ID: 1011627607

View in Genome Browser
Species Human (GRCh38)
Location 6:89296336-89296358
Sequence TCTTATTTATGGACTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011627593_1011627607 27 Left 1011627593 6:89296286-89296308 CCCCGTCCTGCGATCATCCCATC 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627594_1011627607 26 Left 1011627594 6:89296287-89296309 CCCGTCCTGCGATCATCCCATCT 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627603_1011627607 1 Left 1011627603 6:89296312-89296334 CCTGGCTGGCCAGAACTCTGGGT 0: 1
1: 1
2: 1
3: 20
4: 238
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627595_1011627607 25 Left 1011627595 6:89296288-89296310 CCGTCCTGCGATCATCCCATCTT 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627599_1011627607 10 Left 1011627599 6:89296303-89296325 CCCATCTTGCCTGGCTGGCCAGA 0: 1
1: 0
2: 2
3: 13
4: 177
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627596_1011627607 21 Left 1011627596 6:89296292-89296314 CCTGCGATCATCCCATCTTGCCT 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627600_1011627607 9 Left 1011627600 6:89296304-89296326 CCATCTTGCCTGGCTGGCCAGAA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1011627604_1011627607 -8 Left 1011627604 6:89296321-89296343 CCAGAACTCTGGGTGTCTTATTT 0: 1
1: 1
2: 1
3: 13
4: 289
Right 1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011627607 Original CRISPR TCTTATTTATGGACTCATGG AGG Intronic
901328751 1:8388133-8388155 TCCTATGAATGGAGTCATGGAGG - Intronic
901958621 1:12807272-12807294 TCTTCTTGCTGGACTCCTGGGGG - Intergenic
911431030 1:97787624-97787646 TCTTTTTTATGAACAAATGGAGG - Intronic
912278762 1:108290412-108290434 TCTACTCTCTGGACTCATGGTGG + Intergenic
912289464 1:108403945-108403967 TCTACTCTCTGGACTCATGGTGG - Intronic
912766574 1:112417816-112417838 TTTTATTTATGGAGTTTTGGGGG + Intronic
915761868 1:158321956-158321978 TGTTATACATGGACACATGGTGG - Intergenic
915844044 1:159243831-159243853 TCCTATTGATGGAGTGATGGAGG - Intergenic
919768548 1:201142677-201142699 TCCTGTTTATTGACTGATGGAGG - Intronic
924432304 1:244007541-244007563 TCTTATTGATCAACTGATGGAGG + Intergenic
1069292451 10:66797385-66797407 TCTTACTTTTGAACTCATTGAGG - Intronic
1069569773 10:69487265-69487287 TCCTATCAATGGAGTCATGGAGG + Intronic
1069824195 10:71245375-71245397 TCTTATTGATGGGGTAATGGAGG + Intronic
1070435707 10:76390684-76390706 TATTATTTAGGGAATTATGGGGG - Intronic
1070728123 10:78806361-78806383 ACTTATGCATGGGCTCATGGAGG - Intergenic
1078307117 11:10200460-10200482 TGTTATTTAAGGTCTCTTGGTGG + Intronic
1082717785 11:56636075-56636097 TCTAAATTATGTACACATGGTGG - Intergenic
1085782510 11:79422557-79422579 TGTTTTTTAGGCACTCATGGAGG - Intronic
1088876554 11:113941273-113941295 TCTTATTTTTGGCCCCTTGGGGG + Intronic
1089653233 11:119928760-119928782 TCATACCTATGGACTCATGTGGG - Intergenic
1089777991 11:120852454-120852476 TCCTGTTTGTGGACTCATGTTGG + Intronic
1090538280 11:127670848-127670870 TCTTATAAATGGAATCATGCAGG - Intergenic
1095142545 12:38684038-38684060 TCTTTTGTATGAACTCATGCTGG - Intronic
1097929648 12:65169891-65169913 TCCTACTTACGGACTCCTGGGGG + Exonic
1098147255 12:67510469-67510491 TCTTATTTATGGAAGGGTGGAGG - Intergenic
1099737943 12:86595104-86595126 TCTAATTTAGGGAGTCATGCTGG + Intronic
1100137750 12:91574683-91574705 TCTTATTAAGGGAGTCAGGGAGG - Intergenic
1111696551 13:91631717-91631739 AGTTGTTTATGGACTCAAGGAGG + Intronic
1114260203 14:21031114-21031136 GAACATTTATGGACTCATGGAGG + Exonic
1114659656 14:24336035-24336057 TCATGTTTATTGACTCCTGGGGG + Exonic
1116059555 14:39904321-39904343 TCTCATTTATGGGCACATAGAGG + Intergenic
1116310246 14:43316441-43316463 TGTTAAGCATGGACTCATGGAGG + Intergenic
1116942769 14:50807315-50807337 GCTTATTTATGGAATCACAGAGG - Intronic
1123686616 15:22802472-22802494 ACTTATTCGTGCACTCATGGAGG - Intronic
1130203601 15:81855290-81855312 TCTTATTTATAGAGCCCTGGAGG - Intergenic
1138189177 16:55000254-55000276 TCTTGTTTAGGGGCACATGGTGG - Intergenic
1138232495 16:55349017-55349039 TATTATTTATGGGGTCATGCAGG + Intergenic
1138386878 16:56641719-56641741 CCTTATTTGTGGACTAGTGGAGG - Intronic
1140011651 16:71137480-71137502 TCTTATCTCTGAACTGATGGGGG - Intronic
1141215559 16:82020082-82020104 TCTTATTCTTGGACTAAGGGAGG + Intergenic
1141293406 16:82742863-82742885 TGTTTTTAATGGACTCATGGAGG - Intronic
1143929646 17:10408499-10408521 TCTTATATATGGACTAATAATGG - Intronic
1144767648 17:17741392-17741414 TCTTATTAATGGGGTGATGGAGG - Intronic
1148031892 17:44627660-44627682 TCTTATCTCTGGCCTCAAGGGGG - Intergenic
1149280401 17:55098386-55098408 TCTTATATATGGAATGAAGGAGG + Intronic
1159353732 18:67308709-67308731 TCTTTTTTATGAACTGATGCTGG - Intergenic
1160087233 18:75787905-75787927 TCTTCTTTATTGACTCATTTGGG - Intergenic
1160253948 18:77231167-77231189 TCTTGTATATGATCTCATGGAGG + Intergenic
1160863122 19:1245919-1245941 TCTTATTTATAGGGTCCTGGTGG - Intergenic
1161781191 19:6293172-6293194 TCTGACTTTTGAACTCATGGAGG - Intergenic
1162260047 19:9525429-9525451 TCTTAAACATGAACTCATGGTGG - Intergenic
925078248 2:1037824-1037846 TGTTATTTATCCACTCATGAGGG + Intronic
925288644 2:2731653-2731675 TCTTTTTAATGGACTAGTGGAGG + Intergenic
925889694 2:8423699-8423721 TTGTATTTTTGAACTCATGGTGG + Intergenic
933278952 2:80311355-80311377 TTTAATTTATGGTATCATGGGGG - Intronic
933287148 2:80396850-80396872 TCTCATTGCTGGACTCATTGTGG - Intronic
933465777 2:82649453-82649475 TCTTATTTAAAGATTCATCGAGG - Intergenic
935388210 2:102523461-102523483 TCTCATGTATGGACTCAGTGAGG + Intronic
938689159 2:133771019-133771041 ACTTTTTTGTGGACTCCTGGAGG - Intergenic
942093003 2:172512348-172512370 TCTGAAAGATGGACTCATGGTGG + Intergenic
943062235 2:183051215-183051237 TCCTATATCTGGAATCATGGCGG - Intergenic
944074139 2:195708644-195708666 TCTTATTAATAGTCTCAGGGTGG + Exonic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
1168947859 20:1776716-1776738 ACTTCTTTATTGACTCATGCTGG - Intergenic
1169107252 20:3006936-3006958 TCTTATTTATGTGCACATGTTGG + Intronic
1170084246 20:12511406-12511428 GATCATTTATGTACTCATGGAGG + Intergenic
1178325761 21:31644289-31644311 TTTTAATTAAGGACTCAGGGAGG - Intergenic
1180754191 22:18148988-18149010 TCTTGTATGTAGACTCATGGGGG - Intergenic
1184011592 22:41752736-41752758 TTTTAGTCATGGGCTCATGGTGG + Intronic
953246346 3:41198126-41198148 ACTTATTCATTCACTCATGGAGG - Intronic
955613062 3:60778010-60778032 TCTTAGTTCTGGACACATCGGGG - Intronic
957582003 3:82086204-82086226 TCTTATTTATTGACTGCTGTTGG - Intergenic
957669830 3:83286617-83286639 TATTAAGCATGGACTCATGGAGG - Intergenic
959798710 3:110464263-110464285 TCTTATTTCTGGGCCCATGTAGG + Intergenic
960359236 3:116690906-116690928 TCTTATTTATGGTGCCATAGTGG + Intronic
963924864 3:150940599-150940621 TTTTATTGATGGTTTCATGGAGG - Intronic
965893939 3:173550457-173550479 TCTTATTGATGAATTCATGTGGG - Intronic
966314231 3:178627074-178627096 TCTTATTAATTGCCTCATAGAGG + Intronic
967069056 3:185946271-185946293 TCCTATTTATGGAGACCTGGAGG + Intergenic
979506492 4:121502848-121502870 TGTTCTATATGGACTCATGGAGG + Intergenic
984339034 4:178430073-178430095 TCTTATTACTGGAGTCAGGGAGG - Intergenic
986017945 5:3774606-3774628 TCTTGTTTCTTGTCTCATGGTGG + Intergenic
987609205 5:20180223-20180245 GCCTATGAATGGACTCATGGCGG + Intronic
988462600 5:31454035-31454057 TCTTATTTAGGGACTCAAGAGGG - Intronic
993081464 5:83306715-83306737 TCTTATTGCTGGAGTCAGGGAGG - Intronic
995801815 5:116004749-116004771 TCTTATTTGTGTAATAATGGGGG + Intronic
996859606 5:128049812-128049834 TCTCACTCATGGACTCAGGGAGG + Intergenic
999159271 5:149481913-149481935 TTTTAGTGATAGACTCATGGGGG - Intergenic
1005288060 6:24350086-24350108 TCCTCTTTATGGCCTCATGATGG - Intronic
1007893629 6:45322910-45322932 TTTTCTCCATGGACTCATGGTGG - Exonic
1008976734 6:57435698-57435720 TCTTATTTATTGCCACATTGAGG + Intronic
1009347624 6:62635474-62635496 TATTATCCAAGGACTCATGGTGG + Intergenic
1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG + Intronic
1011713895 6:90084372-90084394 TCTGGTCTATGAACTCATGGGGG + Intronic
1011837964 6:91457229-91457251 ACTTATTAATGCAATCATGGTGG - Intergenic
1012415419 6:99007924-99007946 ACGTATTTATGGGTTCATGGGGG - Intergenic
1013405028 6:109835636-109835658 TCTTATTTATTTACTCTTGAAGG + Intergenic
1016551765 6:145289057-145289079 TCTTATTTCTTGAATCTTGGTGG - Intergenic
1020500519 7:8913767-8913789 TCTTATCTCTGTCCTCATGGTGG + Intergenic
1024640604 7:51325590-51325612 TCTTAGTTAAGGCCTCAGGGAGG + Intergenic
1033943188 7:146681377-146681399 TGTTATTCATGGACACATAGAGG + Intronic
1042085504 8:65103500-65103522 TCTTGGTTATGTAATCATGGTGG - Intergenic
1042113057 8:65402176-65402198 TGCTCTTTAGGGACTCATGGCGG - Intergenic
1042509706 8:69598275-69598297 CCTTGTTTATTGGCTCATGGAGG + Intronic
1043007949 8:74844141-74844163 TATTAATTATGGACTCTAGGAGG + Intronic
1043311708 8:78868341-78868363 TCTAATTTATTGACACATGGTGG + Intergenic
1044160725 8:88911625-88911647 CCTTGTTTAAGGACTCTTGGTGG + Intergenic
1050839904 9:10135379-10135401 TCTTATATAGTGTCTCATGGGGG - Intronic
1058061716 9:100504194-100504216 TCTGACTTATGCACTGATGGTGG - Intronic
1185654317 X:1671729-1671751 TCTTTTTTATGGACTCAGCCCGG + Intergenic
1186257698 X:7740550-7740572 TCTGCTTGATGGACTCATAGAGG + Intergenic
1188711799 X:33410221-33410243 TGGTATTTAAGGACTGATGGAGG + Intergenic
1188863802 X:35289484-35289506 TATTATTAATAGACTCATGGGGG + Intergenic
1189636626 X:43017544-43017566 TATTATTTATGGACACATGCTGG - Intergenic
1191783835 X:64896400-64896422 TCTTATAAATGGACTCATACAGG + Intergenic
1195432085 X:104800305-104800327 TCTTATTTATAGCCTCATGAGGG - Intronic
1198140890 X:133802296-133802318 TATTTTTTATGAACTGATGGGGG - Intronic