524770-74524792 CACCAGAATCACTGGAACCTAGG + Intronic
1029173791 7:98649408-98649430 CCAGAGAATCACTGGAGCCTGGG - Intergenic
1029255128 7:99264447-99264469 CCACAGAATCATAGGATCATTGG + Intergenic
1029532561 7:101135091-101135113 CCAGAGAATCACATGAACCTGGG + Intronic
1030027709 7:105341269-105341291 CAAGAGAATCACTGGAACCTGGG + Intronic
1030054892 7:105575399-105575421 CAAGAGAATCAGTTGAACCTGGG - Intronic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1030262337 7:107579276-107579298 CCAGAGAATCACTTGAACCTGGG + Intergenic
1030762940 7:113373389-113373411 CCACAAAATGGAAGGAACCTAGG - Intergenic
1032083935 7:128873905-128873927 CAGCAGAATCAGTTGAACCTGGG - Intronic
1033265229 7:139879972-139879994 CCAGAGAATCACTTGAACCTCGG - Intronic
1034066343 7:148140514-148140536 CAAGAGAATCACATGAACCTGGG - Intronic
1034920064 7:155072188-155072210 CCACAGAATGACAGTAACCTAGG - Intronic
1035119894 7:156558288-156558310 CAAAAGAATAATAGGAACCTGGG - Intergenic
1036781068 8:11648027-11648049 CCACAGGGTCAGTGGAAACTAGG + Intergenic
1036943867 8:13075941-13075963 GCTTAGAATCAGAGGAAACTAGG + Intergenic
1037759316 8:21731363-21731385 GCAAAGAAACAGAGGAATCTTGG + Intronic
1037870996 8:22496588-22496610 CAAAAGAATCACTGGAACCTGGG - Intronic
1038311143 8:26447318-26447340 CAAGAGAATCAGTTGAACCTGGG - Intronic
1038336302 8:26648484-26648506 TCACAGAATCACAGGACACTTGG - Intronic
1038961317 8:32523526-32523548 CCACAGAATCAGAAGCTCTTTGG + Intronic
1039047515 8:33463410-33463432 CCAGAGAATCACTTGAACCTGGG + Intronic
1039162324 8:34636120-34636142 ATAAAGAATCAGAGGAACTTTGG + Intergenic
1039617153 8:38965192-38965214 TCACAGAATCACAGAAAACTAGG - Intronic
1039629699 8:39097277-39097299 CCACAGTATCACAGACACCTGGG - Intronic
1040797976 8:51308044-51308066 CCATAAAAGCAAAGGAACCTTGG - Intergenic
1041288539 8:56285107-56285129 CCAGAGAATCACTTGAACCTGGG + Intergenic
1042584281 8:70318067-70318089 CCACAAAAACAAAGGAACATTGG + Intronic
1042872741 8:73412977-73412999 CCCCAGAGTCAGAGAAACCAAGG - Intergenic
1042932482 8:74027396-74027418 GCACAGAATCACCTGAACCTGGG - Intronic
1047285396 8:123483462-123483484 CCCCAGAATCACAGGAACCATGG - Intergenic
1047532334 8:125688127-125688149 CCACAGAATCATGGGTCCCTGGG + Intergenic
1047956337 8:129979046-129979068 CAACAGAATCACTTGAACCTGGG + Intronic
1048491022 8:134894131-134894153 CCACAAGATTGGAGGAACCTGGG - Intergenic
1048493906 8:134919871-134919893 CCACAACATGGGAGGAACCTGGG - Intergenic
1048543204 8:135361837-135361859 TCACAGAATGAAAGGAACCTGGG + Intergenic
1048768051 8:137865955-137865977 CTAAAGAAGCAGAGGAACTTTGG - Intergenic
1048922867 8:139246659-139246681 ACACAGAGACAGAGGAACCCTGG - Intergenic
1048924283 8:139256665-139256687 CCAGAGAATCACTTGAACCTTGG + Intergenic
1049845158 8:144797160-144797182 CCAAAGAATCTGAGGAACCTAGG + Intergenic
1051725922 9:20088366-20088388 CTAGAGAATCAGAGGCAACTAGG + Intergenic
1052315417 9:27111989-27112011 GCACAGAATCACGTGAACCTGGG - Intronic
1052741301 9:32395381-32395403 CCAGAGAATCACTTGAACCTGGG + Intronic
1056070524 9:82982125-82982147 CCACAGAATCTGAGGTGCCAAGG + Exonic
1056565614 9:87770340-87770362 CAAGAGAATCACATGAACCTGGG - Intergenic
1057110148 9:92462068-92462090 CAAGAGAATCAGTTGAACCTGGG - Intronic
1058963483 9:110014678-110014700 CCAGAGAATCACTTGAACCTGGG + Intronic
1059279838 9:113123190-113123212 CAAGAGAATCACTGGAACCTGGG + Intergenic
1059431556 9:114253570-114253592 CCTCAGAATCAGACAGACCTGGG + Intronic
1060066126 9:120502787-120502809 CCACAGCATCAACAGAACCTTGG + Intronic
1060150896 9:121287415-121287437 CCTCAGAATCAGAGGTTCCCGGG + Intronic
1061072183 9:128317664-128317686 CTACAGATTAAGAGGAATCTAGG + Intronic
1061251237 9:129427717-129427739 CCACAGCATCTGAGAACCCTCGG + Intergenic
1061556146 9:131370534-131370556 CAAGAGAATCACTGGAACCTGGG + Intergenic
1061658437 9:132110810-132110832 CCAGAGAATCACTTGAACCTGGG + Intergenic
1061988351 9:134143446-134143468 CCAGAGAATCACTTGAACCTGGG + Intronic
1062699111 9:137889955-137889977 GCACAGAATCAGGGGACCCTGGG - Intronic
1185539013 X:887290-887312 GCTGAGAATCAGATGAACCTGGG + Intergenic
1186675762 X:11815837-11815859 CAGCAGAATCACTGGAACCTGGG - Intergenic
1188653463 X:32660854-32660876 CAGCAAAATCAGAGTAACCTAGG - Intronic
1190142756 X:47862428-47862450 CAAGAGAATCACATGAACCTGGG + Intronic
1192182271 X:68923519-68923541 CCACAGAACAAGATGAATCTTGG + Intergenic
1192581372 X:72285212-72285234 CAAAAGAATCAGTTGAACCTGGG - Intronic
1192779357 X:74278445-74278467 CAGGAGAATCAGATGAACCTGGG - Intergenic
1193618210 X:83716735-83716757 CCAGAGAATCACTTGAACCTGGG - Intergenic
1195060958 X:101194065-101194087 CCAGAGAATCACTTGAACCTGGG + Intergenic
1196906075 X:120436276-120436298 CTACAGAATAAGATCAACCTGGG - Intronic
1196909503 X:120471309-120471331 CCACAGAATCAGAATCACTTGGG - Intergenic
1197446511 X:126556438-126556460 CCACAGAATTTGAGGAAATTCGG + Intergenic
1197765276 X:130056040-130056062 CCACAGTCTCAGAGGAGCCTGGG - Exonic
1198065760 X:133095000-133095022 CAACAGAATCACTTGAACCTGGG + Intronic
1198468933 X:136928479-136928501 CAAGAGAATCAATGGAACCTAGG - Intergenic
1199381407 X:147176824-147176846 CAGCAGAATCATTGGAACCTGGG + Intergenic
1200987425 Y:9318032-9318054 CAGGAGAATCACAGGAACCTGGG - Intergenic
1201014671 Y:9588539-9588561 CAACAGAATCACTTGAACCTAGG + Intergenic
1201059204 Y:10029427-10029449 CAGGAGAATCACAGGAACCTGGG - Intergenic
1201233142 Y:11885124-11885146 CAGCAGAATCAGTTGAACCTAGG + Intergenic
1201857563 Y:18561768-18561790 CCAGAGAATGGGAGGAACCCAGG + Intronic
1201875758 Y:18758613-18758635 CCAGAGAATGGGAGGAACCCAGG - Intronic
1202118166 Y:21494641-21494663 CAGGAGAATCACAGGAACCTGGG + Intergenic
1202120617 Y:21518181-21518203 CAGGAGAATCACAGGAACCTGGG + Intronic
1202123068 Y:21541722-21541744 CAGGAGAATCACAGGAACCTGGG + Intronic
1202155937 Y:21887659-21887681 CAGGAGAATCACAGGAACCTGGG - Intronic
1202158385 Y:21911200-21911222 CAGGAGAATCACAGGAACCTGGG - Intronic
1202184840 Y:22176125-22176147 CAGGAGAATCACAGGAACCTGGG - Intronic
1202206520 Y:22410276-22410298 CAGGAGAATCACAGGAACCTGGG + Intronic