ID: 1011628223

View in Genome Browser
Species Human (GRCh38)
Location 6:89300454-89300476
Sequence GAGTGGAGATTGCGCCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011628220_1011628223 -1 Left 1011628220 6:89300432-89300454 CCAAGGAGACGCAGGTTGCAGTG 0: 13
1: 1506
2: 28201
3: 127682
4: 233254
Right 1011628223 6:89300454-89300476 GAGTGGAGATTGCGCCACCCGGG 0: 1
1: 0
2: 2
3: 30
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011628223 Original CRISPR GAGTGGAGATTGCGCCACCC GGG Intronic
900911090 1:5597527-5597549 GAGTGGAAATTCAGTCACCCAGG + Intergenic
901484242 1:9547398-9547420 GAGCTGAGATTGCGCCAGCCTGG + Intronic
902162496 1:14542635-14542657 GAGTGCAGATCCCGTCACCCTGG + Intergenic
902572460 1:17355493-17355515 GAGCCGAGATTGTGCCAGCCTGG + Intronic
903439692 1:23378307-23378329 GAGCCGAGATTGCGCCAGCCTGG + Intergenic
903538205 1:24081329-24081351 GAGTGGACAATGCCCCAGCCAGG - Exonic
904410478 1:30322034-30322056 GAGAGGAGAGGGGGCCACCCTGG - Intergenic
904781492 1:32952686-32952708 GAGCAGAGATTGCGCCACCATGG + Intronic
908234811 1:62138779-62138801 GATTGGAGCTGGCCCCACCCAGG + Intronic
909807264 1:79887183-79887205 GAGTGGTGATTTTGCCACCCAGG + Intergenic
910720963 1:90285939-90285961 GAGCTGAGATTGCACCAGCCTGG + Intergenic
912252387 1:108024884-108024906 GAGACGAGATTGTGCCATCCTGG + Intergenic
912997749 1:114548359-114548381 GAGCTGAGATTGCGCCAGCCTGG - Intergenic
914759637 1:150588154-150588176 GAGCCGAGATTGCGCCACTGCGG + Intergenic
914830403 1:151166807-151166829 AAGTGGAGATTGGGTCACCAGGG + Intronic
915146467 1:153798543-153798565 GAGGGGAGGCTGGGCCACCCGGG - Intergenic
916144915 1:161729892-161729914 GAGCTGAGATTGCTCCAGCCTGG - Intergenic
916702457 1:167311986-167312008 GAGCCGAGAGTGCGCCAGCCTGG - Intronic
917428404 1:174939500-174939522 AAGCTGAGATTGCGCCAGCCTGG + Intronic
918620403 1:186597525-186597547 GAGTCGAGATTGTGCCAGCCTGG - Intergenic
920162394 1:204009263-204009285 GAGCTGAGACTGCGCCAGCCTGG + Intergenic
921865457 1:220083366-220083388 GAGCCGAGATCGCGCCAGCCTGG - Intronic
922018328 1:221675930-221675952 TTGTGGAAATTGCCCCACCCAGG - Intergenic
922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG + Intronic
923507963 1:234622841-234622863 GAGCTGAGATTGTGCCATCCTGG - Intergenic
923877662 1:238067107-238067129 GAGTCAAGACTGTGCCACCCAGG + Intergenic
924110719 1:240696961-240696983 GAGCCGAGATCGCGCCAGCCTGG - Intergenic
1063217096 10:3934536-3934558 GAGCCGAGATCGCGCCAGCCTGG - Intergenic
1066538767 10:36421269-36421291 GAGCTGAGATTGCGCCAGCCTGG - Intergenic
1066745664 10:38603045-38603067 GAGTAGAGATTACGCTTCCCAGG - Intergenic
1068365359 10:56042453-56042475 GAGTAGAGATAGCGCCAGCATGG - Intergenic
1069444489 10:68460459-68460481 GAGTAGAGATCGCGCCAGCCTGG - Intronic
1070418666 10:76214396-76214418 GAGCCGAGATTGCGCCACTGCGG - Intronic
1073042557 10:100617522-100617544 GAGTGGAGATGGCACCAGCAAGG + Intergenic
1073165284 10:101442933-101442955 GAGCCGAGATGGCACCACCCTGG - Intronic
1074818613 10:117163243-117163265 GGGAGGAGACAGCGCCACCCAGG + Intergenic
1074980899 10:118619359-118619381 GAGCGGAGATCGTGCCAGCCTGG + Intergenic
1076686627 10:132201109-132201131 GGGTGGGGAATCCGCCACCCCGG - Intronic
1077091380 11:779873-779895 GGGAGGAGATGGCGGCACCCTGG - Intronic
1077162365 11:1119611-1119633 GAGTGGGGTCTGTGCCACCCTGG + Intergenic
1078193435 11:9113239-9113261 GAGCTGAGATTACGCCAGCCTGG + Intronic
1078209975 11:9263272-9263294 GAGCTGAGATTGCGCCAGTCTGG - Intronic
1083911222 11:65711386-65711408 GAGCGGAGATTGTGCCTCGCTGG + Intergenic
1087247894 11:95861104-95861126 GAGCTGAGATTGTGCCAGCCTGG + Intronic
1088670406 11:112134907-112134929 GAGCCGAGATTGCGCCACTGCGG - Intronic
1091472257 12:739467-739489 GAGTCGAGATTGTGCCACTGTGG - Intergenic
1092905998 12:13101219-13101241 AAGTGGAGATGGCGCGGCCCAGG - Intronic
1101516557 12:105441162-105441184 GAGCCGAGATTGTGCCAGCCTGG - Intergenic
1101680156 12:106956298-106956320 GATTGGAGCTTGCGCACCCCTGG + Intronic
1102295826 12:111735931-111735953 GAGCCGAGATTGCGCCACTGTGG - Intronic
1102700608 12:114835776-114835798 GAGCCGAGATTGCACCACCCTGG + Intergenic
1103448081 12:121007851-121007873 GAGTAGAGATGATGCCACCCAGG + Intronic
1104322057 12:127761231-127761253 GAGTGGAGAGAGTGCCAGCCGGG - Intergenic
1104386874 12:128358137-128358159 AAGTGGAGACTGTTCCACCCTGG - Intronic
1104680837 12:130750453-130750475 GAGTCTAGATTGCACCAGCCTGG + Intergenic
1106077381 13:26472447-26472469 GAGCCGAGATTGCACCAGCCTGG + Intergenic
1106573302 13:30950334-30950356 AAGTGGAGGTTGCTCCACCCTGG + Intronic
1107715968 13:43199749-43199771 CAGTGGAGATTTTGCCCCCCAGG + Intergenic
1108423490 13:50274181-50274203 GAGCTGAGATTGCACCAGCCTGG + Intronic
1115665274 14:35538015-35538037 GAGCCGAGATCGCGCCAGCCTGG + Intergenic
1115689756 14:35830409-35830431 GAGCCAAGATTGCGCCAGCCTGG - Intronic
1115705710 14:35995681-35995703 GAGCTGAGATTGCACCAGCCTGG + Intergenic
1116693471 14:48141805-48141827 GAGCCAAGATTGCGCCAGCCTGG - Intergenic
1116723668 14:48533319-48533341 GAGCTGAGATTGTGCCAGCCTGG + Intergenic
1117515103 14:56492928-56492950 CAGGGGAGATTTTGCCACCCAGG + Intronic
1117979465 14:61328194-61328216 GAGCCGAGATTGCGCCACTGCGG + Intronic
1120164770 14:81185904-81185926 GAGCCGAGATTGCACCAGCCTGG - Intronic
1120200452 14:81533346-81533368 GAGTGGAGCTTCCTCGACCCTGG - Intronic
1120996490 14:90421973-90421995 GAGCTGAGATTGAGCCAGCCTGG - Intergenic
1121032125 14:90667165-90667187 GAGTTGAGAGTGCGGCAGCCTGG + Intronic
1121550672 14:94797199-94797221 GAATGGTGAATGGGCCACCCAGG + Intergenic
1122253290 14:100456288-100456310 GAGCTGTGATTGTGCCACCCAGG + Intronic
1123707021 15:22958137-22958159 GAGCCGAGATTGCGCCAGCCCGG - Intronic
1124270827 15:28279043-28279065 GAGCGGAGATTGTGCCAGCCTGG - Intronic
1124710761 15:32008147-32008169 GAGCTGAGATTGTGCCAGCCTGG + Intergenic
1125448173 15:39780469-39780491 GAGCCGAGATTGCACCACTCCGG + Intronic
1126034216 15:44532202-44532224 GAGCAGAGATTGCGCCAGCCTGG + Intergenic
1128832811 15:70785242-70785264 GAGCTGAGATCGCGCCAGCCTGG - Intergenic
1130053822 15:80505988-80506010 GAGCCGAGATTGCGCCACTGCGG - Intronic
1132629967 16:912535-912557 GAGTGGAGGCAGCGCGACCCTGG + Intronic
1134779391 16:16881999-16882021 GAGGAGGGATTGCGCCTCCCAGG - Intergenic
1138278583 16:55755222-55755244 GAGTGGAGAGTGCCACAGCCAGG + Intergenic
1138289971 16:55838399-55838421 GAGTGGAGAGTGCCACAGCCAGG - Intergenic
1138436706 16:57004849-57004871 GAGGGGAGTTTACCCCACCCTGG - Intronic
1139061211 16:63254034-63254056 GAGCTGAGATTGCACCAGCCTGG + Intergenic
1139753474 16:69123602-69123624 GAGCCAAGATTGCTCCACCCTGG + Intronic
1140280170 16:73546597-73546619 GAGTGGAGATTGCCAGCCCCAGG + Intergenic
1144691361 17:17267282-17267304 GAGCTGAGATGGCGCCAGCCTGG + Intronic
1147205166 17:38832186-38832208 GAGCCGAGATTGCACCAGCCTGG - Intergenic
1147960253 17:44163041-44163063 GAGCGGAGATTGCGCCAGCCTGG - Intergenic
1148272109 17:46269476-46269498 GAGCCGAGATCGCGCCAGCCTGG + Intergenic
1148893842 17:50828336-50828358 GAATAGAGATCGCGCCAGCCTGG + Intergenic
1150154146 17:62836445-62836467 GAGCCGAGATCGCGCCAGCCTGG - Intergenic
1150636918 17:66919509-66919531 GAGCCAAGATTGCGCCAGCCTGG - Intergenic
1151797547 17:76356403-76356425 GAGCCGAGATTGTGCCAGCCTGG + Intronic
1158115351 18:53989632-53989654 GAGTTGAGATCACGCCAGCCTGG - Intergenic
1158384674 18:56975744-56975766 GAGTGGAGACTGTGGCACACCGG + Intronic
1159190105 18:65030160-65030182 GAGCGGAGATTGCGCCATTGCGG - Intergenic
1161317940 19:3626980-3627002 GAAAGGAGACTCCGCCACCCTGG - Intergenic
1162070362 19:8149144-8149166 GGGTGGAGATCGCGCCCCGCGGG - Intronic
1162743582 19:12786738-12786760 GGGTGGAGATTGGGCCAGACAGG - Intronic
1162920953 19:13902580-13902602 GAGCCGAGATCGCGCCAGCCTGG + Intronic
1164211482 19:23101621-23101643 GAGCGGAGATTGCACCATCAAGG - Intronic
1164322564 19:24163051-24163073 CATTGGAGATTGTGCCACCCAGG - Intergenic
1165210184 19:34229526-34229548 ATGAGGAGATTGAGCCACCCAGG + Intergenic
1165352444 19:35283224-35283246 GAGAGGAGATTTCTCCATCCTGG + Intronic
1165697694 19:37913447-37913469 GAGCTGAGATTGTGCCAGCCTGG - Intronic
1165759839 19:38314665-38314687 GAGGCGAGATTGCACCAGCCTGG - Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1167251796 19:48402661-48402683 GAGCCGAGATTGCGCCACTGCGG + Intronic
1168212578 19:54901234-54901256 GAGTCGAGATTGCGCCACTCAGG + Intergenic
1168225244 19:54989935-54989957 GAGCCGAGATTGCGCCACCTGGG + Intronic
925463660 2:4086942-4086964 GAGCTGAGATTGCACCAGCCTGG + Intergenic
927072665 2:19546817-19546839 GAGCTGAGATTGCGCCAGCCTGG + Intergenic
927129669 2:20047634-20047656 GAGCCGAGATTGCGCCACTGCGG + Intronic
927230949 2:20823703-20823725 GAGCCGAGATTGCGCCACTGCGG - Intergenic
927787813 2:25985815-25985837 GAGCCGAGATTGCACCAGCCTGG + Intergenic
928550258 2:32363276-32363298 GAGTTGTGATTGTGCCAGCCTGG + Intronic
929585875 2:43114016-43114038 GAGTGGAGATTCAGGCACCCAGG - Intergenic
930800171 2:55435638-55435660 GAGTGGATAAGGGGCCACCCGGG + Intergenic
932017554 2:68047613-68047635 GAGTGGTGATTGCACTATCCTGG - Intronic
932728899 2:74203582-74203604 GAGCTGAGATTGCTCCAGCCTGG + Intronic
933828371 2:86185124-86185146 GAGCCGAGATTGCGCCAGCCTGG + Intronic
933894980 2:86802657-86802679 GAGTGGAGATTGTGCCACTGCGG - Intronic
934308063 2:91842236-91842258 GAGTAGAGATTACGCTTCCCAGG - Intergenic
935751923 2:106242885-106242907 GAGCTGAGATTGCGCCAGCCTGG + Intergenic
935912335 2:107910434-107910456 GAGCTGAGATTGTGCCAGCCTGG + Intergenic
936115422 2:109698877-109698899 GAGCCAAGATTGCGCCAGCCTGG + Intergenic
939964123 2:148593867-148593889 GAGCCGAGATCGCGCCAGCCTGG - Intergenic
940911253 2:159211945-159211967 AAGGGGCGAGTGCGCCACCCCGG - Intronic
944091483 2:195916802-195916824 GAGTCAAGATTGCGTCAGCCGGG + Intronic
944710467 2:202330632-202330654 GAGCTGAGATTGTGCCACCTGGG + Intergenic
945615644 2:212062459-212062481 GAGCCGAGATTGCACCAGCCTGG - Intronic
946442938 2:219712204-219712226 GAGCTGAGCTTGCGCCAGCCTGG + Intergenic
1171940071 20:31319785-31319807 GAGATGAGATTGGGCCAGCCTGG - Intergenic
1172499968 20:35418742-35418764 GAGCTGAGATTGCTCCAGCCTGG - Intergenic
1174669746 20:52295872-52295894 GAGGGGAAATAGAGCCACCCCGG - Intergenic
1174920485 20:54696743-54696765 GAGCCGAGAATGTGCCACCCTGG + Intergenic
1177076589 21:16583266-16583288 GAGCCGAGATCACGCCACCCTGG - Intergenic
1178538726 21:33431623-33431645 GAGCTGAGATTGCGCCAGCCTGG - Intronic
1178618218 21:34152612-34152634 GAGTGGAGATTGGGTCGCCAAGG - Intergenic
1178857041 21:36259017-36259039 GAGCCGAGATTGCGCCAGCCTGG - Intronic
1180763014 22:18223318-18223340 GAGGGGATCATGCGCCACCCAGG + Intergenic
1180772629 22:18401229-18401251 GAGGGGATCATGCGCCACCCAGG - Intergenic
1180804009 22:18650845-18650867 GAGGGGATCATGCGCCACCCAGG - Intergenic
1180806754 22:18718604-18718626 GAGGGGATCATGCGCCACCCAGG + Intergenic
1181217710 22:21344414-21344436 GAGGGGATCATGCGCCACCCAGG + Intergenic
1181284943 22:21745148-21745170 GAGCCAAGATTGCACCACCCAGG - Intergenic
1181930901 22:26400736-26400758 GAGCCGAGATTGCACCACCTGGG + Intergenic
1182242868 22:28931078-28931100 TCGTGAAGATTGTGCCACCCTGG + Intronic
1182344158 22:29648668-29648690 GGGTGGAGATTGTGCCACCTGGG - Intronic
1183567611 22:38627041-38627063 GAGTTATGATTGCACCACCCTGG + Intronic
1184740246 22:46423920-46423942 GAGCCGAGATTGTGCCAGCCTGG + Intronic
1185258046 22:49847694-49847716 GAGTCAAGATTGGGCCATCCAGG - Intergenic
1203234467 22_KI270731v1_random:142217-142239 GAGGGGATCATGCGCCACCCAGG - Intergenic
950299983 3:11868456-11868478 GAGCTGAGATTGTGCCAGCCTGG - Intergenic
952461382 3:33529922-33529944 GAGCCGAGATTGCGCCACTGCGG + Intronic
952888568 3:38026466-38026488 GAGTGCAGTTTGCGCCATCTCGG - Intronic
953903495 3:46856818-46856840 GAGTGGGGAGTGGGCCACACTGG - Intergenic
953984901 3:47434052-47434074 CAGTGGGGAGTGCACCACCCTGG - Intronic
954229141 3:49202914-49202936 GAGCCGAGATTGCGCCACTGCGG - Intronic
954682395 3:52352826-52352848 GAGTGGAGATAGCCCAACCCTGG + Intronic
956844931 3:73174011-73174033 GAGATGAGATTGCGCCAGCCTGG + Intergenic
957089919 3:75719239-75719261 GAGTTGTGATTGCACCAGCCTGG + Intronic
958948725 3:100394402-100394424 GAGTGGACATCGTGCCCCCCTGG - Intronic
959708170 3:109358481-109358503 GAGCCGAGATTGCGCCAGCCTGG + Intergenic
960226542 3:115175809-115175831 GAGCGGAGATCGCGCCACTGCGG + Intergenic
960348043 3:116559116-116559138 GAGCTGAGATTGCACCAGCCTGG + Intronic
960591142 3:119367046-119367068 GAGCCGAGATTGTGCCAGCCTGG + Intronic
962517124 3:136162524-136162546 GAGCCGAGATTGCGCCACTGCGG + Intronic
964676543 3:159288682-159288704 GAGCCGAGATTGCGCCAGCCTGG + Intronic
965675953 3:171196806-171196828 GAGCCGAGATCGCGCCAGCCTGG - Intronic
966963673 3:184967781-184967803 GAGCGGAGATTGCACCACTGCGG + Intronic
968945771 4:3662857-3662879 GTGTGGAGATGGGACCACCCTGG + Intergenic
969295736 4:6269885-6269907 GAGTGCAGATTGCTCCCCCGCGG + Exonic
970747185 4:19312996-19313018 GAGCTGAGATTGTGCCAGCCTGG + Intergenic
971829342 4:31670791-31670813 GAGCCGAGATTGCGCCACTGTGG - Intergenic
974542941 4:63262353-63262375 GAGCCAAGATTGCGCCATCCTGG + Intergenic
975564161 4:75736359-75736381 GAGCTGAAATTGCGCCAGCCTGG - Intronic
976770547 4:88647476-88647498 GAGTGGAGTCTGAGCCACCTGGG + Intronic
978079743 4:104577803-104577825 CAGTGGAGATTTTACCACCCAGG + Intergenic
978749104 4:112227449-112227471 GAGCCGAGATTGCGCCACTGCGG - Intergenic
984745736 4:183214736-183214758 GAGCCGAGATTGCACCAGCCTGG + Intronic
985289219 4:188370374-188370396 GAGCCGAGAATGCGCCAGCCTGG + Intergenic
989632828 5:43504251-43504273 GAGCTGAGATCGCGCCAGCCTGG + Intronic
994834787 5:104835524-104835546 GAGCGGAGATTGTGCCAGCCTGG + Intergenic
1003018979 6:2493595-2493617 GATCAGAGATTGCGCCAGCCTGG - Intergenic
1005405255 6:25480772-25480794 GAGCCGAGATCGCGCCAGCCTGG - Intronic
1006332157 6:33399333-33399355 GAGCCGAGATTGTGCCAGCCTGG + Intronic
1009724815 6:67525001-67525023 GAGCCGAGATCGCGCCAGCCTGG - Intergenic
1010472270 6:76242582-76242604 CAGCTGAGATTGCTCCACCCCGG - Intergenic
1011628223 6:89300454-89300476 GAGTGGAGATTGCGCCACCCGGG + Intronic
1015791885 6:136971614-136971636 GAGCCGAGATTGTGCCAGCCTGG + Intergenic
1016098909 6:140073665-140073687 GTGTGGAGATTACGCAACACAGG - Intergenic
1019192957 6:170264178-170264200 GAGAGGTGATTTCTCCACCCAGG + Intergenic
1022664508 7:32398257-32398279 GAGCCGAGATTGCGCCAGCCTGG + Intergenic
1023426417 7:40042131-40042153 GAGCCGAGATCGCGCCAGCCTGG - Intronic
1023682955 7:42706561-42706583 GAGCCGAGATTGCGCCACTGCGG + Intergenic
1023685772 7:42733544-42733566 TAGTGCAGGTCGCGCCACCCTGG + Intergenic
1024391764 7:48821813-48821835 GAGCTGAGATTGTGCCAGCCTGG - Intergenic
1026001412 7:66561554-66561576 GAGCCGAGATTGCACCAGCCTGG + Intergenic
1026945260 7:74312193-74312215 GAGCTGAGATTGCACCACCTGGG + Intronic
1027341911 7:77218650-77218672 GAGTTGTGATTGTGCCACCTGGG - Intronic
1029022368 7:97378290-97378312 GAGCCGAGATTGCGCCACTGAGG - Intergenic
1032475152 7:132206794-132206816 GAGTGGAGATAGGGCGATCCTGG - Intronic
1034471364 7:151256222-151256244 GAGCTGAGATCGCGCCACCTGGG - Intronic
1037517617 8:19648752-19648774 GAGTGCAGTTGGCGCCACCATGG - Intronic
1039395531 8:37222308-37222330 GAGTGTAGAATGTGCCACGCAGG - Intergenic
1041520894 8:58755349-58755371 GAGCCGAGATTGCCCCAGCCTGG - Intergenic
1047651323 8:126925787-126925809 GAGAGGAGATTGGGTCACTCAGG + Intergenic
1050537646 9:6644873-6644895 GGGTGGAGATTCCGCCACTCGGG + Intronic
1050791170 9:9472255-9472277 GAGCCGAGATTGCGCCACTGCGG - Intronic
1051767669 9:20542302-20542324 GAGCCGAGATTGCGCCACTGCGG - Intronic
1053215489 9:36266853-36266875 GAGCCGAGATGGCGCCAGCCTGG + Intronic
1057482169 9:95453527-95453549 GAGTGGACACGGCGCCATCCAGG + Exonic
1058970606 9:110079307-110079329 GAGTGGAGGTTTCGCCACGTTGG - Intronic
1061751922 9:132784463-132784485 GAGCTGAGATTGCGCCATTCCGG + Intronic
1203487653 Un_GL000224v1:72489-72511 GAGTTGTGATTGCACCAGCCTGG - Intergenic
1203500274 Un_KI270741v1:14384-14406 GAGTTGTGATTGCACCAGCCTGG - Intergenic
1190306736 X:49087467-49087489 GAGTCGAGATTGTGCCACTTTGG + Intronic
1190848974 X:54219622-54219644 GAGCCGAGATCGCGCCAGCCTGG + Intronic
1196677675 X:118437980-118438002 GAGCTGAGATCGCGCCAGCCTGG + Intronic
1196694809 X:118600351-118600373 GAGCTGAGATTGTGCCAGCCTGG + Intronic
1199650570 X:149943672-149943694 GAGCCGAGATTGCACCAGCCTGG - Intergenic
1200111272 X:153742166-153742188 GAGTAGAGATTACGCTTCCCAGG - Intronic