ID: 1011633248

View in Genome Browser
Species Human (GRCh38)
Location 6:89347620-89347642
Sequence CACATACCATGTAAGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011633248 Original CRISPR CACATACCATGTAAGAGCTA AGG Intronic
902310768 1:15579856-15579878 CACATACCAGGAGAGATCTAGGG + Intronic
904508590 1:30981275-30981297 CACCTATCATGAAAGAGCTATGG + Intronic
905739956 1:40361545-40361567 GAAATGCCATCTAAGAGCTAAGG - Intronic
908371502 1:63484196-63484218 CTAATACAATGTAAGTGCTATGG - Intronic
909615709 1:77606056-77606078 GAAATGCCATCTAAGAGCTAAGG - Intronic
909935639 1:81547182-81547204 ACCATACCATGCAAGAGCTGAGG + Intronic
914874581 1:151503236-151503258 CCACTACCATGTCAGAGCTAAGG - Intergenic
915188822 1:154130964-154130986 TTCATAACATATAAGAGCTAGGG + Intronic
915440108 1:155940646-155940668 CAAACCCCATGTCAGAGCTAAGG - Intergenic
916494396 1:165332024-165332046 CACATAATATGTAAGAGCCTTGG - Intronic
917364033 1:174209312-174209334 GAAATACCATCTAAGAGCCAAGG - Intronic
921621151 1:217327846-217327868 CAAATACCAGATAAGAGTTAAGG - Intergenic
922317565 1:224456328-224456350 CACATCTCATGTCTGAGCTATGG - Intronic
923758122 1:236812491-236812513 CACTTCCCATGTATGAGCTGAGG - Intronic
923954440 1:238998890-238998912 CAAATACCTTGTAAAAGATATGG + Intergenic
1063288760 10:4718387-4718409 CACATCTCAGGTAATAGCTAAGG - Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1067033015 10:42892335-42892357 CATAGACCATGTAAGAGTCAGGG - Intergenic
1069951791 10:72024076-72024098 CACATAGCAGTTAAGAGCTTGGG + Intergenic
1072900916 10:99405992-99406014 GACATAGCATGTAAGAGAGAGGG - Intronic
1075485841 10:122821425-122821447 CACCTACCATGTGCAAGCTATGG + Intergenic
1079602487 11:22326938-22326960 CACAAACCATGGAAAAGCTTGGG + Intergenic
1080296055 11:30729089-30729111 CACATACCATGGAAGAAATTAGG + Intergenic
1081799079 11:45845183-45845205 CACATTACATGTAAGACCCAGGG + Intergenic
1082895292 11:58183640-58183662 CACTTACCAGGTAAGAGCTGTGG - Intergenic
1086237376 11:84647918-84647940 CACTTACCATGTGATAGTTATGG + Intronic
1088174230 11:107032852-107032874 CTAATACCATGTAAGTACTATGG + Intergenic
1090081251 11:123614285-123614307 CACGTAACATGGAAGTGCTAGGG - Intronic
1090091602 11:123703017-123703039 CACAGACCATGTAAGGGCTTGGG + Intergenic
1090328762 11:125912794-125912816 CACATACGATAGAATAGCTAAGG - Intronic
1090372382 11:126265662-126265684 CACATACCTAGTAAGAACTGAGG + Intronic
1091242066 11:134059843-134059865 CACATATCATGTCAGAGTTATGG - Intergenic
1092414062 12:8276227-8276249 CACATATCATTTAAGAGGTTTGG - Intergenic
1098251506 12:68574622-68574644 CAGAGACCATGTAAGAGTTCTGG + Intergenic
1100807286 12:98299083-98299105 CATATACCATGTGCCAGCTATGG + Intergenic
1103076137 12:117984159-117984181 CATGTACCATGGAAGAGCTCCGG - Intergenic
1104295816 12:127511908-127511930 CAGATACCATGGAAAACCTAAGG + Intergenic
1105288972 13:19034446-19034468 CACATGTCATGTAAGTGCAATGG - Intergenic
1105781608 13:23709542-23709564 CACACAGAATGCAAGAGCTATGG - Intergenic
1107505113 13:41026146-41026168 CACATAGCATGTCAGAGGTTGGG + Intronic
1107858073 13:44634862-44634884 CACCTACCATGTAAGCACTGTGG - Intergenic
1109783196 13:67140309-67140331 CACAGAACCTGTTAGAGCTAAGG + Intronic
1111081369 13:83312796-83312818 TACATAACTTGTAAGACCTAGGG - Intergenic
1111206793 13:85020828-85020850 CACATGCCCTGTAAGAGGGATGG + Intergenic
1113536535 13:111071061-111071083 CCCAGAGCATGTAAGAGCTTTGG + Intergenic
1116124786 14:40770182-40770204 CACATACAATGTGATTGCTATGG + Intergenic
1116351432 14:43868701-43868723 TACATACCAGGTATGAGCTCAGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1119561005 14:75589733-75589755 CGCATATAATGCAAGAGCTATGG - Intronic
1121705052 14:95986176-95986198 TCCATAACATGTAAGAGCAAGGG - Intergenic
1125033634 15:35097991-35098013 GACATATCATGAAGGAGCTAGGG + Intergenic
1125120090 15:36145947-36145969 CACACAGCTTGTAAGAGCCATGG + Intergenic
1127155738 15:56122987-56123009 CAAAAACCATCTAAGAGCCAAGG + Intronic
1127718608 15:61676968-61676990 CATATAGCATGTTAGAACTATGG - Intergenic
1133611097 16:7434129-7434151 CATAAACCAGGTAAGAGCTTAGG + Intronic
1134049493 16:11127283-11127305 AAAATACCATGTAACAGTTAAGG - Intronic
1136551810 16:30986008-30986030 CACAGGCCATGTCAGAGCTGGGG - Intronic
1138942965 16:61812527-61812549 CACATACCATCTCAAAGCCATGG + Intronic
1146126139 17:30233100-30233122 CAGATTCCCTGTAAGAGCAAGGG + Intronic
1147544319 17:41388595-41388617 CACTTACCTTGTAAGTACTAGGG + Intronic
1148457172 17:47817243-47817265 CACACACCAGGTAAGATCCAGGG - Exonic
1150163494 17:62919265-62919287 CAAATTCCATATTAGAGCTAGGG + Intergenic
1150612770 17:66747559-66747581 CACATAGCTGGTAAGAGCAAAGG + Intronic
1151010679 17:70491917-70491939 CCCACACACTGTAAGAGCTATGG + Intergenic
1151036200 17:70803357-70803379 CACAGATCATTTAAGAGCTGTGG - Intergenic
1151696338 17:75720050-75720072 CAAATGCCATGTAAAAGCCATGG + Intergenic
1154470746 18:14698182-14698204 CACATGTCATGTAAGTGCAACGG + Intergenic
1154932186 18:21011345-21011367 CATATACAATGTAATATCTAGGG - Intronic
1157647808 18:49294884-49294906 CATATACCATGAAAGAATTAAGG + Intronic
1158300732 18:56049183-56049205 CAAATAGCATGTAAGAGGGAGGG + Intergenic
1159601831 18:70435577-70435599 CAAATACCATGATAGAGTTAAGG + Intergenic
1166608105 19:44163632-44163654 GGCATACTAGGTAAGAGCTAAGG - Intergenic
926477391 2:13341390-13341412 CTCATAGCATGCTAGAGCTACGG - Intergenic
927959839 2:27234257-27234279 CACAGAACATGCAAGAGCTGTGG - Intronic
928939115 2:36709221-36709243 CACGTACTATGAAACAGCTATGG + Intronic
935352929 2:102169939-102169961 CACAAACCATGTAATATCTAAGG + Intronic
939483438 2:142778624-142778646 CAAATGCCATCTAAGAGCCAAGG + Intergenic
941573887 2:167205914-167205936 CACAGACCATGTAATAACAAAGG - Intronic
941650474 2:168087109-168087131 CACACATCATGTAAGACCAAAGG + Intronic
943237175 2:185337650-185337672 GAAATACCATCTGAGAGCTAAGG + Intergenic
943785240 2:191870277-191870299 CACACACCATGTAAGAATTCAGG + Intergenic
943831773 2:192472761-192472783 GACATACCATCTAGGAGCCAAGG - Intergenic
1169005692 20:2205512-2205534 TACATACCATGACAGAACTATGG + Intergenic
1169325139 20:4669682-4669704 CACCAACCATATAAGATCTAAGG - Intergenic
1174341778 20:49901632-49901654 CACCTACCCTGGGAGAGCTAAGG - Intergenic
1176803737 21:13459746-13459768 CACATGTCATGTAAGTGCAACGG - Intergenic
1182975961 22:34624381-34624403 CACATACCATGTCTCAGCTTAGG + Intergenic
956450337 3:69368308-69368330 CACATATCCTGTGGGAGCTAAGG - Intronic
956798591 3:72737658-72737680 CTAATACAATGTAAGTGCTATGG + Intergenic
958661208 3:97069957-97069979 CACACAGCTTGAAAGAGCTAGGG - Intronic
959655600 3:108800813-108800835 AACATATCATCTGAGAGCTAAGG - Intergenic
960463140 3:117961525-117961547 CACAAACCATGAAATAGTTAAGG + Intergenic
963189210 3:142450704-142450726 CACATTACATGAAAGAACTACGG + Intronic
963701481 3:148631295-148631317 AACGTGCCATGTAGGAGCTAGGG - Intergenic
966047128 3:175565768-175565790 AACAAACCATGTAACAGATATGG - Intronic
969117246 4:4878347-4878369 CACACACCATCTCAGAGCCAAGG - Intergenic
969288664 4:6224356-6224378 GTCACACCATGTCAGAGCTAGGG + Intergenic
969388647 4:6874293-6874315 CACAGACCATGTGACAGCTGGGG + Intronic
970887763 4:21006402-21006424 CACATACCATGTAAAAGAAGAGG + Intronic
972907452 4:43768380-43768402 TACACACCATGCAGGAGCTATGG - Intergenic
975635524 4:76444400-76444422 CACATAGCCAGTAAAAGCTAGGG - Intronic
975979310 4:80138445-80138467 AACAGATCATGTAAGTGCTATGG + Intergenic
976443616 4:85105133-85105155 TACATACCTGGTAAGAGCAAAGG - Intergenic
978787549 4:112626675-112626697 CAAATACCATCTAAAAGCCAAGG + Intronic
980957093 4:139440497-139440519 CACACAGCTTGTAGGAGCTAGGG - Intergenic
983388935 4:167103317-167103339 GAAATACCATCCAAGAGCTAAGG - Intronic
984957189 4:185057169-185057191 CACATAGTATCTAAGAGCTTGGG - Intergenic
987397556 5:17439209-17439231 AACATACAAAGTAAGAGTTAAGG + Intergenic
990179956 5:53149680-53149702 CACATGCCATGTGAGAGATCAGG - Intergenic
1001571268 5:172732166-172732188 CAGGTACCAGGTAAGAGGTAGGG - Intergenic
1008063592 6:47024633-47024655 CAGATTCCATGTGAGAGCTAAGG - Intronic
1009747553 6:67837922-67837944 CACATACCATAGAAGAGTTAAGG + Intergenic
1011633248 6:89347620-89347642 CACATACCATGTAAGAGCTAAGG + Intronic
1014492919 6:122084154-122084176 CACATAATTTGTGAGAGCTAGGG + Intergenic
1016116445 6:140291080-140291102 CACATACCATCTAGGGGCTTGGG + Intergenic
1018474645 6:164128718-164128740 CACTCACCATGTATGAGTTAAGG - Intergenic
1018877570 6:167838400-167838422 CACAGACCAGGGAAGGGCTAGGG - Intronic
1019900298 7:4015271-4015293 CACATTCCAGGGAAGAGCTGAGG - Intronic
1022521109 7:31007447-31007469 CACTTACCATGTGTGAGATAGGG - Intergenic
1022592634 7:31680463-31680485 CACATAGCTAGTAAGAGCAAGGG - Intergenic
1024170310 7:46778213-46778235 GAAATACCATCTAAGAGCCAAGG - Intergenic
1024362474 7:48482767-48482789 TACATGCCATGTAACAGGTAGGG - Intronic
1031234011 7:119148525-119148547 ACCACACCATCTAAGAGCTAGGG + Intergenic
1031526259 7:122824283-122824305 CACATGGCTAGTAAGAGCTAAGG + Intronic
1032167549 7:129557409-129557431 GACATAGCACGTAAGAGCTTGGG + Intergenic
1032830715 7:135622687-135622709 CACATGCTAGGTATGAGCTAAGG - Intronic
1033496689 7:141905325-141905347 CACATAAAATGTAAGAGCCTTGG - Intergenic
1034126437 7:148675769-148675791 CAAATGCCATCTAAGAGCTAAGG - Intergenic
1034760344 7:153666783-153666805 CACAGACCATCTAAGATCAAAGG + Intergenic
1041590600 8:59577563-59577585 CACAAACCATGTAAGAAAAAAGG + Intergenic
1041925979 8:63236901-63236923 CACATGGCATGTAAGAGCAGAGG - Intergenic
1043650801 8:82589091-82589113 CACATTCCATGAAAAAGCAAAGG - Intergenic
1046715379 8:117561246-117561268 CACTTAGCATGTGAGAGCCAAGG - Intergenic
1051833466 9:21308047-21308069 CAAAGACCATGTAAGAGCTGAGG - Intergenic
1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG + Intergenic
1058799677 9:108533133-108533155 CACAAACCAGGAAAGAGATATGG + Intergenic
1187545087 X:20243214-20243236 CACATACCAGGCAAATGCTAAGG + Intronic
1187995430 X:24921176-24921198 CACATACTATGCAAGTGCAAGGG + Intronic
1193098349 X:77578857-77578879 CAAATTCCATTCAAGAGCTAAGG - Intronic
1194291102 X:92072576-92072598 GAAATACCATGTCGGAGCTAAGG + Intronic
1196490567 X:116260951-116260973 CACATGCCATGTATGAGACAGGG + Intergenic
1198663024 X:138991373-138991395 CACATATCTTGCAAGAGATATGG + Intronic
1200309453 X:155062792-155062814 CACATAGCTAGTAAGAGGTATGG - Intronic
1200608608 Y:5297151-5297173 GAAATACCATGTCGGAGCTAAGG + Intronic