ID: 1011636573

View in Genome Browser
Species Human (GRCh38)
Location 6:89380264-89380286
Sequence GTGTTTATTCATAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011636573_1011636576 9 Left 1011636573 6:89380264-89380286 CCATCCACTTTATGAATAAACAC 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1011636576 6:89380296-89380318 GATGTCAGTATTCACTTTGTAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1011636573_1011636577 15 Left 1011636573 6:89380264-89380286 CCATCCACTTTATGAATAAACAC 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1011636577 6:89380302-89380324 AGTATTCACTTTGTAGGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1011636573_1011636578 26 Left 1011636573 6:89380264-89380286 CCATCCACTTTATGAATAAACAC 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1011636578 6:89380313-89380335 TGTAGGCCCTGGTCACCGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
1011636573_1011636579 29 Left 1011636573 6:89380264-89380286 CCATCCACTTTATGAATAAACAC 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1011636579 6:89380316-89380338 AGGCCCTGGTCACCGTGAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011636573 Original CRISPR GTGTTTATTCATAAAGTGGA TGG (reversed) Exonic
905552634 1:38855804-38855826 GTTTTTATTCACAAAGTTGATGG - Exonic
907228149 1:52968977-52968999 GTTACTATTCATTAAGTGGAAGG + Intronic
909001208 1:70219781-70219803 GTGCTTATACAGAAAATGGATGG - Intronic
909684477 1:78331780-78331802 GTATTTATTCCAAAGGTGGATGG + Intronic
910676039 1:89817945-89817967 CTGTGTCTTCATATAGTGGAAGG - Intronic
912420078 1:109536723-109536745 ATGTTTATTGAAGAAGTGGATGG + Intergenic
914709079 1:150196565-150196587 GTGAATATTCATAAAGAGGGGGG - Intergenic
915684031 1:157613005-157613027 GTGTTTTTTCATATACTGGTTGG - Intergenic
915750409 1:158204256-158204278 GTCTTTATTCACAATGTGGTTGG + Intergenic
916489997 1:165293747-165293769 CTGTGTCTTCATAGAGTGGAAGG + Intronic
916546665 1:165812040-165812062 TTGTTTATTCAAAAAATGTAAGG - Intronic
917863628 1:179172489-179172511 GTGTTTATTCATCCAGGGCAAGG + Intronic
917942023 1:179932164-179932186 GATTTGATTCATAAAGTGCATGG + Intergenic
918794340 1:188873600-188873622 GTCCTTATCCATAAAGTGCAAGG - Intergenic
918888819 1:190236204-190236226 GTGTTTATTGATAGAGAGAAAGG + Intronic
919151511 1:193706359-193706381 TTGTTTATTCATAAGGTAGGAGG - Intergenic
919856645 1:201710872-201710894 GTGTGTATTCCCAAAGAGGAAGG - Intronic
920385119 1:205565779-205565801 GTGGTTATTCTTAAATTTGAAGG - Intergenic
921159659 1:212463952-212463974 GTGTTTATTCAGAAGCTGCAGGG + Intergenic
921645530 1:217611544-217611566 TTGTTTTTTCTTAACGTGGAAGG - Intronic
922861695 1:228823339-228823361 GTGTTTATCCACATAGAGGACGG + Intergenic
924545577 1:245023784-245023806 GTGTTTATTTTTAACGTGAATGG + Intronic
1063517792 10:6713490-6713512 GTTTTTATGGATAAAGGGGATGG - Intergenic
1063587003 10:7361554-7361576 ATGTTTATTCATGAAGTGTGAGG - Intronic
1063880253 10:10523840-10523862 GTGTTCATTTATTAAATGGAAGG + Intergenic
1063979567 10:11442795-11442817 GAATTTAATCATAAAGTGGGGGG - Intergenic
1065239311 10:23689344-23689366 GTGATCATCCATAAAGTGGTTGG + Intergenic
1067092885 10:43279110-43279132 GTGTTTATCCATAAAATAAAAGG + Intergenic
1068316286 10:55347260-55347282 GTTTTTTTACATAAAGGGGAAGG + Intronic
1069235168 10:66062087-66062109 TTCTTTATTAATAAAATGGAGGG + Intronic
1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG + Intergenic
1071268200 10:83983060-83983082 TTCTTTAATCATATAGTGGAAGG + Intergenic
1074044343 10:109823390-109823412 CTGATTATTCATAAAGGGGTAGG + Intergenic
1075242383 10:120790969-120790991 GGGATTCTTCAGAAAGTGGAGGG - Intergenic
1076106883 10:127830639-127830661 GTGATTATTCATAAGGGGGTGGG + Intergenic
1079384117 11:19963754-19963776 GTGCTTATGCAGAAAGTGAATGG + Intronic
1080074326 11:28130934-28130956 GTGTCTATTCATGAAGGAGAGGG - Intronic
1082681902 11:56184133-56184155 CTGTGTCTTCATATAGTGGAAGG + Intergenic
1084241865 11:67826706-67826728 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1087779108 11:102284690-102284712 ATGTTTATCCATAAAATGAAAGG - Intergenic
1089025451 11:115265124-115265146 GTGTATATTCAAGAAGGGGAGGG - Intronic
1089167811 11:116490687-116490709 CTGTTAATTCTTAAAGTGGGTGG + Intergenic
1090859760 11:130642537-130642559 GTGTTTCTGAGTAAAGTGGATGG + Intergenic
1093099211 12:15006952-15006974 TTTTTTATTTATAAAATGGATGG - Intergenic
1093364172 12:18272100-18272122 GTGTTTATTCCTAAATTGCATGG + Intronic
1093776427 12:23080392-23080414 CTATTTATTTATAAAGTGTATGG - Intergenic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1094093736 12:26679505-26679527 GTGTTTCTTCTTAGAGGGGAGGG - Intronic
1095273962 12:40256994-40257016 ATTTTTATTCATAGAGTAGATGG - Intronic
1097461570 12:59870267-59870289 GGATTTACTCATATAGTGGAAGG + Intergenic
1098285137 12:68899162-68899184 GTGTGGATTCAGAAAGTGGAAGG + Intronic
1098287218 12:68919704-68919726 CTGTTTCTTCATAAATTGAAAGG + Intronic
1100318669 12:93468918-93468940 CTGAGTATTCATTAAGTGGAAGG + Intronic
1100700607 12:97143866-97143888 GTGTTTTTTAATAAAGGGGAAGG + Intergenic
1100888023 12:99093882-99093904 GTGTTTATTCTTAAGGGTGAAGG + Intronic
1101519226 12:105466197-105466219 GTGTTTATACATAAAATATACGG - Intergenic
1101623580 12:106416361-106416383 GTGTTCATTCTTAAACTGAATGG - Intronic
1107742721 13:43469639-43469661 GTGTATGTTCATATATTGGAAGG + Intronic
1108243024 13:48486891-48486913 GAGTTAATTCATAAATTAGAGGG + Intergenic
1108824132 13:54391031-54391053 TTATTTATTCATAAAGGGGTGGG - Intergenic
1108953615 13:56122030-56122052 GTTTTTATTCATAAAATGAAAGG + Intergenic
1109182664 13:59232207-59232229 GTATTTATTTACAAAGTGAAAGG + Intergenic
1109913877 13:68954091-68954113 GCGTTTTTTCATAAGGTGGCAGG - Intergenic
1112404973 13:99111349-99111371 CTGTTTATTCATTAAGGTGATGG + Intergenic
1112720733 13:102241719-102241741 CTCTTTCTTCATTAAGTGGATGG - Intronic
1115076722 14:29401589-29401611 GTGTTTAATCATTAAGTATAAGG + Intergenic
1116765203 14:49062168-49062190 GTGTCTCTTTATAAAGTGAAGGG - Intergenic
1118004899 14:61556678-61556700 GTGTTTAGTCATAATGTTGACGG - Intronic
1119298237 14:73550554-73550576 ATGATTATTCATAAGGTGGTGGG - Intronic
1119302527 14:73582738-73582760 ATGATTATTCATAAGGTGGTGGG - Intergenic
1122051146 14:99060945-99060967 GAGCTTATGCATAAAGTGGCTGG - Intergenic
1123166051 14:106325826-106325848 TTGTTTATTCATTATTTGGATGG - Intergenic
1126516787 15:49548348-49548370 GCATTTATTCCTGAAGTGGAAGG - Intronic
1127040037 15:54964469-54964491 GTCTTTATTCATGAAGTGGTTGG - Intergenic
1127700981 15:61500842-61500864 ATGTTATTCCATAAAGTGGAAGG - Intergenic
1127827489 15:62717842-62717864 GTTTTTGTCCATTAAGTGGATGG + Intronic
1133353367 16:5117614-5117636 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1138865400 16:60812448-60812470 TAGTTTATTCAAAAAGTGCAAGG + Intergenic
1140159752 16:72476481-72476503 GGGTTTTTTCAAAAAGTGGGAGG - Intergenic
1140651096 16:77089469-77089491 TTGGTTATTCAAAAACTGGAAGG - Intergenic
1141852677 16:86658143-86658165 CTGTTTGTTCATAAACTGGGAGG - Intergenic
1144061451 17:11586425-11586447 ATGTTTATTTATAAAGGAGAAGG - Intergenic
1150371381 17:64641733-64641755 GTGTTTATTCAGATGGTGGCTGG - Intronic
1155383106 18:25246336-25246358 GTGAATATTCATAATGTAGAAGG + Intronic
1156621863 18:38862189-38862211 GTCTATATTCATAAACTGGAAGG + Intergenic
1157929091 18:51800722-51800744 GGGTTGATTCATTAAGAGGATGG - Intergenic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1162522824 19:11192179-11192201 CTGTTTATTCAGTAAGTGGCAGG - Intronic
1164912314 19:32022923-32022945 GAGTTGATTTATAAAGTGAAGGG - Intergenic
1165886287 19:39081299-39081321 GGGTGTATTCACACAGTGGAGGG + Intergenic
1168437155 19:56328138-56328160 GTGTTTACTCCTTAGGTGGATGG + Intronic
926943759 2:18166277-18166299 TTGTTTCTTCATAATGTTGATGG + Intronic
926951616 2:18249451-18249473 GTGTTTCTTCAAAAGGTGGTAGG - Intronic
927910729 2:26897488-26897510 GGGTTTATTCAAAAAATGCAAGG - Intronic
931041080 2:58301239-58301261 TTGTTTATTCATGAATTGGTGGG + Intergenic
931162878 2:59713435-59713457 GTATTTATAAATAAACTGGAAGG + Intergenic
931466833 2:62496445-62496467 GTGTTATTTCATCAAGTAGATGG - Intergenic
931974535 2:67628868-67628890 TTGTGTATTCTTAAAGTGGGAGG + Intergenic
932499724 2:72173247-72173269 GTGCTTATTCTTAAAGCTGATGG - Intergenic
932843659 2:75111819-75111841 GTGGTTGTCCATAAAGTGGTAGG + Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933374349 2:81460454-81460476 GAGTTTATTCATCATGTTGATGG - Intergenic
936172188 2:110185987-110186009 GTGTTTGTTCAGTAAGGGGATGG + Intronic
937052510 2:118903984-118904006 GTGCTTATTCATAAAGTGTCAGG - Intergenic
938413595 2:131086073-131086095 ATGTTTATTCCTAAACTGTAGGG - Intronic
939719442 2:145629788-145629810 GCGTTTCTACATAAAATGGAAGG + Intergenic
940771161 2:157840834-157840856 GTAGTTAATGATAAAGTGGACGG - Intronic
942042037 2:172076395-172076417 GTGTTTATTCAGAAACTGTGTGG + Intronic
943898571 2:193401974-193401996 TTTTTTTTTCATAAAGTGTAAGG + Intergenic
944890075 2:204108491-204108513 CTGTCCATTCATAAAGTGGAGGG + Intergenic
946355535 2:219182208-219182230 GTGCGTGTTCACAAAGTGGAGGG - Exonic
1176728940 21:10470196-10470218 GTGTATATACATAACGTGTAGGG - Intergenic
1179393789 21:41018671-41018693 GTGATTATTCATTAAGTACACGG + Intergenic
1182210522 22:28672668-28672690 GTATTTAGTCAAAGAGTGGAAGG - Intronic
1182342741 22:29637153-29637175 GTTTTTATTCATAAACTGAAAGG - Intronic
1183577788 22:38702802-38702824 GTGTTAAATCATAACGTTGAGGG - Intergenic
949716926 3:6943862-6943884 ATGTTTGTTCATTAAGTGTACGG + Intronic
951747191 3:25992340-25992362 TTGATTATTCATAAAGAGGTGGG - Intergenic
952586801 3:34903014-34903036 GAGTATCTTCATATAGTGGAAGG - Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
958951650 3:100423617-100423639 GTGTATTCTCATAAAGTGAACGG - Intronic
960180483 3:114569884-114569906 GTGTTTATGCATAAAAGTGAAGG - Intronic
961296125 3:125886112-125886134 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
961611353 3:128142436-128142458 GTATTTATTGATTAAATGGATGG - Intronic
962488059 3:135864074-135864096 GGGTTTATTCCTAAAGCAGAAGG - Intergenic
964085326 3:152810640-152810662 GAGTTTTTTCATAACGTTGAAGG + Intergenic
964459397 3:156906145-156906167 GTGTTTCATTATAGAGTGGAGGG + Intronic
964503091 3:157369902-157369924 GTGTTTACTCATAGAGTGGTGGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965089156 3:164141394-164141416 GTATTTATTCTTAAAGAGGCTGG - Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965400998 3:168212263-168212285 GTGTTAATTTATAAGGTGGGTGG - Intergenic
965970860 3:174554951-174554973 ATGTTTCTTCACATAGTGGAAGG + Intronic
966017271 3:175156051-175156073 GTGTTTATTTCCAAAGTGGTAGG + Intronic
966673917 3:182564262-182564284 GTGTTTATTAAAATAATGGATGG + Intergenic
967334353 3:188325873-188325895 GTGTTTATTCAGGAACTGAATGG + Intronic
969753862 4:9134627-9134649 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
969965157 4:10986474-10986496 CTGTGTCTTCATATAGTGGAAGG - Intergenic
970544130 4:17109408-17109430 ATGTTTTGTCACAAAGTGGATGG - Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971187791 4:24397392-24397414 GGATTTATTCCTAAAGAGGAAGG - Intergenic
971680716 4:29696459-29696481 GTGTATATGCATAAAGTTAAGGG + Intergenic
972076640 4:35098426-35098448 GAGTTCATTCATAAGGTGTATGG - Intergenic
973657949 4:53069877-53069899 ATGTATATTATTAAAGTGGAAGG - Intronic
973669705 4:53203751-53203773 GTGTTTATTCTAAAATTGGGAGG + Intronic
974206898 4:58715816-58715838 TTGTTTATTCAAAAAATGGAGGG - Intergenic
976237910 4:82920349-82920371 GTGAATATTCAAAAATTGGAAGG + Intronic
976358923 4:84154591-84154613 GTGTTCATATAGAAAGTGGATGG - Intergenic
977017764 4:91714748-91714770 GTATACATTCATAAAGTGCAAGG - Intergenic
978906402 4:114011224-114011246 GAGTTTCTTCATAATGTTGATGG + Intergenic
979295557 4:119029551-119029573 GTTTTTATTATTAAAGTGGAAGG + Intronic
979525898 4:121716683-121716705 GTTTTTATTCTTAAATTCGAAGG - Intergenic
982007490 4:151077283-151077305 GTGTTTTTTCTTAAACTGAATGG + Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
984207435 4:176802050-176802072 GTTTATATTCATAAAGGGGAAGG - Intergenic
985613696 5:906433-906455 CTGTTTATTAAAACAGTGGAGGG - Intronic
986590593 5:9365372-9365394 GTCTTTATTCAAAATGTTGATGG - Intronic
987102933 5:14608382-14608404 GTGTGTCTTCACATAGTGGAAGG + Intronic
987171207 5:15260166-15260188 GTCTCTATTCAAAAAGTGAATGG - Intergenic
989308630 5:39987091-39987113 GTGTTAATTCTTACAGTGTAAGG - Intergenic
990190505 5:53254722-53254744 CTGTCTTTTCATCAAGTGGATGG - Intergenic
990617635 5:57523568-57523590 TTGTTTATTCACAGAATGGAAGG - Intergenic
991439549 5:66632489-66632511 GTGTTTATTTAGTAGGTGGAGGG + Intronic
992104914 5:73442448-73442470 GTATTTATTGCTAAAGTCGAAGG + Intergenic
992975028 5:82107201-82107223 CTGTTTATACATAAAGTCGGTGG + Intronic
993217943 5:85049219-85049241 GGGCTGATTCATAAAGTGCATGG - Intergenic
993806172 5:92412639-92412661 CTCTATCTTCATAAAGTGGATGG - Intergenic
994513031 5:100731981-100732003 GTGTTTAAACAGAAAGTGCAAGG + Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
996493370 5:124125509-124125531 GTGTTTGTACATAAAGTTGCTGG + Intergenic
998900700 5:146850506-146850528 GTGTGTGTTCAAAAAGTGAAAGG - Intronic
999094865 5:148968881-148968903 GATTTTATTCATCATGTGGATGG + Intronic
1000477447 5:161728662-161728684 GTGTTTATTCAGTAATAGGAGGG + Intergenic
1000557844 5:162749037-162749059 TTTTTTATTCCTCAAGTGGAAGG - Intergenic
1003356395 6:5376920-5376942 GTGATTATTTATGATGTGGAAGG + Intronic
1005156195 6:22809590-22809612 GTATTTATGCACAAAGTAGAAGG - Intergenic
1005618735 6:27600646-27600668 ATGTTTATTCAAAAAGTGGCAGG - Intergenic
1006254552 6:32820098-32820120 GTGACGATTCATGAAGTGGAAGG + Intronic
1011636573 6:89380264-89380286 GTGTTTATTCATAAAGTGGATGG - Exonic
1012556186 6:100515219-100515241 GTTTTTATTCATAATTTTGATGG + Intronic
1012831253 6:104206068-104206090 GTGTGTCTTCACATAGTGGAAGG - Intergenic
1014104042 6:117543111-117543133 ATGTTTATTCCTAAAGAAGACGG - Exonic
1014222092 6:118807784-118807806 ATGTTAATTCATAAAGTGAGAGG - Intergenic
1015305508 6:131702229-131702251 AAGTTTAATCTTAAAGTGGAAGG + Intronic
1016248204 6:142013017-142013039 ATGTTTCTTCATATAGTAGAGGG - Intergenic
1016253946 6:142081119-142081141 CTGTTTATTCAAATGGTGGAAGG + Intronic
1018426762 6:163690193-163690215 GTGTTTAATCAGCAAGTGGTGGG + Intergenic
1019834354 7:3367044-3367066 GTTTTTATTTCTAAAGAGGAAGG + Intronic
1021456963 7:20839978-20840000 GTGTTTAGTCATAAGATGGGGGG + Intergenic
1021854069 7:24836419-24836441 GTGTTAATACATAAATAGGAAGG - Intronic
1024022431 7:45384511-45384533 CCGTTCATTCAAAAAGTGGATGG - Intergenic
1025226320 7:57167546-57167568 GTTTTTAGTTTTAAAGTGGAAGG - Intergenic
1027630021 7:80592852-80592874 GAGTAAATACATAAAGTGGAAGG + Intronic
1031304158 7:120103124-120103146 GAGTTTATTCTTTAAGTGTAGGG + Intergenic
1032476591 7:132215349-132215371 CTCTTTATTCATAAAATGAAGGG + Intronic
1032617615 7:133491939-133491961 GTGGTTAAGCATAAAGTGTATGG + Intronic
1033002945 7:137526908-137526930 CTCTTTATGGATAAAGTGGATGG + Intronic
1033739621 7:144260460-144260482 AAGTTTAATCTTAAAGTGGAAGG + Intergenic
1033801309 7:144905599-144905621 GTGTTTATTCAAAAAGTTGGGGG + Intergenic
1034403207 7:150880150-150880172 GGGTTTGTTCAGACAGTGGAAGG - Intergenic
1035121334 7:156570336-156570358 GTGCTTCTTCATATCGTGGAAGG + Intergenic
1039329258 8:36518953-36518975 ATGATTATTCATAAAGAGGTGGG + Intergenic
1040718404 8:50287338-50287360 GTTTTTATTCATAAAGACAAGGG - Intronic
1040974537 8:53175439-53175461 TTGTTTAGTCATTAAGAGGATGG + Intergenic
1041356367 8:57005110-57005132 GGGTTTATTCCTAAAATGGAAGG - Intergenic
1043522666 8:81063275-81063297 GTTTTTATTCCTAAAGTGGCAGG + Intronic
1043973077 8:86554353-86554375 GTGTTTATTCAATAAGTTAAAGG - Intronic
1045079696 8:98612237-98612259 TTGTTTATTCATAATGTCCATGG - Intronic
1046100086 8:109603892-109603914 GTGGTAAATCTTAAAGTGGAAGG + Intronic
1047166041 8:122439538-122439560 CTCATTATTCATAAACTGGAAGG + Intergenic
1047228724 8:122978023-122978045 GTGTCTATTCATATCGTGGCAGG + Intergenic
1048850990 8:138645284-138645306 ATGATTATTCATAAAGAGGTGGG - Intronic
1050219540 9:3371773-3371795 GTCTTTATTCAAATAGAGGAAGG + Intronic
1050288159 9:4125650-4125672 GTGTGTATTCAGAAAGAGAACGG + Intronic
1050596463 9:7209346-7209368 GTGTTTATTATCAAAATGGATGG + Intergenic
1051396681 9:16629909-16629931 GTGTCTACTCATAAAATAGACGG + Intronic
1051779113 9:20669450-20669472 GTGTTGCTTCATAAATTGTAAGG + Intronic
1052094979 9:24373064-24373086 GTTTCTATTCATAAAGTAGAAGG + Intergenic
1052102164 9:24461578-24461600 TTGTTTTTTCATCAAGTGAAAGG - Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1058779638 9:108319851-108319873 GGCTTTATTGATAAAATGGAAGG + Intergenic
1059593137 9:115685963-115685985 GGGGTTATTCATTAAATGGAAGG - Intergenic
1186250444 X:7660318-7660340 GTGTTCATTCATCCAGTGGTGGG + Intergenic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1193856070 X:86603921-86603943 GTGTTTATTTTTAAAGTGTTTGG + Intronic
1194230588 X:91318434-91318456 GGGTTTATTCAAAAAATGCAAGG + Intergenic
1194786086 X:98086030-98086052 GTGTTAATTTATAAAGTAAATGG + Intergenic
1196256808 X:113529630-113529652 GTGATTATTCATGAAGGGGAAGG + Intergenic
1197312779 X:124926680-124926702 GTGTTTATTCATTAAAGGGAAGG - Intronic
1198493325 X:137165699-137165721 GTGTTTATCCATTGATTGGAGGG + Intergenic
1201143780 Y:11050469-11050491 AGGTTTATTCATAAGGTTGAAGG + Intergenic