ID: 1011628523

View in Genome Browser
Species Human (GRCh38)
Location 6:89302611-89302633
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 3, 1: 1, 2: 1, 3: 18, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011628523_1011628531 8 Left 1011628523 6:89302611-89302633 CCCTGACCGTGCCCGAGCTCACC 0: 3
1: 1
2: 1
3: 18
4: 146
Right 1011628531 6:89302642-89302664 GTTTGATGCCAAGAACATGATGG 0: 2
1: 14
2: 6
3: 22
4: 177
1011628523_1011628534 30 Left 1011628523 6:89302611-89302633 CCCTGACCGTGCCCGAGCTCACC 0: 3
1: 1
2: 1
3: 18
4: 146
Right 1011628534 6:89302664-89302686 GCTGCCCGCGACCGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 81
1011628523_1011628533 22 Left 1011628523 6:89302611-89302633 CCCTGACCGTGCCCGAGCTCACC 0: 3
1: 1
2: 1
3: 18
4: 146
Right 1011628533 6:89302656-89302678 ACATGATGGCTGCCCGCGACCGG 0: 1
1: 0
2: 0
3: 5
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011628523 Original CRISPR GGTGAGCTCGGGCACGGTCA GGG (reversed) Intronic
900083106 1:873862-873884 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
900651996 1:3734352-3734374 GCTGTGCTCCGGGACGGTCAAGG - Exonic
900675958 1:3886396-3886418 GGTGAGGAGGGGCACGGACAAGG - Intergenic
903499273 1:23792696-23792718 GGTGAGCAGGGGCACAGACATGG - Exonic
904767921 1:32864569-32864591 GGTCAGCTCGGGGACTGGCATGG - Intronic
907116524 1:51973426-51973448 GATGAGATCGGGCGCGTTCAGGG - Intronic
915268573 1:154735643-154735665 GATGCGCTGGGTCACGGTCAGGG - Intronic
915697794 1:157762076-157762098 TGTGTGCTCTGGCATGGTCAGGG - Intronic
922668738 1:227493427-227493449 GGTGAACTCAGCCATGGTCAGGG + Intergenic
922670858 1:227507872-227507894 GGTGAACTCAGCCATGGTCAGGG - Intergenic
923029389 1:230235388-230235410 GGAGAGCTCAGGCAGGCTCAGGG + Intronic
923929395 1:238676599-238676621 GATGAGATCGGGCTCGTTCAGGG + Intergenic
1062763951 10:47522-47544 GGTAAGCTCAGCCACAGTCAAGG + Exonic
1063268426 10:4479694-4479716 GGTGAGCCAGGGCACTGGCAAGG + Intergenic
1063977762 10:11430692-11430714 GGAGAGCTCTGGCACGGCCCAGG - Intergenic
1073104284 10:101023388-101023410 GGTGGGCTGGGGCAAGGCCAGGG + Intronic
1076853374 10:133103750-133103772 GGCGAGCTCCGGCCTGGTCACGG - Intronic
1077074892 11:695846-695868 GGTGAGCTCGGGCGGGGTGGGGG + Exonic
1077087785 11:763258-763280 GGTGAGGGCGGGGACGGTGAGGG - Intronic
1077535536 11:3122326-3122348 GGTGAGCCCGGGCCCGGGGAGGG - Exonic
1078145178 11:8717581-8717603 GACGAGATCGGGCACGTTCAGGG + Intronic
1080850980 11:36069941-36069963 GCTGAGGTCGGCCACGGTCTAGG - Intronic
1080971117 11:37278548-37278570 GGTGGGCTCAGCCACGGACATGG - Intergenic
1082006147 11:47420242-47420264 GGTGAGCAGGAGCACGGGCAGGG - Exonic
1084426892 11:69088988-69089010 GCTGAGCTCGGGCACAGACCGGG - Intronic
1088905740 11:114154373-114154395 GGTGAACTCGCACACAGTCATGG - Intronic
1089442717 11:118530580-118530602 GGTGGGCTGGGGCTCGGGCAAGG + Intronic
1089564562 11:119363957-119363979 GGGGTCCTCGGGCAGGGTCACGG + Intronic
1091848612 12:3677547-3677569 GGTGAGCTGAGGCACCGTAACGG - Intronic
1091917172 12:4278048-4278070 GGTGATCTGGGGCAAGGTGAGGG - Intronic
1094202450 12:27807783-27807805 GATGAGATCGGGCATGTTCAGGG + Intergenic
1094813790 12:34165232-34165254 GGTAAGCTCAGCCACGGGCAGGG + Intergenic
1095261579 12:40105231-40105253 GGTGAGTTCGGGCTCCGTGAAGG - Exonic
1102291032 12:111699867-111699889 GGGGAGCTGTGGCACAGTCATGG - Intronic
1103172043 12:118829697-118829719 GATGAGATCGGGCACGTTCAGGG - Intergenic
1113045978 13:106155452-106155474 GATGAGATTGGGCACGTTCAGGG + Intergenic
1114263674 14:21058203-21058225 GGTGAGCTCACCCATGGTCAGGG - Exonic
1116307359 14:43275202-43275224 AGTGAGTTCAGCCACGGTCAGGG - Intergenic
1119770344 14:77216803-77216825 GGAGAGCTCGGCCAGGGTCCGGG - Intronic
1119890363 14:78177883-78177905 GATGAGATCGGGCATGTTCAGGG + Intergenic
1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG + Intergenic
1124655638 15:31504401-31504423 CGTGAGCCTGGGCATGGTCAGGG - Intronic
1125722500 15:41851991-41852013 GATGAGATCGGGCATGTTCAGGG + Intronic
1131720512 15:95163398-95163420 GGTGAGGTGGGGCACGGTGACGG + Intergenic
1134060338 16:11195762-11195784 GGAGTGCTGGGGCACGATCATGG + Intergenic
1134435467 16:14252502-14252524 GGTAAGTGAGGGCACGGTCATGG + Exonic
1139438874 16:66953881-66953903 GGTGAGTTCGGGGATGCTCAGGG - Intergenic
1139757341 16:69155222-69155244 GGAGAGCAGTGGCACGGTCACGG + Intronic
1141407648 16:83808093-83808115 GGTGAGGTCCTGCACGGTCTTGG - Exonic
1141474400 16:84262890-84262912 GATGAGATTGGGCACGTTCAGGG + Intergenic
1142414756 16:89935299-89935321 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1142440697 16:90095705-90095727 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1148384044 17:47221800-47221822 GGAGAGCAATGGCACGGTCATGG + Exonic
1148462943 17:47848448-47848470 GGTGAGGGCAGGGACGGTCAGGG + Exonic
1148694786 17:49552317-49552339 GGGGAGCCTGGGCACGGTCTTGG + Intergenic
1148734704 17:49858855-49858877 GGGGAGCCGGGGCACTGTCAGGG + Intergenic
1149517502 17:57291858-57291880 GATGAGATCGGGCACATTCAGGG - Intronic
1149729393 17:58930045-58930067 GGCGAGATCAGGCACGTTCAGGG - Intronic
1150571959 17:66394325-66394347 GGTGTGCTTGGGCACAGTTAGGG + Intronic
1152335804 17:79699802-79699824 GGTGAGAACGGGCATGTTCAGGG - Intergenic
1152956858 18:47855-47877 GGTGAGCTCAGCCACAGTCAAGG + Exonic
1153225144 18:2894188-2894210 GGCGAGCTCTGGCTTGGTCAGGG + Intronic
1154204505 18:12325637-12325659 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1155068626 18:22292289-22292311 GATGAGATCGGGCACGTTCAGGG + Intergenic
1155185578 18:23383897-23383919 GGGGAGATCGGGTATGGTCATGG + Intronic
1157723745 18:49946351-49946373 GATAAGCTCAGGCACGTTCAGGG + Intronic
1158697030 18:59712724-59712746 GATGAGATCAGGCACGTTCAAGG + Intergenic
1161168099 19:2799434-2799456 GGTGACCTCGGGCAACCTCAGGG - Intronic
1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG + Exonic
1162562331 19:11423903-11423925 GGTGATCTTTGGCAAGGTCAAGG - Exonic
1163606967 19:18280962-18280984 GGGGCCCTCGGGCACGGCCACGG - Exonic
1165264872 19:34652547-34652569 GATGAGATCTGGCACGTTCAGGG + Intronic
1165320176 19:35080242-35080264 GGTGAGCTTGGGCAGGGGCTGGG + Intergenic
1166294610 19:41883006-41883028 GGAGAGCTCGGGCGCGGCCGGGG + Intergenic
927162973 2:20286902-20286924 GATGAGATCAGGCACGATCAGGG - Intronic
927175284 2:20401686-20401708 GACGAGATCGGGCACGTTCAGGG + Intergenic
932722420 2:74147799-74147821 GGTGAGCGTGGGCAGGGTCGGGG - Exonic
936529446 2:113265571-113265593 GGTGAGCTCTGACCGGGTCAGGG - Intronic
938092181 2:128441162-128441184 GTGGAGCTAGTGCACGGTCATGG + Intergenic
940103300 2:150067949-150067971 GGTGTGCAGAGGCACGGTCATGG + Intergenic
940982037 2:160014415-160014437 GATGAGATCGGGCACATTCAGGG - Intronic
944341157 2:198601563-198601585 GATGAGATCGGGCACATTCAGGG - Intergenic
947043412 2:225949781-225949803 GGTGTGCTTGGGCACTGACAGGG - Intergenic
947292790 2:228596227-228596249 GATGAGATCCGGCACGTTCAGGG - Intergenic
948058489 2:235026960-235026982 GGCGAGATCAGGCACGTTCAGGG + Intronic
948794921 2:240397579-240397601 TGTGAGCTCTGGCACAGTCCAGG + Intergenic
1171278316 20:23876782-23876804 GGTGAGCTGGGGCAGGTCCAGGG + Intronic
1171283396 20:23919344-23919366 GGTGAGCTGGGGCAGGTCCAGGG + Intergenic
1172657327 20:36545068-36545090 GGTGAGCTGGGACAGGGACAGGG + Exonic
1173166072 20:40688176-40688198 GTTCAGCTCGCGCACGGACATGG + Exonic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1176838761 21:13820271-13820293 GTCGAGCTGGGGGACGGTCAGGG - Intergenic
1179272281 21:39860802-39860824 GGTGTGCTGGGCCAAGGTCAGGG - Intergenic
1179813742 21:43889666-43889688 GATGAGATCAGGCACGTTCAGGG - Intronic
1179950521 21:44706806-44706828 GGGCAGCTTGGGCACTGTCAGGG - Intronic
1180949352 22:19714306-19714328 GGTGACCCCGGGCGCGGCCAGGG + Intergenic
950050223 3:9982833-9982855 GGAGAGCACTGGCACAGTCAAGG - Intronic
950462725 3:13135000-13135022 GCAGAGCTCGGGCCTGGTCAGGG + Intergenic
950962968 3:17124378-17124400 GGTGTGCTGGGGCACAATCACGG - Intergenic
955695557 3:61632535-61632557 GATGAGATCAGGCACGTTCAGGG + Intronic
955702852 3:61699201-61699223 GATGAGATCGGGCGCGTTCAGGG + Intronic
962192728 3:133328373-133328395 GGTGAGATCAGGCACATTCAGGG + Intronic
966370291 3:179244592-179244614 GGTGTGCACTGCCACGGTCAGGG - Exonic
967013524 3:185461203-185461225 GATGAGATTGGGCACGTTCAGGG + Intronic
968258313 3:197298411-197298433 GGTGGGCTAGGGCAAGGTAAAGG - Exonic
968357454 3:198120292-198120314 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
978735346 4:112077924-112077946 GGTGAGCTCAGCCACCATCAAGG - Intergenic
980621989 4:135319935-135319957 GGTGAGCTTGGGTAAGGTCCAGG + Intergenic
981792727 4:148557963-148557985 GATGAGATCGGGCATGTTCAGGG - Intergenic
984542476 4:181057252-181057274 GATGAGCTCAGGGACGTTCAAGG - Intergenic
985441086 4:189982958-189982980 GGTGAGCTCAGCCACAGTCAAGG + Intergenic
988967365 5:36432553-36432575 GGTGAGCTGGTGCATGTTCATGG + Intergenic
991393503 5:66176589-66176611 GATGAGATCGGGCATGCTCAGGG + Intronic
992676498 5:79111505-79111527 GGTGAGCGAGAGGACGGTCAGGG + Intronic
993502677 5:88680446-88680468 GGTGAGCACGGGCACAGTCCCGG + Intergenic
994287733 5:97990737-97990759 GATGAGATCGGGCACATTCAGGG + Intergenic
999103786 5:149050716-149050738 GATGAGATCGGGCATGTTCAGGG - Intronic
1001519604 5:172381674-172381696 GGTGTGCTCGGGAACTGCCAGGG - Intronic
1001636819 5:173216269-173216291 GATGAGATCGGGCACGTTCAGGG + Intergenic
1003392917 6:5728878-5728900 GGTGAGCTCAGGCAGGGTTTCGG - Intronic
1003406444 6:5830484-5830506 GATGAGATCAGGCACGTTCAGGG + Intergenic
1005012449 6:21348696-21348718 GGTGAGCGAGGGCACAGGCATGG - Intergenic
1007535825 6:42587821-42587843 GATGAGATCGGGCACATTCAGGG - Intronic
1008584054 6:52932976-52932998 GATGAGATCGGGCATGTTCAGGG + Intergenic
1009021223 6:57949837-57949859 GGTGATCTTGGGGAGGGTCAAGG - Intergenic
1011246415 6:85325671-85325693 GGTGAACTGGGACAAGGTCATGG - Intergenic
1011628523 6:89302611-89302633 GGTGAGCTCGGGCACGGTCAGGG - Intronic
1012031075 6:94064908-94064930 GATGAGATCAGGCACGTTCAGGG + Intergenic
1015108713 6:129567737-129567759 GGTGATCTCATGCAAGGTCATGG + Intergenic
1015636088 6:135275825-135275847 GCTGAGATCGGGCACGTTCAGGG + Intergenic
1017304310 6:152898825-152898847 GGTGAGCTCAGGCACTATGAGGG - Intergenic
1018268610 6:162052038-162052060 GATGAGATCGGGCACGTTCAGGG + Intronic
1019171812 6:170137045-170137067 GGTGCGCTCGGGCTCGGCCGCGG - Intergenic
1020057937 7:5131201-5131223 GATGAGATCAGGCACGTTCAGGG + Intergenic
1023417677 7:39948505-39948527 GGGGTGCTGTGGCACGGTCATGG + Intergenic
1024968075 7:55043103-55043125 GATGAGATCGGGCGCGTTCAAGG + Intronic
1029127745 7:98306412-98306434 GGAGAGCTCAGCCACGTTCAGGG + Intronic
1030662715 7:112238895-112238917 GATGAGGTCGGGCACGTTCAGGG - Intronic
1031822352 7:126519670-126519692 GATGAGATCAGGCACGTTCAGGG - Intronic
1033768625 7:144523232-144523254 GGTGTGCAGGGGCACGATCATGG + Intronic
1034096899 7:148417452-148417474 GTTGAGCTCAGGCACTGTCATGG + Exonic
1034426890 7:151018634-151018656 GGTGACCCCGAGCGCGGTCATGG + Exonic
1034895862 7:154875948-154875970 GGTGAGCTGGGAGACGGTGATGG + Exonic
1035965011 8:4181250-4181272 GATGAGATTGGGCACGTTCAGGG - Intronic
1036043363 8:5111812-5111834 GATGAGATCGGGCATGTTCAGGG - Intergenic
1036621374 8:10426243-10426265 TGTGAGCTGGGGCCCGGTCATGG + Intronic
1038814799 8:30891198-30891220 GGTGAGTGAGGGCACCGTCATGG + Intergenic
1045553511 8:103193527-103193549 GGTGAGCTGACACACGGTCAGGG - Intronic
1045953885 8:107884510-107884532 GGTGAGATCAGGCACGTTCGGGG - Intergenic
1047256865 8:123220476-123220498 GATAAGATCGGGCACAGTCAGGG - Intronic
1048242262 8:132754290-132754312 GATGAGATCAGGCACGTTCAGGG - Intronic
1048992867 8:139771555-139771577 GCTGAGCTCTGGCCAGGTCATGG + Intronic
1049665201 8:143839907-143839929 GGTGAGCACGGGCAAGGCCCCGG - Exonic
1051907157 9:22108403-22108425 GGTGAGATCGGGCACGTTCAGGG + Intergenic
1060995385 9:127872737-127872759 GGTCAGCTCAGGCTCGGCCAGGG - Exonic
1061062465 9:128257549-128257571 GGTGGGCACGGGCATGGGCATGG - Intronic
1061183859 9:129040641-129040663 GGGGATCTCGGCCACCGTCATGG - Exonic
1062348650 9:136127950-136127972 GGTGGGCTCAGGTACAGTCAAGG - Intergenic
1062532863 9:137009348-137009370 GGTGAGCCGGGGCAGGGCCAGGG - Exonic
1062741304 9:138176777-138176799 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1186816361 X:13241605-13241627 GATGAGATCGGGCACATTCAGGG + Intergenic
1187028526 X:15461057-15461079 TGTGAGCTCTGGCAGGCTCAGGG - Intronic
1190878294 X:54475057-54475079 GGTGGGCTAGGGCAGGGCCATGG - Intronic
1192339651 X:70253058-70253080 GATGAGATCGGGCACGTTCATGG - Intergenic
1194466443 X:94239893-94239915 GGTGGGCTTGGGCAAGATCAGGG + Intergenic
1196549150 X:117000885-117000907 GATGAGGTCGGGCGCGTTCAGGG + Intergenic
1197183553 X:123562489-123562511 TGTGAGCTCAGGCACCCTCAGGG - Intergenic
1198063720 X:133074235-133074257 GATGAGCTAGGCCACGTTCAAGG - Intronic
1201242826 Y:11975263-11975285 GGTGACCATGGGCATGGTCATGG - Intergenic