ID: 1011633497

View in Genome Browser
Species Human (GRCh38)
Location 6:89349831-89349853
Sequence TGACATGTGCAGCAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 7, 3: 148, 4: 440}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011633497_1011633506 7 Left 1011633497 6:89349831-89349853 CCCACCACCTGCTGCACATGTCA 0: 1
1: 0
2: 7
3: 148
4: 440
Right 1011633506 6:89349861-89349883 CCTGATGAAGAAGCTGCCAAAGG No data
1011633497_1011633507 10 Left 1011633497 6:89349831-89349853 CCCACCACCTGCTGCACATGTCA 0: 1
1: 0
2: 7
3: 148
4: 440
Right 1011633507 6:89349864-89349886 GATGAAGAAGCTGCCAAAGGAGG 0: 1
1: 0
2: 0
3: 24
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011633497 Original CRISPR TGACATGTGCAGCAGGTGGT GGG (reversed) Intronic
900726999 1:4223100-4223122 TGACATGTTCCCGAGGTGGTCGG + Intergenic
900831349 1:4967904-4967926 TGACATGTGTCCAAGGTGGTCGG + Intergenic
900944988 1:5825923-5825945 TGACATGTGCCCAAGGTGTTCGG - Intergenic
901789425 1:11646640-11646662 TGGAATGTGCTGCAGGTGGAGGG - Intergenic
901939210 1:12649273-12649295 TTACCTGTTCAGCAGGTGGTTGG - Intronic
902541731 1:17160417-17160439 TGACATGTGCCCAAGGTGGTTGG + Intergenic
903117556 1:21190694-21190716 TGGCATGTGCCCAAGGTGGTAGG - Intergenic
904042379 1:27592359-27592381 TGACAGGTGGTGCAGGTGATGGG - Intronic
904574967 1:31499629-31499651 TGACATGTGCCTAAGGTGGTCGG - Intergenic
905023453 1:34833963-34833985 TGAGATGTGCTGCAGGTTTTGGG - Intronic
907379939 1:54078610-54078632 GGAAATGTCCAGCAGGAGGTTGG + Intronic
907504273 1:54906366-54906388 TGACATGTGCCCAAGGTGGTTGG - Intergenic
907744858 1:57203052-57203074 TGACATGTGCAGCAGCAGATTGG + Intronic
907889936 1:58627152-58627174 TTACATGTGGAGCAGGTACTTGG - Intergenic
907957623 1:59245776-59245798 TGTCATGGGCAGCAAGGGGTGGG - Intergenic
907977726 1:59448370-59448392 TGTCTTGGGCAGTAGGTGGTGGG + Intronic
908258672 1:62322281-62322303 TGACATGTGCCCAAGGTGGTCGG + Intergenic
909474017 1:76062139-76062161 TGACATGTGCCCAGGGTGGTTGG + Intergenic
910428404 1:87138298-87138320 TGACATGATCAGAAAGTGGTAGG + Intronic
910461928 1:87457157-87457179 TGACATGTGCCCAAGGTGGTCGG + Intergenic
911951723 1:104181800-104181822 TGACATGTGCCCAAGGTAGTCGG - Intergenic
912056070 1:105599363-105599385 TGACATGTGCCCAAGGTGGGGGG + Intergenic
912445122 1:109729949-109729971 TGACATGTGCCCCAGGTGGTTGG + Intronic
913487748 1:119349018-119349040 TGACATGTGCCCAAGGTGATCGG + Intergenic
914194935 1:145442301-145442323 TAGCATGTGCTGCAGGTTGTAGG - Intergenic
914358210 1:146907105-146907127 TGACATGTACGCGAGGTGGTTGG + Intergenic
914476209 1:148024868-148024890 TAGCATGTGCTGCAGGTTGTAGG - Intergenic
914495215 1:148189902-148189924 TGACATGTACACGAGGTGGTTGG - Intergenic
914918583 1:151832830-151832852 TGCCACGTGCACCAGGTGGGGGG - Intergenic
915880575 1:159667107-159667129 GAACATGTGCACAAGGTGGTCGG + Intergenic
916762623 1:167831045-167831067 CGACATGTGCCCAAGGTGGTCGG - Intronic
917119392 1:171632463-171632485 TGACATGTGTCCAAGGTGGTTGG - Intergenic
917137716 1:171803595-171803617 TGACAAGTCCAGCAGTGGGTCGG - Intronic
918240070 1:182613132-182613154 TGACATGTGCCCAAGGTGGCCGG + Intergenic
918668341 1:187179637-187179659 TGCCATGTGAAGAAGGTGCTGGG - Intergenic
919013909 1:192003869-192003891 TGAGATGTGCAGCAGGTATGAGG + Intergenic
919065692 1:192690309-192690331 TGACATGTGCCCAAGGTGGTCGG - Intergenic
920046789 1:203138270-203138292 TGGAATGTTGAGCAGGTGGTTGG + Intronic
920539276 1:206765963-206765985 TGACATGTGCCCAAGGTGGTTGG + Intergenic
920583716 1:207137354-207137376 TGACATGTGGCCAAGGTGGTCGG + Intronic
921366547 1:214379866-214379888 TGACATGTGCCCAAGGTGGTCGG - Intronic
922057516 1:222055497-222055519 TGACATGTGCCCAAGGTGGTCGG - Intergenic
922153541 1:223024192-223024214 CGACATGTGCCCCAGGTGGTTGG + Intergenic
922217279 1:223530510-223530532 TGACATGTGCCCAAGGTGGTCGG - Intergenic
922234169 1:223710936-223710958 GGACATGTGCCCGAGGTGGTTGG - Intronic
922239762 1:223748052-223748074 TGGCAGGGGCAGCAGGTGGCAGG - Intronic
922847893 1:228704275-228704297 TGACATGTGCCCAAGGTGGTTGG - Intergenic
923407436 1:233676818-233676840 TGACATGTGTCCAAGGTGGTTGG + Intergenic
923755725 1:236789499-236789521 CGACATGTGCCCAAGGTGGTGGG + Intergenic
924070979 1:240278273-240278295 TGCTATGTGCAGCAGGTGATGGG - Intronic
924643073 1:245851919-245851941 TGCCATGTGCAGCAGCATGTTGG + Intronic
924662478 1:246034379-246034401 TGACCAGTGGAGCAGGTTGTAGG + Intronic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1063143063 10:3273147-3273169 TGACATGTGCTCAGGGTGGTCGG + Intergenic
1063186893 10:3659901-3659923 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1063525555 10:6781354-6781376 TCAGATGTGCAGGAGGTGTTAGG - Intergenic
1064302698 10:14136792-14136814 TGACATGTGCCCAAGGTGGTCGG - Intronic
1064440949 10:15353142-15353164 AAACATGTCCAGCAGATGGTAGG + Intronic
1064637130 10:17379761-17379783 TGACACGTGCCCAAGGTGGTCGG - Intronic
1064756894 10:18579615-18579637 AGACATGTGCCCCAGGTGGTTGG + Intronic
1065156236 10:22872890-22872912 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1065450483 10:25851521-25851543 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1066394371 10:35004859-35004881 GTCCAAGTGCAGCAGGTGGTTGG - Intergenic
1066673259 10:37861760-37861782 TGACATGTGCCCAAGATGGTCGG + Intergenic
1067538363 10:47133863-47133885 TGACATGTGCCCAAGGTGGTAGG + Intergenic
1067682277 10:48448647-48448669 TGTCCTGTCCAGCAGGTGATTGG - Intronic
1068809072 10:61235305-61235327 TGACAAGTGCCCAAGGTGGTTGG - Intergenic
1068897876 10:62227616-62227638 TGAGATGTGCAGCAAATGGTAGG + Intronic
1069143965 10:64865426-64865448 TGATATGTGCCGGAGGTGGTCGG + Intergenic
1069550131 10:69358370-69358392 TGACATGTGCAGCACTGGGGTGG - Intronic
1069600813 10:69706116-69706138 TGACAAGTGCCCCAGGTGGTTGG - Intergenic
1069616545 10:69810243-69810265 AGACATCTGCAGCAGGTATTGGG - Intronic
1069702152 10:70434772-70434794 TGGCATGTAAAGCAGTTGGTAGG - Intronic
1070195455 10:74151961-74151983 TCACATGTGAGGCAGGTGTTAGG - Intronic
1070792624 10:79198496-79198518 TGACATGTGTGATAGGTGGTGGG + Intronic
1071492628 10:86146423-86146445 TGACATTAGGAGCTGGTGGTGGG - Intronic
1071863110 10:89696190-89696212 GAACATGTGCACAAGGTGGTTGG - Intergenic
1071905574 10:90169941-90169963 TGACATATGGAGCAGGTGCAGGG - Intergenic
1073311557 10:102546467-102546489 TGGCATGTGCTGCAGAAGGTGGG - Intronic
1073395691 10:103215519-103215541 GAACATGTGCCCCAGGTGGTTGG + Intergenic
1073483769 10:103803819-103803841 TGACATGTGCCCAAGGTGGATGG + Intronic
1073531563 10:104237274-104237296 TGACATGTGCCCATGGTGGTCGG + Intronic
1074821053 10:117178772-117178794 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1075927678 10:126266292-126266314 TGACAAGAGCAGCAGGTGCAGGG + Intronic
1076259383 10:129053797-129053819 TGAAATGTCCAGGAAGTGGTAGG - Intergenic
1076329912 10:129656555-129656577 TGACACGTGCCCCAGGTGGTCGG + Intronic
1076709560 10:132324750-132324772 TGAGATGTGCCCAAGGTGGTTGG + Intronic
1076871674 10:133197795-133197817 TGTCAGGTGCAGGAGCTGGTGGG - Intronic
1077132104 11:978193-978215 TGCCATGTGCAGCAGGAGCCCGG - Intronic
1078375495 11:10790155-10790177 TGAGTTGTGAAGCAGCTGGTGGG + Intergenic
1079070989 11:17347042-17347064 CGACATGTGCCCAAGGTGGTCGG + Intronic
1079632251 11:22692385-22692407 TGACATGTGCCCAAGGTGGTAGG + Intronic
1080335562 11:31191953-31191975 TGGCATGTCCAGCACATGGTAGG + Intronic
1080820154 11:35797999-35798021 TGACATGTCCCCAAGGTGGTCGG + Intronic
1081324779 11:41730686-41730708 TGACATGTGCCCAATGTGGTAGG + Intergenic
1082632512 11:55558806-55558828 TGACATGTGCCCAAGGTGGCTGG + Intergenic
1082635503 11:55588083-55588105 TGACATGTGCCCAAGGTGGCTGG + Intergenic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1084766064 11:71309320-71309342 TGACATATGCCCAAGGTGGTCGG + Intergenic
1084782064 11:71416601-71416623 CCACATGTCTAGCAGGTGGTTGG - Intergenic
1086369370 11:86141212-86141234 TGACTTGGGCAGCTGGTGGATGG - Intergenic
1087023642 11:93628451-93628473 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1088458322 11:110056273-110056295 TGACATGTGCCCAAGGTTGTTGG + Intergenic
1090185323 11:124735404-124735426 TGACATGTGCCCAAGGTAGTTGG - Intergenic
1090249923 11:125244189-125244211 TGACATTTGGAGCATGAGGTTGG - Intronic
1090805185 11:130198119-130198141 TGGCCTGTGGGGCAGGTGGTGGG + Intronic
1090866927 11:130709571-130709593 TGGCAAGGGCAGCAGGTGTTGGG + Intronic
1091697143 12:2635282-2635304 AGACATGTGCAGGAACTGGTAGG - Intronic
1092613752 12:10197737-10197759 GGACATGTGCCCAAGGTGGTCGG - Intergenic
1094468343 12:30778701-30778723 TGACATGTGCCCAAGATGGTTGG + Intergenic
1094614470 12:32023670-32023692 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1095552348 12:43458042-43458064 TGACATGTGCCAAAGGTGGTGGG + Intronic
1095783835 12:46088817-46088839 TGACATGTTCAGCAAGTGCTTGG - Intergenic
1095871386 12:47031912-47031934 TGACAGGTGCCCAAGGTGGTTGG + Intergenic
1095988139 12:48014226-48014248 AGATATGTGCAGGGGGTGGTGGG + Intergenic
1096774562 12:53956064-53956086 TGAATAGTGCAGCAGGAGGTAGG + Intronic
1097584745 12:61502013-61502035 TGACATGCGCCCAAGGTGGTCGG - Intergenic
1097740291 12:63233846-63233868 CGACATGTGCCCCAGGTGGTTGG + Intergenic
1098127738 12:67317839-67317861 TGAGATGTATAGCAGGTGGTTGG - Exonic
1098408993 12:70158831-70158853 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1099051013 12:77781618-77781640 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1099627513 12:85093589-85093611 TGAAATGTGCTGCCAGTGGTGGG - Intronic
1099911646 12:88841016-88841038 TGACATGTGCACAAGGTGGTAGG + Intergenic
1100619241 12:96255674-96255696 GAACATGTGCCCCAGGTGGTCGG + Intronic
1100755790 12:97749686-97749708 TGACATGTGCCCAAGGTGGTAGG - Intergenic
1101694054 12:107107844-107107866 TGACATGTGCCCAAGGTGGTAGG - Intergenic
1102910450 12:116709561-116709583 TGGCATCTGCAGCAGGATGTCGG - Intergenic
1103211682 12:119171701-119171723 GGACATGTGCCCAAGGTGGTAGG + Intergenic
1103877759 12:124141832-124141854 TGACATGTGCCCAAGGTGGTCGG + Intronic
1104103504 12:125637448-125637470 AGACATGTGCCCAAGGTGGTAGG + Intronic
1104187945 12:126450299-126450321 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1104535993 12:129618801-129618823 TGACATGTGCCCAAGGCGGTTGG + Intronic
1104538900 12:129644197-129644219 TGACATATGCCCAAGGTGGTTGG - Intronic
1104634718 12:130430544-130430566 TTACATGTGGAGCAGGTTCTGGG + Intronic
1104680763 12:130749896-130749918 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1104757112 12:131276222-131276244 TGACATGTGCCCAAAGTGGTCGG + Intergenic
1105019687 12:132807883-132807905 CAGCATCTGCAGCAGGTGGTGGG - Exonic
1107174595 13:37385680-37385702 TGACATGTGCTCAAGGTGATTGG - Intergenic
1107312853 13:39098369-39098391 TAAGAAGTGCAGCAGGTGGCAGG + Intergenic
1107824073 13:44311933-44311955 GCACATGGGCAGCGGGTGGTGGG - Intergenic
1108433690 13:50380437-50380459 TGACATGTACCAAAGGTGGTAGG + Intronic
1110124814 13:71929662-71929684 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1110869676 13:80435669-80435691 TGACATGTGCCCAAGGTGGATGG - Intergenic
1110976434 13:81841597-81841619 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1111472701 13:88705902-88705924 GGACATGTGCCTAAGGTGGTCGG + Intergenic
1112775993 13:102844895-102844917 TGACATGTGCCCAAGGTGGTTGG + Exonic
1113528608 13:111002724-111002746 TGACATTTGCCCAAGGTGGTTGG + Intergenic
1113732611 13:112652697-112652719 TGGCATGTGCCCAAGGTGGTTGG + Intronic
1113923807 13:113929369-113929391 CCACATGTGCAGCGGGAGGTGGG - Intergenic
1114229459 14:20767493-20767515 GGACATGTGCCCAAGGTGGTTGG - Intergenic
1114791719 14:25667056-25667078 TGACACATGCAGCAGCTGATTGG + Intergenic
1115274004 14:31586278-31586300 TGGCAAGTGCAGCAGTTTGTGGG + Intronic
1115735461 14:36323313-36323335 GGACTTATGCAGCAGGTGATGGG - Intergenic
1117416542 14:55501654-55501676 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1117446235 14:55806155-55806177 TGACATGTGCTCAAGGTGGTTGG + Intergenic
1118024568 14:61755939-61755961 AGACATGTGCTGAAGGTGATTGG - Intergenic
1118395423 14:65332034-65332056 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1118870849 14:69740073-69740095 TGACATGTGTCCAAGGTGGTCGG + Intronic
1119247796 14:73127919-73127941 TCACATGTGCCCAAGGTGGTCGG - Intergenic
1119450364 14:74704322-74704344 CGACATGTGCCCAAGGTGGTTGG + Intronic
1119796263 14:77400445-77400467 TGACATGTGCCCAAGGTAGTCGG + Intronic
1120402055 14:84044322-84044344 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1120618870 14:86738517-86738539 GAACATGTGCACAAGGTGGTTGG + Intergenic
1120694868 14:87633337-87633359 GGACATGTGCCCAAGGTGGTTGG + Intergenic
1120987563 14:90347488-90347510 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1121986664 14:98513470-98513492 TGTCATGGGCACCAGGGGGTTGG + Intergenic
1122434445 14:101684866-101684888 TGACATATGCCCAAGGTGGTCGG + Intergenic
1122653825 14:103243453-103243475 GAACATGTGCACAAGGTGGTCGG - Intergenic
1202891784 14_KI270722v1_random:166020-166042 TGAAATGTGCCCAAGGTGGTTGG + Intergenic
1124664289 15:31578922-31578944 TAACATGTGCCCAAGGTGGTTGG - Intronic
1126276874 15:46894318-46894340 TGACATGTGCCCTAGGTGGTCGG - Intergenic
1126707143 15:51416102-51416124 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1126946168 15:53822959-53822981 TGACATGTGTCCAAGGTGGTTGG + Intergenic
1126985595 15:54303714-54303736 CGACATGTGCCCAAGGTGGTCGG + Intronic
1127229043 15:56968773-56968795 TGACATGTGCTCAAGGTGGCTGG + Intronic
1130368665 15:83264003-83264025 TGGCATGTGCAGCCGAGGGTTGG + Exonic
1130732719 15:86515877-86515899 TGACATGTGCCCGAGGTGGTTGG + Intronic
1131008537 15:88998368-88998390 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1131422451 15:92318633-92318655 GCCCATGTGGAGCAGGTGGTAGG + Intergenic
1132272053 15:100535060-100535082 AGACATGTGCCCAAGGTGGTAGG - Intronic
1132333171 15:101026436-101026458 TGAGATGGGCAGCAATTGGTTGG - Intronic
1133407990 16:5541370-5541392 TGACATGTGCCCAAGGTAGTCGG + Intergenic
1133498825 16:6345817-6345839 CGACATGTGCGCAAGGTGGTTGG + Intronic
1134242874 16:12518644-12518666 TTAAATGTGCAGGAGGGGGTAGG - Intronic
1134330163 16:13243319-13243341 TGACATGTGCCCAGGGTGGTTGG + Intergenic
1134371732 16:13632317-13632339 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1134382358 16:13739792-13739814 TGACGTGTGCTGAAGGTGGTTGG - Intergenic
1135246178 16:20859138-20859160 TGACAGGTGCAGCATGTTGATGG + Exonic
1135323361 16:21511487-21511509 GGACATGTGCCCCAGGGGGTGGG - Intergenic
1135988031 16:27198537-27198559 TGACATGTGCCGAAGGTGGTTGG - Intergenic
1136043577 16:27599085-27599107 TTGCATGGGCAGCAGGTGTTGGG - Intronic
1136289499 16:29262829-29262851 GGACATGTGCCGCAGGGGGTTGG + Intergenic
1136870953 16:33807804-33807826 TGACATGTGCCCCAGGTGGTTGG + Intergenic
1137686696 16:50391535-50391557 TGACATTTGGCGCAGGTGGTGGG + Intergenic
1138576509 16:57910847-57910869 TGACATGTGTGCAAGGTGGTTGG - Intronic
1138947703 16:61872306-61872328 TAACATGTGCCCAAGGTGGTTGG + Intronic
1140419455 16:74806656-74806678 TGACATGTGGCTAAGGTGGTTGG - Intergenic
1141747461 16:85935345-85935367 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1142035565 16:87860571-87860593 GGACATGTGCCCCAGGGGGTGGG - Intronic
1142095238 16:88235809-88235831 GGACATGTGCCGCAGGGGGTTGG + Intergenic
1203101219 16_KI270728v1_random:1308254-1308276 TGACATGTGCCCCAGGTGGTTGG - Intergenic
1143275954 17:5710922-5710944 TGACAAGGGCAGAGGGTGGTCGG - Intergenic
1144232752 17:13225317-13225339 TCACAGGTGCAACAGGGGGTAGG + Intergenic
1144363587 17:14520437-14520459 CAACATCTGCAGCTGGTGGTTGG + Intergenic
1144615307 17:16766017-16766039 TGACATGTGTCCAAGGTGGTTGG + Intronic
1144897395 17:18549643-18549665 TGACATGTGTCCAAGGTGGTTGG - Intergenic
1144920118 17:18756381-18756403 TGACTTGTGCAAAAGGTTGTTGG - Intronic
1145134979 17:20396078-20396100 TGACATGTGTCCAAGGTGGTTGG + Intergenic
1145227506 17:21142535-21142557 AGACATGTGCCCAAGGTGGTTGG + Intronic
1145243867 17:21255006-21255028 GAACATGTGCTGGAGGTGGTCGG + Intergenic
1145747376 17:27330412-27330434 TGACATGTGCCCAATGTGGTCGG + Intergenic
1146269744 17:31477022-31477044 TGCCCTGTGGAGAAGGTGGTGGG - Intronic
1146726337 17:35159402-35159424 TAGCATGTCCAGCAGGTGGCTGG - Exonic
1148221491 17:45865454-45865476 TGACACATGCCCCAGGTGGTCGG + Intergenic
1149254382 17:54808259-54808281 GGACATGTGCCCAAGGTGGTGGG - Intergenic
1150625920 17:66841082-66841104 CGACATGTGCCCAAGGTGGTTGG + Intronic
1150956563 17:69866645-69866667 TGACATGTGCCAAAGGTGGTCGG - Intergenic
1152126036 17:78447463-78447485 TCAGATGGGCAGCAGGTGGCTGG + Intronic
1152570541 17:81119573-81119595 CGACCTGGGCTGCAGGTGGTGGG - Exonic
1154375835 18:13808985-13809007 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1155188253 18:23406325-23406347 TGTCATGGGCGGCAGGGGGTGGG + Intronic
1155935078 18:31745285-31745307 TGACATGTGCCCAAGGTGGCTGG - Intergenic
1155980830 18:32177724-32177746 TGACAGCTGCTGCATGTGGTGGG - Intronic
1156903473 18:42327821-42327843 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1156984112 18:43328841-43328863 TGACATGTGCCAAAGGTGGTTGG + Intergenic
1158098305 18:53800670-53800692 TGACAAGTTCAGCAGATGGTGGG - Intergenic
1158864588 18:61625893-61625915 TAACATGTGCCCCTGGTGGTTGG - Intergenic
1159899777 18:74035226-74035248 TGACATGTGCCCAAGGTGTTTGG - Intergenic
1159918232 18:74204551-74204573 TGACCTGTGCTGAAGGTGGTCGG - Intergenic
1160417836 18:78723950-78723972 TGACATGTGGCCAAGGTGGTTGG + Intergenic
1160558927 18:79744243-79744265 TGACATGTGCCTGAGGTGGTCGG - Intronic
1160570435 18:79813582-79813604 TGATTTGTGTAGCAGGTGGAAGG - Intergenic
1160598140 18:79991877-79991899 TGATATGTGCCCGAGGTGGTCGG + Intronic
1161977034 19:7612704-7612726 TGACCCACGCAGCAGGTGGTGGG - Exonic
1162419608 19:10558514-10558536 TGAGTAGTGCACCAGGTGGTGGG - Intronic
1163186991 19:15645775-15645797 TGATATGTGCTGCTGGTGGGTGG + Exonic
1163279599 19:16307442-16307464 TGACATGTGTCCAAGGTGGTCGG - Intergenic
1163860758 19:19741611-19741633 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1164203906 19:23041938-23041960 TGACATGTACCCAAGGTGGTCGG + Intergenic
1164314721 19:24077292-24077314 TGACAGGTGCCCAAGGTGGTTGG - Intronic
1164966932 19:32493316-32493338 TGACATGTACCCAAGGTGGTCGG + Intergenic
1166515500 19:43443740-43443762 TGACACGTGCCCAAGGTGGTAGG + Intergenic
1166713413 19:44951422-44951444 TGCCAAGTGCAGGGGGTGGTGGG + Intronic
1166973496 19:46588291-46588313 TGACATGTGCCCAAGGCGGTTGG - Intronic
1167200642 19:48062884-48062906 TGACATGTGCCCAAGGCGGTTGG + Intronic
1167750510 19:51376738-51376760 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1167916484 19:52744048-52744070 TGACATGTGCCCCAGGTGGACGG - Intergenic
1167922480 19:52793249-52793271 TGACATGTGCCCAAGGTGGACGG - Intronic
1168444675 19:56401767-56401789 TGACATGTGCCCAAGGTGGTTGG - Intronic
1168451298 19:56468560-56468582 TGACATGTGCCCAAGGTGGTCGG - Intronic
926979977 2:18558965-18558987 GGACATGTGCCCAAGGTGGTCGG - Intronic
926985045 2:18613338-18613360 TGATGTGTGAAGCAGGCGGTAGG - Intergenic
927947223 2:27142865-27142887 TGACATGTGCCCAAGGTGGTTGG - Intergenic
928682140 2:33713645-33713667 GGACATGTGCCCAAGGTGGTTGG + Intergenic
930459810 2:51658759-51658781 TGAAATGTGCAGAAGCTGGGTGG - Intergenic
931237696 2:60425417-60425439 TGACATGTGCCCAAGATGGTCGG - Intergenic
931451836 2:62374255-62374277 TGACATGTGCCCAAGGTGATCGG + Intergenic
933066830 2:77808229-77808251 GGACATGTGCCCAAGGTGGTCGG - Intergenic
933196822 2:79399984-79400006 TGACATGTGCCCAAAGTGGTTGG + Intronic
933613688 2:84462429-84462451 TGACAGGTGCCCAAGGTGGTTGG - Intergenic
934537373 2:95146561-95146583 TGTCAGGAGCAGCAGGAGGTTGG + Intronic
934955168 2:98611225-98611247 TGACATGTGCCCAAGGTGGTCGG + Intronic
936572200 2:113626599-113626621 TGACATGTGCCAAAGGTGGTCGG - Intergenic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
937078949 2:119126706-119126728 TGGGATGAGAAGCAGGTGGTGGG - Intergenic
937458667 2:122066618-122066640 TGACATGGCCAGCAGTTTGTTGG + Intergenic
937672801 2:124556816-124556838 ACACAGGTGAAGCAGGTGGTGGG + Intronic
938142069 2:128802880-128802902 TGACATGTGCCCAAGGTGGTCGG + Intergenic
938739900 2:134221177-134221199 GAACATGTGCCGAAGGTGGTTGG + Intronic
939339654 2:140877825-140877847 TGACATGTGCCAAAGGTGGTCGG - Intronic
939547972 2:143577167-143577189 TGAAATGTGGTGCAGATGGTAGG - Intronic
939825337 2:147008702-147008724 TGACCTGGGCTGGAGGTGGTTGG + Intergenic
941405581 2:165083628-165083650 TGACATGTGCCTAAGGAGGTTGG - Intergenic
941986349 2:171515335-171515357 CGACATGTGCCCAAGGTGGTTGG - Intergenic
943260452 2:185653511-185653533 GGACATGTGCGCAAGGTGGTAGG + Intergenic
943262191 2:185680132-185680154 CGACATGTGCCAAAGGTGGTTGG + Intergenic
944512137 2:200475322-200475344 TGACATGTGCCCAAGGTGGTGGG + Intronic
944516770 2:200520485-200520507 TGACATGTGCCCAAGGTTGTCGG + Intronic
944893873 2:204144467-204144489 TGACATGTGCCCAAGGTGGTCGG - Intergenic
946414094 2:219530773-219530795 AGACATGTGGGGGAGGTGGTGGG + Intronic
946656917 2:221958330-221958352 TGAGTTGGGCAGCAGCTGGTGGG - Intergenic
946822693 2:223646747-223646769 TGACATGTGCTCAAAGTGGTTGG + Intergenic
947499357 2:230660693-230660715 TGAAATGAACAGCAGGTGGCCGG + Intergenic
948221254 2:236271504-236271526 TGATATGTGCCCAAGGTGGTCGG - Intergenic
949076202 2:242059754-242059776 GAACATGTGCCTCAGGTGGTCGG - Intergenic
949076566 2:242062795-242062817 CGACATGTGCACAAGGTGGTCGG + Intergenic
1169324048 20:4661037-4661059 GCACATGTGCACAAGGTGGTTGG + Intergenic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1171292446 20:23990073-23990095 GGACCTCTGCAGCAGGTGCTAGG - Intergenic
1171506144 20:25635558-25635580 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1172175771 20:32970991-32971013 TGCCATGGGCAGCATGGGGTGGG + Intergenic
1172659289 20:36556613-36556635 TGACTTTTGCTGCAGGTGCTGGG - Intergenic
1173525939 20:43732668-43732690 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1174333184 20:49837284-49837306 CGACATGTGCCCAAGGTGGTCGG - Intronic
1174333405 20:49839427-49839449 CGACATGTGCCCAAGGTGGTTGG - Intronic
1174379882 20:50149629-50149651 TGACAGGTGCAGCAGGGAGGCGG - Intronic
1175439089 20:58978363-58978385 GGAGATGTCCTGCAGGTGGTTGG - Intergenic
1175646077 20:60672991-60673013 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1176255183 20:64148034-64148056 TGACATGTGCCCGAGGTGGTCGG + Intergenic
1176274246 20:64254933-64254955 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1177003208 21:15639020-15639042 GGACATGTGCCCAAGGTGGTCGG - Intergenic
1177176829 21:17708584-17708606 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1177254635 21:18645144-18645166 TGACATGTGCCCAAGGTGGTAGG + Intergenic
1177435641 21:21048721-21048743 GAACATGTGCCCCAGGTGGTTGG - Intronic
1177814527 21:25961320-25961342 TGACATGTGCCCAAAGTGGTTGG - Intronic
1178118014 21:29437069-29437091 TGACATGTGCCCAAAGTGGTTGG + Intronic
1178306230 21:31492663-31492685 TGACCTGTGCCCAAGGTGGTCGG - Intronic
1178448302 21:32665680-32665702 TGACATGTGCCCAAGGTGGTCGG - Intronic
1178454957 21:32740365-32740387 TGACATGTGCCCAAGGTGGTCGG - Intronic
1179345358 21:40551150-40551172 GTACATGAGCTGCAGGTGGTTGG + Intronic
1180200614 21:46221828-46221850 CGGCATGTGCAGCATGTGCTGGG - Intronic
1181124134 22:20691862-20691884 AGACCTGTGCAGCAGATGCTGGG - Intergenic
1181515299 22:23407523-23407545 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1182108587 22:27706658-27706680 TGACAGGTGGAGAAGGGGGTTGG - Intergenic
1182466308 22:30518900-30518922 GGACATGTTCAAAAGGTGGTAGG - Intergenic
1182588655 22:31362195-31362217 AGACATGTGCCCAAGGTGGTTGG + Intergenic
1183110376 22:35644473-35644495 TTACATGTGGAGCACGTGCTCGG - Intergenic
1183113167 22:35668310-35668332 GAACATGTGCTCCAGGTGGTCGG - Exonic
1183166754 22:36153796-36153818 TGACATGTGCCCAAGGTGGTTGG + Intronic
1183636174 22:39064207-39064229 TAACATGTGCCCAAGGTGGTGGG + Intronic
1184817007 22:46880150-46880172 CGACATGTGCCCAAGGTGGTCGG + Intronic
1185218018 22:49614344-49614366 TGCCGTGTGCCGCAGGTCGTTGG - Intronic
1185427991 22:50784281-50784303 TGACATGTGCCAAAGGTGGCCGG + Intergenic
949461747 3:4302196-4302218 TGACATGTGCCCAAGGTGGTTGG + Intronic
949895947 3:8767786-8767808 GGACATGAGCAGCAGCAGGTAGG + Exonic
949996268 3:9619764-9619786 TGCGCTGTGCTGCAGGTGGTAGG + Intergenic
950600721 3:14033049-14033071 TGACATGTGCCCAAGGTGGTAGG + Intronic
950855522 3:16101193-16101215 TGACATTTCCAGAGGGTGGTAGG - Intergenic
952294415 3:32048672-32048694 TGACATGACCAGCTGGTAGTTGG - Intronic
953969504 3:47336126-47336148 TCACATGTGAAGCAGAGGGTGGG + Intronic
954453237 3:50582967-50582989 TGACATATGCTGGTGGTGGTGGG - Exonic
954606689 3:51916261-51916283 TGACATGTGCCCAAGGTGGTCGG - Intergenic
954651507 3:52166956-52166978 TGACATGTGCCAAAGGTGGTTGG - Intergenic
954923455 3:54212200-54212222 TGACATATGCCCAAGGTGGTCGG + Intronic
955416360 3:58695717-58695739 GGACATGTGCCCAAGGTGGTCGG + Intergenic
956307757 3:67845120-67845142 TGACATGTGCTCAAGGTAGTCGG + Intergenic
958005159 3:87801454-87801476 CGACATGTGCCCAAGGTGGTCGG + Intergenic
958038188 3:88194374-88194396 TGACATGTGCTGAAGGTGGTCGG - Intergenic
958482900 3:94666933-94666955 TGACACGTGCTCAAGGTGGTCGG + Intergenic
958765853 3:98367400-98367422 TGACATGTGCCCAAGATGGTCGG - Intergenic
959222161 3:103534300-103534322 TGACATGTGCCGAAGGTTGTCGG + Intergenic
959752815 3:109858515-109858537 GGACATGTGCCTAAGGTGGTTGG + Intergenic
960110083 3:113837406-113837428 TGACATGTGTCCAAGGTGGTTGG + Intronic
960120558 3:113944592-113944614 TGACTTGAGCAGCTGGTGGATGG - Intronic
960834385 3:121889942-121889964 TGACTTGTGCCCAAGGTGGTTGG + Intergenic
960948319 3:122982150-122982172 TCCCATGAGCAGCAGCTGGTTGG + Intronic
961332757 3:126152665-126152687 TCACATGAGCAGCCGGGGGTAGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962120144 3:132552650-132552672 CGACATGTGCCCAAGGTGGTTGG - Intergenic
962199907 3:133392574-133392596 AGACATGTGCAGCAGGTAGCTGG - Intronic
963003522 3:140705200-140705222 TGAGATTTGCAGCAGGGGGAGGG - Intergenic
964276647 3:155015563-155015585 CGACATGTGCTCAAGGTGGTTGG - Intergenic
964726666 3:159820719-159820741 GGAAATGAGCAGTAGGTGGTTGG + Intronic
966365479 3:179182179-179182201 TAACATGTGAAGCAGTTGTTTGG + Intronic
966472206 3:180303369-180303391 TCATATAAGCAGCAGGTGGTGGG + Intergenic
966666957 3:182481944-182481966 TGACATTTTCAGGAGGTAGTGGG - Intergenic
967425578 3:189323501-189323523 TGACTTTTGCAGCAGAAGGTGGG + Exonic
968270608 3:197400453-197400475 CGACATGTGCCCCAGGTGGTCGG - Intergenic
968293708 3:197557220-197557242 TGACATGTGCCTAAGGTGGTTGG - Intronic
968379201 4:74554-74576 AGACATGTGCCCCAGGTGGTCGG + Intronic
968807193 4:2782035-2782057 TGACATGTGCCCAAGGTGGTTGG + Intergenic
968817159 4:2828080-2828102 GGCCATGTGCTGCAGGAGGTAGG - Intronic
968820599 4:2847664-2847686 TGACATGTGCCCAAGGTGGTTGG + Intronic
969199013 4:5586853-5586875 TGACATGTGCCCAAGGTGGTTGG - Intronic
969357436 4:6638467-6638489 TGACATGTGCCCAAGGTGGTTGG + Intergenic
969655173 4:8492929-8492951 CGACATGTGCCCAAGGTGGTCGG - Intronic
970829689 4:20322255-20322277 TGACATGTGCCCAAGGTGGTTGG + Intronic
970971342 4:21987851-21987873 CGACATGTGCCCAAGGTGGTTGG - Intergenic
971006752 4:22382833-22382855 TGACATGTGCTCAAGGTGGTAGG + Intronic
973580843 4:52342636-52342658 TGACATGTGCCCAAGGTGGTCGG + Intergenic
974166594 4:58212600-58212622 TGACAAGTGCCCAAGGTGGTCGG - Intergenic
974536180 4:63178753-63178775 TGACATGTGCCCAAGGTGGTTGG - Intergenic
974957126 4:68655780-68655802 TGACATGTGTCCAAGGTGGTGGG - Intronic
974962017 4:68714385-68714407 TGACACGTGCTCAAGGTGGTTGG + Intergenic
975215884 4:71753980-71754002 TGTCATGTGTAGCAAGTGGGTGG - Intronic
976543870 4:86310247-86310269 TGACATGTGCCCAAGGTGGTCGG - Intronic
976746685 4:88410153-88410175 TGACATGTGCCCAAGGTAGTGGG + Intronic
977720676 4:100236631-100236653 TGACATGTGGCCAAGGTGGTTGG + Intergenic
977894337 4:102346497-102346519 AGACATGTGCCCAAGGTGGTCGG - Intronic
978307253 4:107343905-107343927 TGACATTTCCAGCACATGGTTGG + Intergenic
978701557 4:111652826-111652848 TGACATGTGCCCAAGGTGGTCGG + Intergenic
979147813 4:117267436-117267458 TGACTTTTGGAACAGGTGGTTGG + Intergenic
979617070 4:122755131-122755153 TGACATGCGCCCAAGGTGGTAGG + Intergenic
980072058 4:128253828-128253850 TGACATGTGCCCAAGATGGTAGG + Intergenic
980471411 4:133257328-133257350 TGACATGTGCCCAAGGTAGTCGG + Intergenic
982008888 4:151088011-151088033 CGACATGTGCCCAAGGTGGTTGG + Intergenic
982113807 4:152080136-152080158 TGCCATCCACAGCAGGTGGTGGG + Intergenic
982447154 4:155505833-155505855 TGACATGTACCCAAGGTGGTTGG + Intergenic
982505591 4:156213473-156213495 TGACCTGTGCTCAAGGTGGTTGG + Intergenic
984010842 4:174369661-174369683 TGACATGTGCCCAAGGTGGTTGG - Intergenic
984096626 4:175443234-175443256 TGACATGTGCCCAAGGTGGTTGG + Intergenic
984336858 4:178403350-178403372 GCACATGTGGGGCAGGTGGTAGG - Intergenic
984399093 4:179238677-179238699 TGACATGTGCCCAAGGTGGTCGG + Intergenic
984993864 4:185408888-185408910 TGACAGGTGAGGCAGGGGGTGGG - Intronic
985073265 4:186189825-186189847 TGACAGGTGCAGGATGAGGTGGG - Intergenic
985634550 5:1029656-1029678 TGACATGTTCAGCAAATCGTGGG + Intronic
985819305 5:2148787-2148809 GGACATGTGCTCCAGGTCGTGGG + Intergenic
986170467 5:5310561-5310583 TCACATGGGGAGCAAGTGGTGGG + Intronic
986220228 5:5762367-5762389 TGACATGTGCCCAAGATGGTTGG - Intergenic
986903179 5:12462332-12462354 TGACATGTGCGCCAGAGGGTGGG + Intergenic
988726495 5:33931505-33931527 TGACATGTGCCCAAGGTGGTTGG - Intergenic
988773666 5:34456060-34456082 TGATATGTGCCCAAGGTGGTTGG + Intergenic
988932161 5:36047261-36047283 TGACATGTGCCCAAGGTGGTTGG - Intronic
990115223 5:52381476-52381498 TGACATGTGCCCAAGGTGGTAGG - Intergenic
990676865 5:58196499-58196521 TGACATGTGGAGGAGGTGATGGG + Intergenic
991117083 5:62966823-62966845 TGACACATGCCGAAGGTGGTCGG + Intergenic
991773071 5:70057923-70057945 TGACATGTCCCCAAGGTGGTGGG - Intronic
991852364 5:70933347-70933369 TGACATGTCCCCAAGGTGGTGGG - Intronic
992164835 5:74039148-74039170 TGACATGTGCCCAAGGTGGTGGG - Intergenic
992294078 5:75309678-75309700 AGATATGTCCTGCAGGTGGTGGG + Intergenic
992540298 5:77757808-77757830 TGACATGTGCCCAAGGTGGCTGG + Intronic
992542026 5:77775462-77775484 TGACATGTGCCCAAGGCGGTTGG - Intronic
993879697 5:93347987-93348009 TACAATGTGCAGCAGGTGGACGG - Intergenic
994355040 5:98785292-98785314 TAAAATTTGCAGCAGTTGGTGGG + Intronic
994420250 5:99522598-99522620 GGACCTGTGCAGCAGATGCTAGG + Intergenic
994420420 5:99523417-99523439 GGACCTGTGCAGCAGATGCTAGG + Intergenic
994420586 5:99524236-99524258 GGACCTGTGCAGCAGATGCTAGG + Intergenic
994486623 5:100390897-100390919 GGACCTGTGCAGCAGATGCTAGG - Intergenic
994486790 5:100391716-100391738 GGACCTGTGCAGCAGATGCTAGG - Intergenic
994486955 5:100392535-100392557 GGACCTGTGCAGCAGATGCTAGG - Intergenic
994776280 5:104038847-104038869 TGACATGTGCCCAAGGTTGTAGG - Intergenic
994908563 5:105872203-105872225 TGACATGTGTCCAAGGTGGTCGG + Intergenic
996795853 5:127345998-127346020 TGACATTTGCAGCACCTGGATGG - Intronic
998812163 5:145977188-145977210 TAGCATGTGCAGGAGGTAGTCGG - Intronic
1000730241 5:164826222-164826244 TGACATGTGCCCAAGGTAGTTGG + Intergenic
1002161053 5:177314366-177314388 AGACATGGCCAGGAGGTGGTGGG + Intergenic
1002390473 5:178907919-178907941 TGACAGGTGCAGCATGTTGATGG + Intronic
1003001474 6:2338769-2338791 GGACATGTGCCCAAGGTGGTTGG + Intergenic
1003471412 6:6438223-6438245 TGAGATGTGCACCAGGAGGTAGG - Intergenic
1004266618 6:14153559-14153581 AGAGATGTTCAGCTGGTGGTTGG - Intergenic
1004968113 6:20877899-20877921 TGACAGGAGCAGCAGGAAGTGGG - Intronic
1005196222 6:23287276-23287298 TGGCATGTGCAGCAGCAGCTTGG - Intergenic
1005429550 6:25741014-25741036 TGAAAGGTGGAGGAGGTGGTAGG + Intergenic
1005641151 6:27797626-27797648 TGACATGTGCCCGAGGTGGTAGG - Intergenic
1005892035 6:30147919-30147941 TGACATGTTCAGGAGCTGGCAGG - Exonic
1007340322 6:41187125-41187147 AGACATGTGCCCAAGGTGGTTGG + Intergenic
1007630789 6:43272159-43272181 TGACTTATGGAGCAGATGGTGGG - Intronic
1007654302 6:43443025-43443047 GCACCTGTGCAGCAGGTGGTTGG - Exonic
1007757148 6:44107254-44107276 AGGCATGTGGACCAGGTGGTTGG - Intergenic
1008479089 6:51966179-51966201 TGACATGTGCCCAAGGTGGTTGG + Intronic
1009658065 6:66571261-66571283 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1010167055 6:72927935-72927957 TGTAATGTGCAGAAGGTGTTAGG - Intronic
1010542509 6:77109292-77109314 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1010605192 6:77880699-77880721 TGAAGTGTGCAGCAGGAGGATGG - Intronic
1010970867 6:82261767-82261789 TGACATGTGCCCAAGGTTGTTGG - Intergenic
1011633497 6:89349831-89349853 TGACATGTGCAGCAGGTGGTGGG - Intronic
1014455651 6:121631619-121631641 TGACATGTGCCCAAGGTAGTTGG + Intergenic
1015455049 6:133416957-133416979 TCACATGGGCAGTAGGTGTTCGG - Intronic
1015775823 6:136813024-136813046 TGACATGTCCACAAGGTGGTTGG - Intergenic
1015970989 6:138742137-138742159 AGCCATGTGGAACAGGTGGTAGG + Intergenic
1016048559 6:139505835-139505857 TGACATGTGCCTAAGGTGGTCGG + Intergenic
1018102826 6:160456547-160456569 AGAAATGTGCAGAAGGGGGTGGG + Intergenic
1018138447 6:160802391-160802413 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1018362262 6:163083486-163083508 TGACATGTACCCAAGGTGGTTGG - Intronic
1018480132 6:164181704-164181726 GGACATGTGCCCAAGGTGGTCGG - Intergenic
1018844774 6:167547940-167547962 TTCCATCTGCAGCAGATGGTAGG + Intergenic
1018866515 6:167750824-167750846 TGACGTGTGCCCAAGGTGGTTGG - Intergenic
1020029079 7:4920353-4920375 GGACAGGTGCAGCAGCTGGGTGG + Intronic
1020865395 7:13554842-13554864 AGACATGGGCTGGAGGTGGTAGG - Intergenic
1021802125 7:24317417-24317439 TAACATGTGCCCAAGGTGGTTGG - Intergenic
1021882684 7:25109737-25109759 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1021892041 7:25195397-25195419 TGACAGGTGCCCAAGGTGGTAGG - Intergenic
1022940345 7:35230676-35230698 AGAAATGTGCAGCAGTTAGTAGG + Intronic
1023138692 7:37079678-37079700 TGTCATATGCTGCAGGTGATGGG - Intronic
1023278700 7:38547662-38547684 TGACATGTGCCCAAGGTGGTTGG + Intronic
1023396503 7:39756778-39756800 TGACATGTGCCCAAGGTAGTCGG + Intergenic
1024191525 7:47016473-47016495 TGACATGTGCCTAAGGTGATTGG + Intergenic
1024409115 7:49018824-49018846 TGACATGTGCCCAAGGTGGCTGG + Intergenic
1024938835 7:54740979-54741001 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1025003247 7:55335864-55335886 TGACATGTGCCCAAGCTGGTTGG + Intergenic
1025112804 7:56233887-56233909 TGACATGTGCGCAAGGTGGTCGG - Intergenic
1026108579 7:67440211-67440233 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1026174133 7:67981068-67981090 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1026200356 7:68209144-68209166 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1026291602 7:69011360-69011382 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1026510946 7:71027067-71027089 TGGAATGTGCAGGACGTGGTTGG - Intergenic
1026607609 7:71829099-71829121 TGACATGTGCACAAGGTGGTTGG - Intronic
1026610887 7:71858855-71858877 TGACATGTGCCCAAAGTGGTCGG - Intronic
1026620158 7:71943095-71943117 CGACATGTGCCCGAGGTGGTTGG - Intronic
1027903298 7:84147211-84147233 AGACATATGCAACAGGTAGTGGG - Intronic
1028318447 7:89433501-89433523 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1029339016 7:99928077-99928099 TGACATGTGCTGCAGGTCTGAGG + Intronic
1029615523 7:101654568-101654590 TGACATGTGCCCAAGGAGGTCGG + Intergenic
1030085409 7:105811535-105811557 GGAGATGTCAAGCAGGTGGTGGG + Intronic
1030782383 7:113617577-113617599 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1034109204 7:148520130-148520152 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1034940798 7:155228918-155228940 GCACATGTGCTGCTGGTGGTTGG - Intergenic
1035687045 8:1531919-1531941 GGACATGTGCCCAAGGTGGTTGG + Intronic
1036008596 8:4694731-4694753 TGACATGTGCCCAAGGTGGTTGG - Intronic
1036486397 8:9183388-9183410 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1036604534 8:10293802-10293824 TGACTGGGGCAGCAGGTGCTGGG + Intronic
1037130939 8:15407053-15407075 TGACATGTGCCCGAGGTGGTTGG - Intergenic
1037403503 8:18517657-18517679 TGACATGTGTTCAAGGTGGTCGG - Intergenic
1038105805 8:24432579-24432601 AGACATGTGCCCAAGGTGGTTGG + Intergenic
1039290734 8:36091795-36091817 TGACATGTGCCCAAGGTGCTTGG + Intergenic
1040913620 8:52545661-52545683 TGACATGTGCTTAAGGTGATTGG - Intronic
1041124260 8:54619114-54619136 AGACATGTGCATCAGGAGCTGGG - Intronic
1041492666 8:58452074-58452096 TGACATGAGCCCAAGGTGGTTGG - Intergenic
1042361181 8:67885037-67885059 TGACATGTGCCCAAGGCGGTAGG + Intergenic
1042437456 8:68783755-68783777 CGACATGTGCCCGAGGTGGTTGG - Intronic
1043577373 8:81673469-81673491 CGACATGTGCCCGAGGTGGTTGG - Intronic
1044274059 8:90279853-90279875 AGACATGTGCCCAAGGTGGTTGG + Intergenic
1045486512 8:102635801-102635823 TGACATGTGCCCAGGGTGGTCGG - Intergenic
1046457651 8:114487996-114488018 TGACATTTGCAGCAATTGGATGG + Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1047125171 8:121951878-121951900 TGGCATGTGCCCAAGGTGGTCGG - Intergenic
1047219361 8:122907218-122907240 TGACATGTGCCTAAGGTGGTTGG + Intronic
1047252277 8:123189815-123189837 CGACATGTGCCCAAGGTGGTCGG - Intronic
1048520124 8:135146117-135146139 TGACATGTGCCTAAGGTGGTTGG + Intergenic
1048621482 8:136137736-136137758 TGACATGTGCCCAAGTTGGTGGG - Intergenic
1048779020 8:137980832-137980854 TGACAGGTGCAGCTGGTGTAGGG - Intergenic
1049709366 8:144056750-144056772 TGGGACCTGCAGCAGGTGGTTGG + Exonic
1049755605 8:144310090-144310112 TTCCATGTGCAGAAGGGGGTTGG + Intronic
1049825878 8:144667441-144667463 TGACATCTGCAGTAGTTGGTAGG - Intergenic
1052022710 9:23543237-23543259 TGACATTTGCAGCAGCTTCTTGG - Intergenic
1052183534 9:25561977-25561999 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1052190352 9:25654318-25654340 TGACATGTGCCTAAGGTAGTTGG + Intergenic
1053058814 9:35012391-35012413 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1053209763 9:36217977-36217999 TGCCTTTTTCAGCAGGTGGTTGG - Intronic
1053483525 9:38434236-38434258 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1053536374 9:38930666-38930688 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1054629760 9:67433282-67433304 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1054911541 9:70459696-70459718 TGACATGTGCCCAAGGTGGATGG - Intergenic
1055019665 9:71656243-71656265 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1055054289 9:72009963-72009985 TGACATGTGCCCAAGGCGGTTGG + Intergenic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1055451854 9:76438148-76438170 TGACATGTGCCCAAGGTGGTTGG + Intronic
1055783180 9:79842604-79842626 GCACATGTGCAGCAGTGGGTTGG + Intergenic
1056600950 9:88046562-88046584 TGACATGTGCCCAAGGTGGCTGG - Intergenic
1057503907 9:95617304-95617326 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1058245252 9:102615281-102615303 TGATATGTGCCCAAGGTGGTTGG - Intergenic
1058370018 9:104255543-104255565 TAACATGTGCCCAAGGTGGTTGG - Intergenic
1058383772 9:104409270-104409292 TGACATGTGCCCAAGGTGGTAGG - Intergenic
1060084926 9:120689631-120689653 TTACCTGTGCACCAGATGGTAGG + Intronic
1061742692 9:132718680-132718702 GAACATGTGCTCCAGGTGGTTGG - Intergenic
1062039721 9:134398685-134398707 TTACATCTGGAGCAGGGGGTGGG + Intronic
1185535915 X:861552-861574 TGACATTTGCAGAAGGTATTTGG + Intergenic
1185681337 X:1890947-1890969 TGACATGTACCCAAGGTGGTTGG + Intergenic
1185740031 X:2524259-2524281 TGACATGTGCCCTAGGTGGTCGG - Intergenic
1185812228 X:3121286-3121308 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1186020823 X:5253119-5253141 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1186034278 X:5404008-5404030 TGACAAGTGCTCAAGGTGGTCGG + Intergenic
1186779714 X:12900366-12900388 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1187139904 X:16583594-16583616 CGACATGTGCCCAAGGTGGTAGG - Intergenic
1187171172 X:16853720-16853742 TGACTCGTGCAGCAGGTGCCAGG + Exonic
1187616564 X:21000898-21000920 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1188028406 X:25235681-25235703 TCACATGGTAAGCAGGTGGTGGG - Intergenic
1188157247 X:26755422-26755444 TGACATGTGCCCAAGGTGGTTGG - Intergenic
1188243612 X:27816503-27816525 GTACATGTTCATCAGGTGGTGGG + Intronic
1188643014 X:32529299-32529321 CGACATGTGCCCAAGGTGGTTGG - Intronic
1188839054 X:34992467-34992489 GGACATGTGCCCAAGGTGGTTGG + Intergenic
1188904102 X:35771947-35771969 TGACATGTGCCCAAGGTGTTTGG + Intergenic
1188905681 X:35788289-35788311 TGACATGTGCCCAAGGTGGTCGG - Intergenic
1189691915 X:43625456-43625478 TGACATGTGCCCAAGGTGGCAGG + Intergenic
1189758791 X:44299642-44299664 CGACATGTGCCCAAGGTGGTCGG - Intronic
1189862090 X:45283203-45283225 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1190076996 X:47324339-47324361 TGACATGTGCCCAAGGTGATTGG + Intergenic
1190286892 X:48967294-48967316 GGACAGGGGCAGCAGATGGTAGG - Intronic
1191669068 X:63732269-63732291 TGAAATGTGGAGCAGGCAGTAGG - Intronic
1192063383 X:67854559-67854581 TGACATGTGCCCAAGATGGTTGG - Intergenic
1193016342 X:76738264-76738286 TGAACTGTGCAGCCTGTGGTTGG - Intergenic
1193384656 X:80856093-80856115 CGACATGTGCACAAGGTGGTTGG + Intergenic
1193505280 X:82334836-82334858 TGACATGAGCCCAAGGTGGTCGG - Intergenic
1193530220 X:82647045-82647067 TGACATGTGCCCAAGGTGGCCGG + Intergenic
1194004240 X:88470712-88470734 TGACATGTACCCAAGGTGGTTGG - Intergenic
1194158312 X:90420155-90420177 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1194492492 X:94569050-94569072 TGACATGTGCCCAAGGTGGTCGG + Intergenic
1194534065 X:95084510-95084532 GGACATGTGCCCAAGGTGGTTGG + Intergenic
1194906218 X:99578623-99578645 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1194985945 X:100489930-100489952 TGACATGCGCTCAAGGTGGTCGG + Intergenic
1195292017 X:103438550-103438572 TGACATGTGCCCAAAGTGGTCGG - Intergenic
1195540149 X:106054340-106054362 TGACATGTGCCCAAGGTGGTAGG - Intergenic
1195878231 X:109564503-109564525 AGACATTTCCAGAAGGTGGTGGG - Intergenic
1196302141 X:114059508-114059530 TGACATGGGCCCAAGGTGGTTGG - Intergenic
1196542283 X:116923879-116923901 TGACATGTGCCCAAGGAGGTCGG + Intergenic
1196884966 X:120235675-120235697 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1197026331 X:121754309-121754331 TGACATGTACTAAAGGTGGTAGG + Intergenic
1197095534 X:122590180-122590202 TGCCATGAGCAGCATGTGCTTGG + Intergenic
1198058856 X:133023293-133023315 TGAAATGTGAAGAAGATGGTAGG - Intergenic
1198751354 X:139939170-139939192 TGACATGTGCCCAAGGTGGTAGG - Intronic
1198913601 X:141640376-141640398 TGACATGTGCCTGAGGTGGTCGG - Intronic
1199166855 X:144686484-144686506 TGACATGTGTCCCAGGTGGTTGG - Intergenic
1199222825 X:145337327-145337349 TGAAATGTGCCTTAGGTGGTCGG - Intergenic
1199251255 X:145664866-145664888 TGACATGTGCCCAAGGTGATTGG - Intergenic
1199332264 X:146576240-146576262 TGACATGTGCCCAAGGTGTTTGG + Intergenic
1199356933 X:146873713-146873735 TGACATGTGCTCATGGTGGTCGG - Intergenic
1199377362 X:147129555-147129577 AGACATGTGCCTAAGGTGGTTGG - Intergenic
1200056080 X:153461994-153462016 GAACATGTGCACAAGGTGGTTGG - Intronic
1200293694 X:154895753-154895775 TGAAATGTCCAGCAGGCAGTAGG - Intronic
1200504637 Y:3997119-3997141 TGACATGTGCCCAAGGTGGTTGG + Intergenic
1201269125 Y:12237318-12237340 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1201320024 Y:12688184-12688206 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1201409699 Y:13687027-13687049 TGATATGTGCCCAAGGTGGTTGG + Intergenic
1201580942 Y:15511665-15511687 TGACATGTGCCCAAGGTGATTGG + Intergenic
1201906285 Y:19088781-19088803 TGACATGTGCCCAAGTTGGTAGG - Intergenic