ID: 1011637393

View in Genome Browser
Species Human (GRCh38)
Location 6:89387054-89387076
Sequence GACCTAGGAAACCTCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011637393_1011637395 19 Left 1011637393 6:89387054-89387076 CCATCAGTGAGGTTTCCTAGGTC 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1011637395 6:89387096-89387118 AATTGTTCCCTAATGCTCAATGG 0: 1
1: 0
2: 1
3: 7
4: 127
1011637393_1011637396 20 Left 1011637393 6:89387054-89387076 CCATCAGTGAGGTTTCCTAGGTC 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1011637396 6:89387097-89387119 ATTGTTCCCTAATGCTCAATGGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011637393 Original CRISPR GACCTAGGAAACCTCACTGA TGG (reversed) Intronic
901321427 1:8342576-8342598 GACCCAGGAAACAGCACAGATGG - Intronic
901657169 1:10776011-10776033 GACCGAGCAGACCCCACTGATGG - Intronic
902561421 1:17279959-17279981 AACCTATAAAACCTGACTGATGG + Intronic
902695837 1:18140364-18140386 GACCCAGGAAACATCAGTGAGGG - Intronic
904754137 1:32758832-32758854 AACCTAGGAATCCTCACTCCAGG + Intronic
908941539 1:69440941-69440963 GCCCTAGGAAACCTAACACATGG - Intergenic
909012603 1:70351891-70351913 TTCCTAGGACACCTCACTGTAGG + Intronic
915822058 1:159034735-159034757 GAGCTAGGAAAGCTCACAAAGGG - Intronic
915969928 1:160347463-160347485 GAGGTAGAAAACCTCATTGAAGG + Intronic
916085593 1:161266731-161266753 GAACTAGGAATCCTTACTGCAGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
919434709 1:197543618-197543640 TTCCTAGGAAACCTCTCTGGTGG - Intronic
923097026 1:230783557-230783579 GACCTAGGAAACTACAATCATGG - Intronic
923477573 1:234349306-234349328 GGCGTAGGAAATCTCTCTGATGG - Intergenic
1063078114 10:2736677-2736699 GCCCAAGGACACCTGACTGAAGG + Intergenic
1064790687 10:18954817-18954839 GACACAGGAAACCTCTCTCAGGG - Intergenic
1066386488 10:34945845-34945867 GATCTAGGAACCCTCTCTTAGGG - Intergenic
1068190309 10:53643019-53643041 GTCATTAGAAACCTCACTGAAGG - Intergenic
1071251324 10:83822819-83822841 GCCCTGGGAAACCTTCCTGAAGG + Intergenic
1073505368 10:103983312-103983334 GAGAGAGGAAACCGCACTGAAGG - Intronic
1075411524 10:122231980-122232002 GGCCAAGGAGACCTCACTGCGGG - Intronic
1077653751 11:3998743-3998765 GATCTAGAAAACTTCACAGAAGG + Intronic
1080660074 11:34288689-34288711 GACCTTGGAAACGTGGCTGAGGG - Intronic
1081071514 11:38616045-38616067 GACCTAGCTAAGATCACTGATGG - Intergenic
1083136842 11:60686917-60686939 GCCCTCGGAAATCTCACTGTCGG + Intergenic
1084560703 11:69904127-69904149 GACCTAGGACTCGTCACTGGTGG + Intergenic
1085991449 11:81851726-81851748 AAGCTATGAAACCTAACTGAGGG + Intergenic
1089222938 11:116890252-116890274 GACCTATGACTCCTCTCTGAGGG + Intronic
1093122848 12:15293940-15293962 GAGCTAGTGAACCTCATTGAAGG - Intronic
1093137417 12:15468881-15468903 GACCCAGAAAACCTTAGTGAAGG + Intronic
1097155983 12:57012692-57012714 GGCCGAGGAACCCTCACTGAAGG + Intronic
1097908429 12:64944320-64944342 GTCCTGGGAAATCTCTCTGAAGG + Intergenic
1101405350 12:104423720-104423742 GACTTCAGTAACCTCACTGAGGG + Intergenic
1101574401 12:105984062-105984084 CTCCTAGGAACCCCCACTGAGGG + Intergenic
1108116295 13:47132286-47132308 AGCATAGCAAACCTCACTGAGGG - Intergenic
1108601547 13:51999427-51999449 TACCTAAGTAAGCTCACTGAAGG + Intronic
1109011151 13:56946403-56946425 GTCCTCTGAAACCTCACTGATGG + Intergenic
1110039753 13:70738319-70738341 TATCTAGCAAACATCACTGAAGG - Intergenic
1111771195 13:92598030-92598052 GACCTAGGAACCTTGACTCAGGG - Intronic
1116803116 14:49464133-49464155 GGCCTTGGAAACCACACTGAGGG + Intergenic
1117339119 14:54778862-54778884 GACCCAGGATCCCTCACTGAAGG + Intronic
1119391866 14:74296268-74296290 GACCTGGGAGAGCTGACTGAGGG + Intronic
1121548618 14:94781305-94781327 GAACTAGGAAGTCTTACTGATGG + Intergenic
1121657704 14:95609909-95609931 GACCTTGGGAACCAGACTGAAGG - Intergenic
1124966053 15:34434330-34434352 AACCTGGGAAACCTCACAGCCGG + Intronic
1124982665 15:34580415-34580437 AACCTGGGAAACCTCACAGCCGG + Intronic
1125108920 15:36007466-36007488 GCACTAGGAAGCCTCACTGTAGG - Intergenic
1128100993 15:64999727-64999749 GACTGGGGAAACCTTACTGAGGG - Intergenic
1130937250 15:88480840-88480862 GACCAAGGTACCTTCACTGAAGG + Intergenic
1142969616 17:3602452-3602474 GACCCAGAAAACCACACTGATGG - Intergenic
1143739206 17:8940430-8940452 GACCCAGGAAAACTCACGAAGGG + Intronic
1145033914 17:19526680-19526702 GATCATGAAAACCTCACTGAAGG - Intronic
1147773377 17:42883232-42883254 GAACAAGAAAACCTCTCTGATGG + Intergenic
1153512206 18:5868441-5868463 GACCTTGGACAGCTCACAGAGGG - Intergenic
1153840372 18:9001920-9001942 AGCCTAGGTACCCTCACTGAAGG + Intergenic
1158027156 18:52913800-52913822 GAACAAGAAAACCTCCCTGAGGG + Intronic
1162474644 19:10892673-10892695 TACCTAGGAATCCTCACTGCAGG + Intronic
1164586510 19:29479258-29479280 GACCCAGGAAAGCTGCCTGATGG - Intergenic
925248763 2:2410727-2410749 GATCAAGAAGACCTCACTGATGG + Intergenic
925446291 2:3929756-3929778 GAGCTAGGCAACCTCCTTGAAGG - Intergenic
932835513 2:75032204-75032226 GTCCTAGAAATCCTCACTTAGGG - Intergenic
933886694 2:86724402-86724424 TACCTTGGACACCTCACTGCAGG - Intronic
933923486 2:87072305-87072327 TACCTTGGACACCTCACTGCAGG + Intergenic
943022445 2:182591502-182591524 GACCTGGGATACCACCCTGATGG + Intergenic
947814943 2:233030507-233030529 GGCCTAGGAAACCGGGCTGATGG - Intergenic
948329831 2:237156227-237156249 GCCCTAGGATGCCTCACTGAGGG + Intergenic
1173519129 20:43686294-43686316 GAGCTAGGAAGCCTGACTGAGGG + Intronic
1180222578 21:46368626-46368648 AACCTCAGAGACCTCACTGAGGG - Intronic
1184365430 22:44048003-44048025 GGCCAAGCACACCTCACTGATGG - Intronic
1184793306 22:46715372-46715394 GACCTTGCAAACTTCACTTATGG - Intronic
952785717 3:37152879-37152901 GTCCTTGGAAAGCTGACTGATGG - Intronic
952819150 3:37471047-37471069 GCCCCAGGAGACTTCACTGAAGG - Exonic
954798383 3:53172947-53172969 GAGCCAGGGAACCTCACTGCAGG + Intronic
956829853 3:73035550-73035572 GACCTAGCAATCCCCACTGCTGG + Intronic
959131636 3:102363488-102363510 GACCTAGGAAACATCTTTGGGGG + Intronic
960714391 3:120560756-120560778 GAGCTGGGGAACATCACTGACGG - Intergenic
961091656 3:124118073-124118095 CATCCAGGAAACCTCCCTGAGGG + Intronic
964162429 3:153661442-153661464 GACCTAGGAAACATCATTTCTGG - Intergenic
965550770 3:169962818-169962840 GTCCTAGGAAACCATACTTAAGG - Intergenic
969998556 4:11340526-11340548 GCTCTTGGAAACCTCACTAATGG + Intergenic
971783152 4:31065098-31065120 GAACTAAGACACCTCTCTGAGGG + Intronic
972765058 4:42145255-42145277 GACCAAGGAAACCACACTACAGG + Intronic
975042726 4:69763742-69763764 AAGCTAGGAAAACACACTGAAGG + Intronic
975942828 4:79668367-79668389 GCCTTAGCAAACCTCACTCAAGG + Intergenic
976377872 4:84365422-84365444 GACATAGGAAGCCTCACTCAAGG + Intergenic
977444166 4:97107787-97107809 GCCCAAAGAAACCTCACAGATGG - Intergenic
978955718 4:114610172-114610194 GACCTAGGAAACCTGAATGCTGG + Intronic
978983294 4:114979016-114979038 CACCAAGGATACCTAACTGATGG - Intronic
979111057 4:116757617-116757639 GACCTAGAAATCCTCATTCAAGG + Intergenic
979411754 4:120387844-120387866 GACCAAGGAACCATCACTGAGGG + Intergenic
979520639 4:121662492-121662514 GAACTAGGAATTCTCACAGATGG - Intergenic
979862268 4:125708071-125708093 GGCCAAGGAAACCTCTATGATGG - Intergenic
981969376 4:150648383-150648405 GATCTAAGAAACCTGACTGAAGG + Intronic
983532403 4:168824717-168824739 GACCTAGTATAACTCACTTAAGG + Intronic
985510731 5:312110-312132 GAGCTCGGAGACCCCACTGAGGG - Intronic
988524036 5:31970817-31970839 GACCTAGGAAATCCCCCTAAAGG + Intronic
996630055 5:125620031-125620053 GACCTAGGAAACGTTACAAATGG + Intergenic
1002791121 6:438468-438490 GATCTAGGAAAACTGGCTGAAGG + Intergenic
1006934999 6:37711191-37711213 GACCTAGGAAGGCTTAATGAAGG + Intergenic
1007158165 6:39766468-39766490 AACCTAAGAAAACTCCCTGATGG + Intergenic
1007360642 6:41353020-41353042 GACCGAGGAATCCTCAGAGAGGG - Intergenic
1007654256 6:43442769-43442791 GACCTAGGAAAGCTGAGTGCTGG + Intronic
1007784936 6:44274421-44274443 GGCGTAGGAAGTCTCACTGAGGG + Intronic
1007855485 6:44851554-44851576 GACCTAGGATAACTCAATGATGG - Intronic
1011637393 6:89387054-89387076 GACCTAGGAAACCTCACTGATGG - Intronic
1020905697 7:14061633-14061655 GTCCTAGGAAACTTCTCTGGAGG + Intergenic
1023682648 7:42703313-42703335 AACCTAGAAAGCCTCACTAATGG - Intergenic
1024358636 7:48444653-48444675 GAACAAGGAAACCTCAGTTAGGG - Intronic
1026028712 7:66770023-66770045 GACATAGGAATTCTCACTTACGG - Intronic
1029812030 7:103058957-103058979 CACATAGGAAATCTCACTGTTGG + Intronic
1031015440 7:116570618-116570640 GACATGGGAGACCTCTCTGAGGG - Intergenic
1039518749 8:38153717-38153739 GACTCAGGAAACCTGCCTGAAGG + Intergenic
1041257112 8:55988806-55988828 GATCAAAGGAACCTCACTGAGGG - Intronic
1043963337 8:86443710-86443732 GTTAGAGGAAACCTCACTGATGG + Intronic
1048844782 8:138595964-138595986 CACCTGGGCAGCCTCACTGAAGG - Intronic
1050733563 9:8737073-8737095 GACCTATGAATGCTCACTCAGGG + Intronic
1052712253 9:32071019-32071041 GACCTGAGAAACCTGAATGATGG - Intergenic
1060040353 9:120295089-120295111 GATCAAGGAAACCCCTCTGAAGG + Intergenic
1062112045 9:134787322-134787344 GACCCAGGAAACCTCAGTGCAGG - Intronic
1189951651 X:46238168-46238190 GATCTAGCAAACATCATTGATGG + Intergenic
1191653000 X:63561956-63561978 GACCTAGGATTCCTGATTGAGGG - Intergenic
1192905543 X:75546783-75546805 AACCAAGGAAATCTAACTGATGG - Intergenic
1195089175 X:101442180-101442202 GCGCTAGGAATCCTCCCTGATGG - Intronic
1196182566 X:112708512-112708534 AAACTAGAAAACATCACTGAAGG - Intergenic